Osteoblastic Differentiation of Human Adipose-Derived Mesenchymal Stem Cells on P3HT Thin Polymer Film
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials and Substrates
2.2. Physico-Chemical Characterization by Atomic Force Microscopy
2.3. Biological Analyses
2.3.1. Experimental Groups
- Uncoated slide in GM (CTRL GM);
- Uncoated slide in OM (CTRL OM);
- P3HT-coated slide in GM (P3HT GM);
- P3HT-coated slide in OM (P3HT OM).
2.3.2. hADMSCs Cell Culture
2.3.3. Cell Viability of hADMSCs Cultured on P3HT Thin Polymer Film
2.3.4. Osteoblastic Differentiation of hADMSCs on P3HT Thin Polymer Film
2.3.5. Extracellular Matrix Mineralization on P3HT Thin Polymer Film
2.3.6. Gene Expression Profile of hADMSCs on P3HT Thin Polymer Film
2.3.7. Immunofluorescence Analysis of hADMSCs on P3HT Thin Polymer Film
2.3.8. Statistical Data Analysis
3. Results and Discussion
3.1. Atomic Force Microscopy Analysis of P3HT Thin Polymer Film
3.2. Biocompatibility Evaluation of hADMSCs Cultured on P3HT Thin Polymer Film
3.3. Osteoblastic Differentiation of hADMSCs Cultured on P3HT Thin Polymer Film
3.4. Physico-Chemical Properties of the hADMSCs Cultured on P3HT Thin Polymer Film
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dey, D.; Wheatley, B.M.; Cholok, D.; Agarwal, S.; Paul, B.Y.; Levi, B.; Davis, T.A. The Traumatic Bone: Trauma-Induced Heterotopic Ossification. Transl. Res. 2017, 186, 95–111. [Google Scholar] [CrossRef] [PubMed]
- Oryan, A.; Monazzah, S.; Bigham-Sadegh, A. Bone Injury and Fracture Healing Biology Biomed. Environ. Sci. 2015, 28, 57–71. [Google Scholar] [CrossRef]
- Betz, R.R. Limitations of Autograft and Allograft: New Synthetic Solutions. Orthopedics 2002, 25, s561–s570. [Google Scholar] [CrossRef]
- Oryan, A.; Alidadi, S.; Moshiri, A.; Maffulli, N. Bone regenerative medicine: Classic options, novel strategies, and future directions. J. Orthop. Surg. Res. 2014, 9, 18. [Google Scholar] [CrossRef]
- Black, C.R.; Goriainov, V.; Gibbs, D.; Kanczler, J.; Tare, R.S.; Oreffo, R.O. Bone Tissue Engineering. Curr. Mol. Biol. Rep. 2015, 1, 132–140. [Google Scholar] [CrossRef]
- O’Keefe, R.J.; Mao, J. Bone Tissue Engineering and Regeneration: From Discovery to the Clinic—An Overview. Tissue Eng. Part B Rev. 2011, 17, 389–392. [Google Scholar] [CrossRef]
- Ahmad Khalili, A.; Ahmad, M.R. A Review of Cell Adhesion Studies for Biomedical and Biological Applications. Int. J. Mol. Sci. 2015, 16, 18149–18184. [Google Scholar] [CrossRef]
- Saturnino, C.; Sinicropi, M.S.; Iacopettab, D.; Ceramella, J.; Caruso, A.; Muià, N.; Longo, P.; Rosace, G.; Galletta, M.; Ielo, I.; et al. N-Thiocarbazole-based gold nanoparticles: Synthesis, characterization and anti-proliferative activity evaluation. IOP Conf. Ser. Mater. Sci. Eng. 2019, 459, 012023. [Google Scholar] [CrossRef]
