Virulence Determinants and Multidrug Resistance of Escherichia coli Isolated from Migratory Birds
Abstract
1. Introduction
2. Results
2.1. Prevalence of E. coli Isolates
2.2. Prevalence of the Virulence Genes Associated with the APEC Pathotype
2.3. Pearson Correlation Coefficients for Pairs of APEC-Associated Virulence Genes
2.4. Antibiogram Profiles of Isolated E. coli Associated with the APEC Pathotype
2.5. Pearson Correlation Coefficients for Pairs of Antibiotics to Assess Antibiotic-Resistant E. coli Isolates
2.6. Prevalence of MDR E. coli
3. Discussion
4. Materials and Methods
4.1. Study Area
4.2. Sampling and Initial Processing
4.3. Isolation of E. coli
4.4. Molecular Detection of E. coli
4.5. Molecular Detection of APEC-Associated Virulence Genes
4.6. Antibiotic Susceptibility Test
4.7. Statistical Analyses
4.7.1. Descriptive Analysis
4.7.2. Bivariate Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- BirdLife International. IUCN Red List for Birds. Available online: http://www.birdlife.org (accessed on 20 December 2020).
- Benskin, C.M.H.; Wilson, K.; Jones, K.; Hartley, I.R. Bacterial pathogens in wild birds: A review of the frequency and effects of infection. Biol. Rev. 2009, 84, 349–373. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mircea, G.; Ioana, D.; Emoke, P.; Mihaela, N.; Marina, S. Wild birds as potential vectors for pathogen dissemination on migration routes in the Danube Delta Wetlands. Int. J. Curr. Micobiol. Appl. Sci. 2014, 3, 890–897. [Google Scholar]
- Zhao, G.; Zhou, L.; Dong, Y.; Cheng, Y.; Song, Y. The gut microbiome of hooded cranes (Grus monacha) wintering at Shengjin lake, China. Microbiology 2017, 6, e00447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hird, S.M.; Sánchez, C.; Carstens, B.C.; Brumfield, R.T. Comparative gut microbiota of 59 neotropical bird species. Front. Microbiol. 2015, 6, 1403. [Google Scholar] [CrossRef] [Scilit]
- Rahman, M.T.; Sobur, M.A.; Islam, M.S.; Ievy, S.; Hossain, M.J.; El Zowalaty, M.E.; Rahman, A.T.; Ashour, H.M. Zoonotic Diseases: Etiology, Impact, and Control. Microorganisms 2020, 8, 1405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hopkins, K.L.; Davies, R.H.; Threlfall, E.J. Mechanisms of quinolone resistance in Escherichia coli and Salmonella: Recent developments. Int. J. Antimicrob. Agents 2005, 25, 358–373. [Google Scholar] [CrossRef] [Scilit]
- Foxman, B. The epidemiology of urinary tract infection. Nat. Rev. Urol. 2010, 7, 653–660. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nolan, L.K.; Barnes, H.J.; Vaillancourt, J.P.; Abdul-Aziz, T.; Logue, C.M. Colibacillosis. In Diseases of Poultry, 13th ed.; Swayne, D.E., Glisson, J.R., McDougald, L.R., Nolan, L.K., Suarez, D.L., Nair, V.L., Eds.; John Wiley and Sons: New York, NY, USA, 2013; pp. 751–805. [Google Scholar]
- Ievy, S.; Islam, M.S.; Sobur, M.A.; Talukder, M.; Rahman, M.B.; Khan, M.F.R.; Rahman, M.T. Molecular Detection of Avian Pathogenic Escherichia coli (APEC) for the First Time in Layer Farms in Bangladesh and Their Antibiotic Resistance Patterns. Microorganisms 2020, 8, 1021. [Google Scholar] [CrossRef] [Scilit]
- Allan, B.J.; van den Hurk, J.V.; Potter, A.A. Characterization of Escherichia coli isolated from cases of avian colibacillosis. Can. J. Vet. Res. 1993, 57, 146–151. [Google Scholar] [PubMed]