- Gribova, V.; Auzely-Velty, R.; Picart, C. Polyelectrolyte Multilayer Assemblies on Materials Surfaces: From Cell Adhesion to Tissue Engineering. Chem. Mater. 2012, 24, 854–869. [Google Scholar] [CrossRef]
- Ciapetti, G.; Ambrosio, L.; Marletta, G.; Baldini, N.; Giunti, A. Human Bone Marrow Stromal Cells: In Vitro Expansion and Differentiation for Bone Engineering. Biomaterials 2006, 27, 6150–6160. [Google Scholar] [CrossRef]
- Cassari, L.; Zamuner, A.; Messina, G.M.L.; Marsotto, M.; Chang, H.C.; Coward, T.; Battocchio, C.; Iucci, G.; Marletta, G.; Di Silvio, L.; et al. Strategies for the Covalent Anchoring of a BMP-2-Mimetic Peptide to PEEK Surface for Bone Tissue Engineering. Materials 2023, 16, 3869. [Google Scholar] [CrossRef] [PubMed]
- McNamara, L.E.; McMurray, R.J.; Biggs, M.J.; Kantawong, F.; Oreffo, R.O.; Dalby, M.J. Nanotopographical Control of Stem Cell Differentiation. J. Tissue Eng. 2010, 2010, 120623. [Google Scholar] [CrossRef]
- Karakeçili, A.; Messina, G.M.L.; Yurtsever, M.Ç.; Gümüsderelioglu, M.; Marletta, G. Impact of selective nanoconfinement on human dental pulp stem cells. Colloids Surf. B Biointerfaces 2014, 123, 39–48. [Google Scholar] [CrossRef] [PubMed]
- Alba, A.; Villaggio, G.; Messina, G.M.L.; Caruso, M.; Federico, C.; Cambria, M.T.; Marletta, G.; Sinatra, F. Cytostatic effect of polyethyleneimine surfaces on the mesenchymal stromal cell cycle. Polymers 2022, 14, 2463. [Google Scholar] [CrossRef]
- Discher, D.E.; Mooney, D.J.; Zandstra, P.W. Growth Factors, Matrices, and Forces Combine and Control Stem Cells. Science 2009, 324, 1673–1677. [Google Scholar] [CrossRef] [PubMed]
- Dolcimascolo, A.; Calabrese, G.; Conoci, S.; Parenti, R.; Dolcimascolo, A. Innovative Biomaterials for Tissue Engineering. In Biomaterial-Supported Tissue Reconstruction or Regeneration; IntechOpen: London, UK, 2019; ISBN 978-1-83880-378-0. [Google Scholar]
- Franco, D.; Leonardi, A.A.; Rizzo, M.G.; Palermo, N.; Irrera, A.; Calabrese, G.; Conoci, S. Biological Response Evaluation of Human Fetal Osteoblast Cells and Bacterial Cells on Fractal Silver Dendrites for Bone Tissue Engineering. Nanomaterials 2023, 13, 1107. [Google Scholar] [CrossRef]
- Guo, B.; Ma, P.X. Conducting Polymers for Tissue Engineering. Biomacromolecules 2018, 19, 1764–1782. [Google Scholar] [CrossRef]
- Balint, R.; Cassidy, N.J.; Cartmell, S.H. Conductive Polymers: Towards a Smart Biomaterial for Tissue Engineering. Acta Biomater. 2014, 10, 2341–2353. [Google Scholar] [CrossRef]
- Dixon, D.T.; Gomillion, C.T. Conductive Scaffolds for Bone Tissue Engineering: Current State and Future Outlook. J. Funct. Biomat. 2021, 13, 1. [Google Scholar] [CrossRef]
- Lee, S.; Ozlu, B.; Eom, T.; Martin, D.C.; Shim, B.S. Electrically Conducting Polymers for Bio-Interfacing Electronics: From Neural and Cardiac Interfaces to Bone and Artificial Tissue Biomaterials. Biosens. Bioelectron. 2020, 170, 112620. [Google Scholar] [CrossRef]