- Johnson, T.J.; Wannemuehler, Y.; Doetkott, C.; Johnson, S.J.; Rosenberger, S.C.; Nolan, L.K. Identification of minimal predictors of avian pathogenic Escherichia coli virulence for use as a rapid diagnostic tool. J. Clin. Microbiol. 2008, 46, 3987–3996. [Google Scholar] [CrossRef] [Scilit]
- Al-Kandari, F.; Woodward, M.J. Genotypic and phenotypic diversity differences of presumptive commensal and avian pathogenic E. coli. Br. Poult. Sci. 2019, 60, 79–86. [Google Scholar] [CrossRef] [Scilit]
- Díaz-Sánchez, S.; Sánchez, S.; Ewers, C.; Höfle, U. Occurrence of avian pathogenic Escherichia coli and antimicrobial-resistant E. coli in red-legged partridges (Alectoris rufa): Sanitary concerns of farming. Avian Path. 2012, 41, 337–344. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Tang, P.; Tan, D.; Wang, L.; Zhang, S.; Qiu, Y.; Dong, R.; Liu, W.; Huang, J.; Chen, T.; et al. The pathogenicity of chicken pathogenic Escherichia coli is associated with the numbers and combination patterns of virulence-associated genes. Open J. Vet. Med. 2015, 5, 243. [Google Scholar] [CrossRef]
- Nie, W.; Wang, J.; Xu, J.; Yao, L.; Qiao, D.; Xue, F.; Tang, F.; Chen, W. A molecule capturer analysis system for visual determination of avian pathogenic Escherichia coli serotype O78 using a lateral flow assay. Microchim. Acta 2020, 187, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mellata, M. Human and avian extraintestinal pathogenic Escherichia coli: Infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog. Dis. 2013, 10, 916–932. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manges, A.R.; Johnson, J.R. Food-borne origins of Escherichia coli causing extraintestinal infections. Clin. Infect. Dis. 2012, 55, 712–719. [Google Scholar] [CrossRef] [Scilit]
- Orubu, E.S.F.; Zaman, M.H.; Rahman, M.T.; Wirtz, V.J. Veterinary Anti-Microbial Resistance Containment in Bangladesh: Evaluating the National Action Plan and scoping the evidence on implementation. J. Glob. Antimicrob. Resist. 2019, 21, 105–115. [Google Scholar] [CrossRef] [Scilit]
- Bonnedahl, J.; Järhult, J.D. Antibiotic resistance in wild birds. Upsala J. Med. Sci. 2014, 119, 113–116. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.; Huang, Y.; Rao, D.; Zhang, Y.; Yang, K. Evidence for Environmental Dissemination of Antibiotic Resistance Mediated by Wild Birds. Front. Microbiol. 2018, 9, 745. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Allen, H.K.; Donato, J.; Wang, H.H.; Cloud-Hansen, K.A.; Davies, J.; Handelsman, J. Call of the wild: Antibiotic resistance genes in natural environments. Nat. Rev. Microbiol. 2010, 8, 251–259. [Google Scholar] [CrossRef] [Scilit]
- Radhouani, H.; Poeta, P.; Gonçalves, A.; Pacheco, R.; Sargo, R.; Igrejas, G. Wild birds as biological indicators of environmental pollution: Antimicrobial resistance patterns of Escherichia coli and Enterococci isolated from common buzzards (Buteo buteo). J. Med. Microbiol. 2012, 61, 837–843. [Google Scholar] [CrossRef] [Scilit]
- Radimersky, T.; Frolkova, P.; Janoszowska, D.; Dolejska, M.; Svec, P.; Roubalova, E.; Cikova, P.; Cizek, A.; Literak, I. Antibiotic resistance in faecal bacteria (Escherichia coli, Enterococcus spp.) in feral pigeons. J. Appl. Microbiol. 2010, 109, 1687–1695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hasan, B.; Melhus, A.; Sandegren, L.; Alam, M.; Olsen, B. The gull (Chroicocephalus brunnicephalus) as an environmental bioindicator and reservoir for antibiotic resistance on the coastlines of the Bay of Bengal. Microb. Drug Resist. 2014, 20, 466–471. [Google Scholar] [CrossRef] [Scilit]
- Shobrak, M.Y.; Abo-Amer, A.E. Role of wild birds as carriers of multi-drug resistant Escherichia coli and Escherichia vulneris. Braz. J. Microbiol. 2014, 45, 1199–1209. [Google Scholar] [CrossRef] [Scilit]
- Ong, K.H.; Khor, W.C.; Quek, J.Y.; Low, Z.X.; Arivalan, S.; Humaidi, M.; Chua, C.; Seow, K.L.G.; Guo, S.; Tay, M.Y.F.; et al. Occurrence and Antimicrobial Resistance Traits of Escherichia coli from Wild Birds and Rodents in Singapore. Int. J. Environ. Res. Public Health 2020, 17, 5606. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramey, A.M.; Hernandez, J.; Tyrlöv, V.; Uher-Koch, B.D.; Schmutz, J.A.; Atterby, C.; Järhult, J.D.; Bonnedahl, J. Antibiotic-Resistant Escherichia coli in Migratory Birds Inhabiting Remote Alaska. EcoHealth 2017, 15, 72–81. [Google Scholar] [CrossRef] [Scilit]
- Hussong, D.; Damare, J.M.; Limpert, R.J.; Sladen, W.J.; Weiner, R.M.; Colwell, R.R. Microbial impact of Canada geese (Branta canadensis) and whistling swans (Cygnus columbianus columbianus) on aquatic ecosystems. Appl. Environ. Microbiol. 1979, 37, 14–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fleming, R.; Fraser, H. The Impact of Waterfowl on Water Quality—Literature Review; Ridgetown College—University of Guelph: Ridgetown, ON, Canada, 2001. [Google Scholar]
- Ibrahim, D.R.; Dodd, C.E.; Stekel, D.J.; Ramsden, S.J.; Hobman, J.L. Multidrug resistant, extended spectrum beta-lactamase (ESBL)-producing Escherichia coli isolated from a dairy farm. FEMS Microbiol. Ecol. 2016, 92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rashid, M.; Rakib, M.M.; Hasan, B. Antimicrobial-resistant and ESBL-producing Escherichia coli in different ecological niches in Bangladesh. Infect. Ecol. Epidemiol. 2015, 5, 26712. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Literak, I.; Vanko, R.; Dolejska, M.; Čížek, A.; Karpíšková, R. Antibiotic resistant Escherichia coli and Salmonella in Russian rooks (Corvus frugilegus) wintering in the Czech Republic. Lett. Appl. Microbiol. 2007, 45, 616–621. [Google Scholar] [CrossRef] [Scilit]
- Fahim, K.M.; Ismael, E.; Khalefa, H.S.; Farag, H.S.; Hamza, D.A. Isolation and characterization of E. coli strains causing intramammary infections from dairy animals and wild birds. Int. J. Vet. Sci. Med. 2019, 7, 61–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dotto, G.; Menandro, M.L.; Mondin, A.; Martini, M.; Tonellato, F.R.; Pasotto, D. Wild birds as carriers of antimicrobial-resistant and ESBL-producing Enterobacteriaceae. Int. J. Infect. Dis. 2016, 53, 59. [Google Scholar] [CrossRef] [Scilit]
- Foti, M.; Rinaldo, D.; Guercio, A.; Giacopello, C.; Aleo, A.; De Leo, F.; Fisichella, V.; Mammina, C. Pathogenic microorganisms carried by migratory birds passing through the territory of the island of Ustica, Sicily (Italy). Avian Pathol. 2011, 40, 405–409. [Google Scholar] [CrossRef] [Scilit]