- Aziz, I.A.; Maver, L.; Giannasi, C.; Niada, S.; Brini, A.T.; Antognazza, M.R. Polythiophene-Mediated Light Modulation of Membrane Potential and Calcium Signalling in Human Adipose-Derived Stem/Stromal Cells. J. Mater. Chem. C 2022, 10, 9823–9833. [Google Scholar] [CrossRef] [PubMed]
- Ning, C.; Zhou, Z.; Tan, G.; Zhu, Y.; Mao, C. Electroactive polymers for tissue regeneration: Developments and perspectives. Prog. Polym. Sci. 2018, 81, 144–162. [Google Scholar] [CrossRef]
- Rahman, M.H.; Werth, H.; Goldman, A.; Hida, Y.; Diesner, C.; Lane, L.; Menezes, P.L. Recent Progress on Electroactive Polymers: Synthesis, Properties and Applications. Ceramics 2021, 4, 516–541. [Google Scholar] [CrossRef]
- Biglari, N.; Zare, E.N. Conjugated Polymer-Based Composite Scaffolds for Tissue Engineering and Regenerative Medicine. Alex. Eng. J. 2024, 87, 277–299. [Google Scholar] [CrossRef]
- Fan, J.; Abedi-Dorcheh, K.; Sadat Vaziri, A.; Kazemi-Aghdam, F.; Rafieyan, S.; Sohrabinejad, M.; Ghorbani, M.; Rastegar Adib, F.; Ghasemi, Z.; Klavins, K.; et al. A Review of Recent Advances in Natural Polymer-Based Scaffolds for Musculoskeletal Tissue Engineering. Polymers 2022, 14, 2097. [Google Scholar] [CrossRef]
- Yan, H.; Li, L.; Wang, Y.; Huang, J.; Wang, Z.; Shi, X.; Zhang, P. An Electrically and Magnetically Responsive Nanocomposite of GdPO4·H2O/P3HT/PLGA with Electrical Stimulation for Synergistically Enhancing the Proliferation and Differentiation of Pre-Osteoblasts. New J. Chem. 2019, 43, 17315–17326. [Google Scholar] [CrossRef]
- Wu, C.; Pu, Y.; Zhang, Y.; Liu, X.; Qiao, Z.; Xin, N.; Zhou, T.; Chen, S.; Zeng, M.; Tang, J.; et al. A Bioactive and Photoresponsive Platform for Wireless Electrical Stimulation to Promote Neurogenesis. Adv. Healthc. Mater. 2022, 11, 2201255. [Google Scholar] [CrossRef]
- Cheng, H.; Huang, Y.; Qian, J.; Meng, F.; Fan, Y. Organic Photovoltaic Device Enhances the Neural Differentiation of Rat Bone Marrow-Derived Mesenchymal Stem Cells. Med. Nov. Technol. Devices 2022, 16, 100176. [Google Scholar] [CrossRef]
- Yang, K.; Oh, J.Y.; Lee, J.S.; Jin, Y.; Chang, G.E.; Chae, S.S.; Cheong, E.; Baik, H.K.; Cho, S.W. Photoactive Poly(3-Hexylthiophene) Nanoweb for Optoelectrical Stimulation to Enhance Neurogenesis of Human Stem Cells. Theranostics 2017, 7, 4591–4604. [Google Scholar] [CrossRef] [PubMed]
- Ornaghi, H.L.; Monticeli, F.M.; Agnol, L.D. A Review on Polymers for Biomedical Applications on Hard and Soft Tissues and Prosthetic Limbs. Polymers 2023, 15, 4034. [Google Scholar] [CrossRef]
- Zhang, J.; Li, M.; Kang, E.T.; Neoh, K.G. Electrical stimulation of adipose-derived mesenchymal stem cells in conductive scaffolds and the roles of voltage-gated ion channels. Acta Biomater. 2016, 32, 46–56. [Google Scholar] [CrossRef] [PubMed]