- Hubálek, Z. An annotated checklist of pathogenic microorganisms associated with migratory birds. J. Wildl. Dis. 2004, 40, 639–659. [Google Scholar] [CrossRef] [Scilit]
- Chui, L.; Couturier, M.R.; Chiu, T.; Wang, G.; Olson, A.B.; McDonald, R.R.; Antonishyn, N.A.; Horsman, G.; Gilmour, M.W. Comparison of Shiga toxin-producing Escherichia coli detection methods using clinical stool samples. J. Mol. Diagn. 2010, 12, 469–475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kmet, V.; Drugdova, Z.; Kmetova, M.; Stanko, M. Virulence and antibiotic resistance of Escherichia coli isolated from rooks. Ann. Agric. Environ. Med. 2013, 20, 273–275. [Google Scholar] [PubMed]
- Bertelloni, F.; Lunardo, E.; Rocchigiani, G.; Ceccherelli, R.; Ebani, V. Occurrence of Escherichia coli virulence genes in feces of wild birds from Central Italy. Asian Pac. J. Trop. Med. 2019, 12, 142–146. [Google Scholar]
- Hultgren, S.J.; Duncan, J.L.; Schaeffer, A.J.; Amundsen, S.K. Mannose-sensitive haemagglutination in the absence of piliation in Escherichia coli. Mol. Microbiol. 1990, 4, 1311–1318. [Google Scholar] [CrossRef] [Scilit]
- Subedi, M.; Luitel, H.; Devkota, B.; Bhattarai, R.K.; Phuyal, S.; Panthi, P.; Shrestha, A.; Chaudhary, D.K. Antibiotic resistance pattern and virulence genes content in avian pathogenic Escherichia coli (APEC) from broiler chickens in Chitwan, Nepal. BMC Vet. Res. 2018, 14, 113. [Google Scholar] [CrossRef] [Scilit]
- Camarda, A.; Circella, E.; Giovanardi, D.; Pennelli, D.; Battista, P.; Campagnari, E.; Bruni, G.; Tagliabue, S. Avian Pathogenic Escherichia coli in Audouin gulls (Larus audouinii) Could they affect the surviving of the bird colonies? Ital. J. Anim. 2007, 6, 317–320. [Google Scholar] [CrossRef] [Scilit]
- Frömmel, U.; Lehmann, W.; Rödiger, S.; Böhm, A.; Nitschke, J.; Weinreich, J.; Groß, J.; Roggenbuck, D.; Zinke, O.; Ansorge, H.; et al. Adhesion of human and animal Escherichia coli strains in association with their virulence-associated genes and phylogenetic origins. Appl. Environ. Microbial. 2013, 79, 5814–5829. [Google Scholar] [CrossRef] [Scilit]
- Najdenski, H.; Dimova, T.; Zaharieva, M.M.; Nikolov, B.P.; Petrova-Dinkova, G.; Dalakchieva, S.; Popov, K.S.; Hristova-Nikolova, I.P.; Zehtindjiev, P.; Peev, S.G.; et al. Migratory birds along the Mediterranean—Black Sea Flyway as carriers of zoonotic pathogens. Can. J. Microbiol. 2018, 64, 915–924. [Google Scholar] [CrossRef] [Scilit]
- Blanco, G.; Lemus, J.A.; Grande, J.; Gangoso, L.; Grande, J.M.; Donázar, J.A.; Arroyo, B.; Frías, O.; Hiraldo, F. Retracted Geographical variation in cloacal microflora and bacterial antibiotic resistance in a threatened avian scavenger in relation to diet and livestock farming practices. Environ. Microbiol. 2007, 9, 1738–1749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruzauskas, M.; Vaskeviciute, L. Detection of the mcr-1 gene in Escherichia coli prevalent in the migratory bird species Larus argentatus. J. Antimicrob. Chemother. 2016, 71, 2333–2334. [Google Scholar] [CrossRef] [Scilit]
- Fu, S.; Hao, J.; Yang, Q.; Lan, R.; Wang, Y.; Ye, S.; Liu, Y.; Li, R. Long-distance transmission of pathogenic Vibrio species by migratory waterbirds: A potential threat to the public health. Sci. Rep. 2019, 9, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kozak, G.; Boerlin, P.; Janecko, N.; Reid-Smith, R.J.; Jardine, C. Antimicrobial resistance in Escherichia coli isolates from swine and wild small mammals in the proximity of swine farms and in natural environments in Ontario, Canada. Appl. Environ. Microbiol. 2009, 75, 559–566. [Google Scholar] [CrossRef] [Scilit]
- Literak, I.; Dolejska, M.; Radimersky, T.; Klimes, J.; Friedman, M.; Aarestrup, F.M.; Hasman, H.; Cizek, A. Antimicrobial-Resistant Faecal Escherichia coli in Wildmammals in Central Europe: Multiresistant Escherichia coli Producing Extended-Spectrum Beta-Lactamases in Wild Boars. J. Appl. Microbiol. 2010, 108, 1702–1711. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, S.; Wang, J.; Fanning, S.; McMahon, B.J. Antimicrobial resistant bacteria in wild mammals and birds: A coincidence or cause for concern? Ir. Vet. J. 2014, 67, 8. [Google Scholar] [CrossRef] [Scilit]
- Cardoso, M.D.; Lemos, L.S.; Roges, E.M.; de Moura, J.F.; Tavares, D.C.; Matias, C.A.R.; Rodrigues, D.P.; Siciliano, S. A comprehensive survey of Aeromonas sp. and Vibrio sp. in seabirds from southeastern Brazil: Outcomes for public health. J. Appl. Microbiol. 2018, 124, 1283–1293. [Google Scholar] [CrossRef] [Scilit]
- Eid, H.M.; Algammal, A.M.; Elfeil, W.K.; Youssef, F.M.; Harb, S.M.; Abd-Allah, E.M. Prevalence, molecular typing, and antimicrobial resistance of bacterial pathogens isolated from ducks. Vet. World 2019, 12, 677–683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bisgaard, M.; Sakazaki, R.; Shimada, T. Prevalence of non-cholera vibrios in cavum nasi and pharynx of ducks. Acta Pathol. Microbiol. Scand. B. 1978, 86, 261–266. [Google Scholar] [CrossRef] [Scilit]
- Akter, M.; Islam, M.S.; Islam, M.A.; Sobur, M.A.; Jahan, M.S.; Rahman, S.; Nazir, K.N.H.; Rahman, M.T. Migratory birds as the potential source for the transmission of Aspergillus and other fungus to Bangladesh. J. Adv. Vet. Anim. Res. 2020, 7, 338–344. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sobur, M.A.; Sabuj, A.A.M.; Sarker, R.; Rahman, A.M.M.T.; Kabir, S.M.L.; Rahman, M.T. Antibiotic-resistant Escherichia coli and Salmonella spp. associated with dairy cattle and farm environment having public health significance. Vet. World 2019, 12, 984–993. [Google Scholar] [CrossRef] [Scilit]
- Sobur, M.A.; Ievy, S.; Haque, Z.F.; Nahar, A.; Zaman, S.B.; Rahman, M.T. Emergence of colistin-resistant Escherichia coli in poultry, house flies, and pond water in Mymensingh, Bangladesh. J. Adv. Vet. Anim. Res. 2019, 6, 50–53. [Google Scholar]
- Sobur, A.; Haque, Z.F.; Sabuj, A.A.; Ievy, S.; Rahman, A.T.; El Zowalaty, M.E.; Rahman, T. Molecular detection of multidrug and colistin-resistant Escherichia coli isolated from house flies in various environmental settings. Future Microbiol. 2019, 14, 847–858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, R.F.; Cao, W.W.; Cerniglia, C.E. PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl. Environ. Microbiol. 1996, 62, 1242–1247. [Google Scholar] [CrossRef] [Scilit]