- Thrivikraman, G.; Lee, P.S.; Hess, R.; Haenchen, V.; Basu, B.; Scharnweber, D. Interplay of Substrate Conductivity, Cellular Microenvironment, and Pulsatile Electrical Stimulation toward Osteogenesis of Human Mesenchymal Stem Cells in Vitro. ACS Appl. Mater. Interfaces 2015, 7, 23015–23028. [Google Scholar] [CrossRef]
- Yang, C.; Ji, J.; Lv, Y.; Li, Z.; Luo, D. Application of Piezoelectric Material and Devices in Bone Regeneration. Nanomaterials 2022, 12, 4386. [Google Scholar] [CrossRef]
- Khare, D.; Basu, B.; Dubey, A.K. Electrical stimulation and piezoelectric biomaterials for bone tissue engineering applications. Biomaterials 2020, 258, 120280. [Google Scholar] [CrossRef]
- Forciniti, L.; Ybarra, J.; Zaman, M.H.; Schmidt, C.E. Schwann cell response on polypyrrole substrates upon electrical stimulation. Acta Biomater. 2014, 10, 2423–2433. [Google Scholar] [CrossRef] [PubMed]
- Sader, J.E.S.; Chon, J.W.M.; Mulvaney, P. Calibration of Rectangular Atomic Force Microscope Cantilevers. Rev. Sci. Instrum. 1999, 70, 3967–3969. [Google Scholar] [CrossRef]
- Derjaguin, B.V.; Muller, V.M.; Toporov, Y.P. Effect of Contact Deformations on the Adhesion of Particles. J. Colloid Interface Sci. 1975, 53, 314–326. [Google Scholar] [CrossRef]
- Szychlinska, M.A.; Calabrese, G.; Ravalli, S.; Parrinello, N.L.; Forte, S.; Castrogiovanni, P.; Pricoco, E.; Imbesi, R.; Castorina, S.; Leonardi, R.; et al. Cycloastragenol as an Exogenous Enhancer of Chondrogenic Differentiation of Human Adipose-Derived Mesenchymal Stem Cells. A Morphological Study. Cells 2020, 9, 347. [Google Scholar] [CrossRef]
- Calabrese, G.; Franco, D.; Petralia, S.; Monforte, F.; Condorelli, G.G.; Squarzoni, S.; Traina, F.; Conoci, S. Dual-Functional Nano-Functionalized Titanium Scaffolds to Inhibit Bacterial Growth and Enhance Osteointegration. Nanomaterials 2021, 11, 2634. [Google Scholar] [CrossRef]
- Vicari, L.; Calabrese, G.; Forte, S.; Giuffrida, R.; Colarossi, C.; Parrinello, N.L.; Memeo, L. Potential Role of Activating Transcription Factor 5 during Osteogenesis. Stem Cells Int. 2016, 2016, 5282185. [Google Scholar] [CrossRef] [PubMed]
- Calabrese, G.; Gulino, R.; Giuffrida, R.; Forte, S.; Figallo, E.; Fabbi, C.; Salvatorelli, L.; Memeo, L.; Gulisano, M.; Parenti, R. In Vivo Evaluation of Biocompatibility and Chondrogenic Potential of a Cell-Free Collagen-Based Scaffold. Front. Physiol. 2017, 8, 984. [Google Scholar] [CrossRef]
- Rizzo, M.G.; Palermo, N.; Alibrandi, P.; Sciuto, E.L.; Del Gaudio, C.; Filardi, V.; Fazio, B.; Caccamo, A.; Oddo, S.; Calabrese, G.; et al. Physiologic Response Evaluation of Human Foetal Osteoblast Cells within Engineered 3D-Printed Polylactic Acid Scaffolds. Biology 2023, 12, 424. [Google Scholar] [CrossRef]
- Rincón, C.; Meredith, J.C. Osteoblast Adhesion and Proliferation on Poly(3-Octylthiophene) Thin Films. Macromol. Biosci. 2010, 10, 258–264. [Google Scholar] [CrossRef] [PubMed]