- Janßen, T.; Schwarz, C.; Preikschat, P.; Voss, M.; Philipp, H.C.; Wieler, L.H. Virulence-associated genes in avian pathogenic Escherichia coli (APEC) isolated from internal organs of poultry having died from colibacillosis. Int. J. Med. Microbiol. 2001, 291, 371–378. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sobur, A.; Hasan, M.; Haque, E.; Mridul, A.I.; Noreddin, A.; El Zowalaty, M.E.; Rahman, T. Molecular Detection and Antibiotyping of Multidrug-Resistant Salmonella Isolated from Houseflies in a Fish Market. Pathogens 2019, 8, 191. [Google Scholar] [CrossRef] [Scilit]
- Tawyabur, M.; Islam, S.; Sobur, A.; Hossain, J.; Mahmud, M.; Paul, S.; Hossain, T.; Ashour, H.M.; Rahman, T. Isolation and Characterization of Multidrug-Resistant Escherichia coli and Salmonella spp. from Healthy and Diseased Turkeys. Antibiotics 2020, 9, 770. [Google Scholar] [CrossRef] [Scilit]
- Paixao, A.C.; Ferreira, A.C.; Fontes, M.; Themudo, P.; Albuquerque, T.; Soares, M.C.; Fevereiro, M.; Martins, L.; de Sá, M.I.C. Detection of virulence-associated genes in pathogenic and commensal avian Escherichia coli isolates. Poult. Sci. 2016, 95, 1646–1652. [Google Scholar] [CrossRef] [Scilit]
- Bayer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 1966, 45, 493–496. [Google Scholar] [CrossRef] [Scilit]
- CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 28th ed.; CLSI Supplement M100s; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018. [Google Scholar]
- Sweeney, M.T.; Lubbers, B.V.; Schwarz, S.; Watts, J.L. Applying definitions for multidrug resistance, extensive drug resistance and pandrug resistance to clinically significant livestock and companion animal bacterial pathogens. J. Antimicrob. Chemother. 2018, 73, 1460–1463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ashour, H.M. One Health—People, Animals, and the Environment. Clin. Inf. Dis. 2014, 59, 1510. [Google Scholar] [CrossRef] [Scilit]


| Virulence Gene | Occurrence (%) (n = 55) | p-Value * |
|---|---|---|
| fimC | 37 (67.27) | <0.001 |
| iucD | 16 (29.09) | |
| papC | 3 (5.45) |
| Statistical Analysis | fimC | iucD | papC | |
|---|---|---|---|---|
| fimC | Pearson Correlation Coefficient | 1 | ||
| p-value (two-tailed) | - | |||
| iucD | Pearson Correlation Coefficient | 0.447 ‡ | 1 | |
| p-value (two-tailed) | 0.001 * | - | ||
| papC | Pearson Correlation Coefficient | 0.168 | 0.199 | 1 |
| p-value (two-tailed) | 0.221 | 0.146 | - |
| Statistical Analysis | CIP | GEN | E | TE | CL | CTR | MEM | AMP | C | S | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| CIP | Pearson Correlation Coefficient | 1 | |||||||||
| p-value (two-tailed) | - | ||||||||||
| GEN | Pearson Correlation Coefficient | 0.123 | 1 | ||||||||
| p-value (two-tailed) | 0.371 | - | |||||||||
| E | Pearson Correlation Coefficient | - a | - a | - a | |||||||
| p-value (two-tailed) | - | - | - | ||||||||
| TE | Pearson Correlation Coefficient | 0.694 ‡ | 0.099 | - a | 1 | ||||||
| p-value (two-tailed) | 0.000 * | 0.471 | - | - | |||||||
| CL | Pearson Correlation Coefficient | 0.356 ‡ | 0.065 | - a | −0.342 † | 1 | |||||
| p-value (two-tailed) | 0.008 * | 0.639 | - | 0.011 * | - | ||||||
| CTR | Pearson Correlation Coefficient | - a | - a | - a | - a | - a | - a | ||||
| p-value (two-tailed) | - | - | - | - | - | - | |||||
| MEM | Pearson Correlation Coefficient | 0.285 † | 0.098 | - a | -0.225 | 0.098 | - a | 1 | |||