- Lakard, B.; Ploux, L.; Anselme, K.; Lallemand, F.; Lakard, S.; Nardin, M.; Hihn, J.Y. Effect of Ultrasounds on the Electrochemical Synthesis of Polypyrrole, Application to the Adhesion and Growth of Biological Cells. Bioelectrochemistry 2009, 75, 148–157. [Google Scholar] [CrossRef] [PubMed]
- Karagkiozaki, V.; Karagiannidis, P.G.; Gioti, M.; Kavatzikidou, P.; Georgiou, D.; Georgaraki, E.; Logothetidis, S. Bioelectronics Meets Nanomedicine for Cardiovascular Implants: PEDOT-Based Nanocoatings for Tissue Regeneration. Biochim. Biophys. Acta 2013, 1830, 4294–4304. [Google Scholar] [CrossRef] [PubMed]
- Bolin, M.H.; Svennersten, K.; Wang, X.; Chronakis, I.S.; Richter-Dahlfors, A.; Jager, E.W.; Berggren, M. Nano-Fiber Scaffold Electrodes Based on PEDOT for Cell Stimulation. Sens. Actuators B Chem. 2009, 142, 451–456. [Google Scholar] [CrossRef]
- Zhang, Z.; Rouabhia, M.; Wang, Z.; Roberge, C.; Shi, G.; Roche, P.; Li, J.; Dao, L.H. Electrically Conductive Biodegradable Polymer Composite for Nerve Regeneration: Electricity-Stimulated Neurite Outgrowth and Axon Regeneration. Artif. Organs 2007, 31, 13–22. [Google Scholar] [CrossRef]
- Collier, J.H.; Camp, J.P.; Hudson, T.W.; Schmidt, C.E. Synthesis and Characterization of Polypyrrole-Hyaluronic Acid Composite Biomaterials for Tissue Engineering Applications. J. Biomed. Mater. Res. 2000, 50, 574–584. [Google Scholar] [CrossRef]
- Ateh, D.D.; Vadgama, P.; Navsaria, H.A. Culture of Human Keratinocytes on Polypyrrole-Based Conducting Polymers. Tissue Eng. 2006, 12, 645–655. [Google Scholar] [CrossRef]
- Castano, H.; O’Rear, E.A.; McFetridge, P.S.; Sikavitsas, V.I. Polypyrrole Thin Films Formed by Admicellar Polymerization Support the Osteogenic Differentiation of Mesenchymal Stem Cells. Macrom. Biosci. 2004, 4, 785–794. [Google Scholar] [CrossRef]
- Zhu, Y.; Mo, T.; Jiang, C.; Zhang, J. Osteonectin Bidirectionally Regulates Osteoblast Mineralization. J. Orthop. Surg. Res. 2023, 18, 761. [Google Scholar] [CrossRef] [PubMed]
- Lin, X.; Patil, S.; Gao, Y.-G.; Qian, A. The Bone Extracellular Matrix in Bone Formation and Regeneration. Front. Pharmacol. 2020, 11, 757. [Google Scholar] [CrossRef] [PubMed]
- Sinha, K.M.; Zhou, X. Genetic and Molecular Control of Osterix in Skeletal Formation. J. Cell. Biochem. 2013, 114, 975–984. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, M.S.; Cabral, J.M.; da Silva, C.L.; Vashishth, D. Synergistic Effect of Extracellularly Supplemented Osteopontin and Osteocalcin on Stem Cell Proliferation, Osteogenic Differentiation, and Angiogenic Properties. J. Cell. Biochem. 2019, 120, 6555–6569. [Google Scholar] [CrossRef]
- Tsao, Y.-T.; Huang, Y.-J.; Wu, H.-H.; Liu, Y.-A.; Liu, Y.-S.; Lee, O.K. Osteocalcin Mediates Biomineralization during Osteogenic Maturation in Human Mesenchymal Stromal Cells. Int. J. Mol. Sci. 2017, 18, 159. [Google Scholar] [CrossRef]
- Rosset, E.M.; Bradshaw, A.D. SPARC/Osteonectin in Mineralized Tissue. Matrix Biol. 2016, 52–54, 78–87. [Google Scholar] [CrossRef]