| p-value (two-tailed) | 0.035 * | 0.477 | - | 0.099 | 0.477 | - | - | ||||
| AMP | Pearson Correlation Coefficient | - a | - a | - a | - a | - a | - a | - a | - a | ||
| p-value (two-tailed) | - | - | - | - | - | - | - | - | |||
| C | Pearson Correlation Coefficient | 0.717 ‡ | 0.073 | - a | 0.589 ‡ | −0.308 † | - a | −0.246 | - a | 1 | |
| p-value (two-tailed) | 0.000 * | 0.598 | - | 0.000 * | 0.022 * | - | 0.070 | - | - | ||
| S | Pearson Correlation Coefficient | 0.261 | 0.063 | - a | 0.426 ‡ | −0.331 † | - a | −0.158 | - a | 0.178 | 1 |
| p-value (two-tailed) | 0.054 | 0.646 | - | 0.001 * | 0.014 * | - | 0.250 | - | 0.195 | - |
| Pattern No. | Antibiotic Resistance Patterns | No. of Antibiotics (Classes) | No. of MDR Isolates (%) | Overall No. of MDR Isolates (%) |
|---|---|---|---|---|
| 1 | E, TE, AMP | 3 (3) | 2 (3.64) | 55 (100) |
| 2 | GEN, E, AMP | 3 (3) | 2 (3.64) | |
| 3 | E, AMP, S | 3 (3) | 9 (16.36) | |
| 4 | E, CL, AMP | 3 (3) | 4 (7.27) | |
| 5 | E, MEM, AMP | 3 (3) | 2 (3.64) | |
| 6 | CIP, E, AMP, C | 4 (4) | 1 (1.81) | |
| 7 | E, TE, AMP, S | 4 (4) | 1 (1.81) | |
| 8 | E, MEM, AMP, S | 4 (4) | 1 (1.81) | |
| 9 | GEN, E, TE, AMP, S | 5 (4) | 1 (1.81) | |
| 10 | GEN, E, CL, AMP, S | 5 (4) | 1 (1.81) | |
| 11 | CIP, E, TE, AMP, C | 5 (5) | 3 (5.45) | |
| 12 | CIP, E, TE, AMP, S | 5 (5) | 6 (10.91) | |
| 13 | E, TE, AMP, C, S | 5 (5) | 2 (3.64) | |
| 14 | E, TE, CL, AMP, S | 5 (5) | 1 (1.81) | |
| 15 | E, TE, MEM, AMP, S | 5 (5) | 1 (1.81) | |
| 16 | CIP, E, TE, AMP, C, S | 6 (6) | 16 (29.09) | |
| 17 | CIP, GEN, E, TE, AMP, C, S | 7 (6) | 2 (3.64) |
| Target Genes | Primer Sequence (5’–3’) | Amplicon Size (bp) | Annealing Temperature (°C) | References |
|---|---|---|---|---|
| malB | F:GACCTCGGTTTAGTTCACAGA R: CACACGCTGACGCTGACCA | 585 | 55 | [59] |
| fimC | F: GGTAGAAAATGCCGATGGTG R: CGTCATTTTGGGGGTAAGTGC | 496 | 59 | [60] |
| iucD | F: ACAAAAAGTTCTATCGCTTCC R: CCTGATCCAGCTGATGCTC | 692 | 55 | |
| papC | F: TGATATCACGCAGTCAGTAGC R: CCGGCCATATTCACATAA | 483 | 59 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Islam, M.S.; Nayeem, M.M.H.; Sobur, M.A.; Ievy, S.; Islam, M.A.; Rahman, S.; Kafi, M.A.; Ashour, H.M.; Rahman, M.T. Virulence Determinants and Multidrug Resistance of Escherichia coli Isolated from Migratory Birds. Antibiotics 2021, 10, 190. https://doi.org/10.3390/antibiotics10020190
Islam MS, Nayeem MMH, Sobur MA, Ievy S, Islam MA, Rahman S, Kafi MA, Ashour HM, Rahman MT. Virulence Determinants and Multidrug Resistance of Escherichia coli Isolated from Migratory Birds. Antibiotics. 2021; 10(2):190. https://doi.org/10.3390/antibiotics10020190
Chicago/Turabian StyleIslam, Md. Saiful, Md. Mehedi Hasan Nayeem, Md. Abdus Sobur, Samina Ievy, Md. Amirul Islam, Saifur Rahman, Md. Abdul Kafi, Hossam M. Ashour, and Md. Tanvir Rahman. 2021. "Virulence Determinants and Multidrug Resistance of Escherichia coli Isolated from Migratory Birds" Antibiotics 10, no. 2: 190. https://doi.org/10.3390/antibiotics10020190
APA StyleIslam, M. S., Nayeem, M. M. H., Sobur, M. A., Ievy, S., Islam, M. A., Rahman, S., Kafi, M. A., Ashour, H. M., & Rahman, M. T. (2021). Virulence Determinants and Multidrug Resistance of Escherichia coli Isolated from Migratory Birds. Antibiotics, 10(2), 190. https://doi.org/10.3390/antibiotics10020190