- Docheva, D.; Padula, D.; Popov, C.; Mutschler, W.; Clausen-Schaumann, H.; Schieker, M. Researching into the Cellular Shape, Volume and Elasticity of Mesenchymal Stem Cells, Osteoblasts and Osteosarcoma Cells by Atomic Force Microscopy. J. Cell. Mol. Med. 2008, 12, 537–552. [Google Scholar] [CrossRef] [PubMed]
- Takai, E.; Costa, K.D.; Shaheen, A.; Hung, C.T.; Guo, X.E. Osteoblast Elastic Modulus Measured by Atomic Force Microscopy Is Substrate Dependent. Ann. Biomed. Eng. 2005, 33, 963–971. [Google Scholar] [CrossRef] [PubMed]
- Jin, R.; Wang, Y.; Liu, Y.; Ding, C.; Xie, J.; Li, J. Biomineralization and Osteogenic Differentiation Modulated by Substrate Stiffness. Eur. Polym. J. 2020, 122, 109395. [Google Scholar] [CrossRef]
- El-Rashidy, A.A.; El Moshy, S.; Radwan, I.A.; Rady, D.; Abbass, M.M.; Dörfer, C.E.; Fawzy El-Sayed, K.M. Effect of Polymeric Matrix Stiffness on Osteogenic Differentiation of Mesenchymal Stem/Progenitor Cells: Concise Review. Polymers 2021, 13, 2950. [Google Scholar] [CrossRef] [PubMed]
- Olivares-Navarrete, R.; Lee, E.M.; Smith, K.; Hyzy, S.L.; Doroudi, M.; Williams, J.K.; Gall, K.; Boyan, B.D.; Schwartz, Z. Substrate Stiffness Controls Osteoblastic and Chondrocytic Differentiation of Mesenchymal Stem Cells without Exogenous Stimuli. PLoS ONE 2017, 12, e0170312. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward | Reverse |
---|---|---|
Osteopontin | AGTTTCGCAGACCTGACATCCAGT | TTCATAACTGTCCTTCCCACGGCT |
Osteocalcin | GGCAGCGAGGTAGTGAAGAG | GATGTGGTCAGCCAACTCGT |
Osteonectin | TAGCACACAGCCTACCACAAG | AGCAACTTCAGTCTGCTGAGGG |
GAPDH | GCTCTCCAGAACATCATCCCTGCC | GCGTTGTCATACCAGGAAATGAGCTT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Campione, P.; Rizzo, M.G.; Bauso, L.V.; Ielo, I.; Messina, G.M.L.; Calabrese, G. Osteoblastic Differentiation of Human Adipose-Derived Mesenchymal Stem Cells on P3HT Thin Polymer Film. J. Funct. Biomater. 2025, 16, 10. https://doi.org/10.3390/jfb16010010
Campione P, Rizzo MG, Bauso LV, Ielo I, Messina GML, Calabrese G. Osteoblastic Differentiation of Human Adipose-Derived Mesenchymal Stem Cells on P3HT Thin Polymer Film. Journal of Functional Biomaterials. 2025; 16(1):10. https://doi.org/10.3390/jfb16010010
Chicago/Turabian StyleCampione, Paola, Maria Giovanna Rizzo, Luana Vittoria Bauso, Ileana Ielo, Grazia Maria Lucia Messina, and Giovanna Calabrese. 2025. "Osteoblastic Differentiation of Human Adipose-Derived Mesenchymal Stem Cells on P3HT Thin Polymer Film" Journal of Functional Biomaterials 16, no. 1: 10. https://doi.org/10.3390/jfb16010010
APA StyleCampione, P., Rizzo, M. G., Bauso, L. V., Ielo, I., Messina, G. M. L., & Calabrese, G. (2025). Osteoblastic Differentiation of Human Adipose-Derived Mesenchymal Stem Cells on P3HT Thin Polymer Film. Journal of Functional Biomaterials, 16(1), 10. https://doi.org/10.3390/jfb16010010