Sonification of Deproteinized Bovine Bone Functionalized with Genistein Enhances Bone Repair in Peri-Implant Bone Defects in Ovariectomized Rats
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics and Sample Size Calculation
2.2. Estrous Cycle
2.3. Ovariectomy
2.4. Experimental Groups
2.5. Sonification and Functionalization with Genistein
2.6. Peri-Implant Bone Defects and Implant Placement
2.7. Euthanasia
2.8. Biomechanical Test (Removal Torque)
2.9. Micro-CT
2.10. Molecular Analysis (RT-PCR)
2.11. Statistical Analysis
3. Results
3.1. Removal Torque Values
3.2. Micro-CT
3.3. Molecular Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Huidrom, S.; Beg, M.A.; Masood, T. Post-menopausal Osteoporosis and Probiotics. Curr. Drug Targets 2021, 22, 816–822. [Google Scholar] [CrossRef] [PubMed]
- Lu, L.; Tian, L. Postmenopausal osteoporosis coexisting with sarcopenia: The role and mechanisms of estrogen. J. Endocrinol. 2023, 259, e230116. [Google Scholar] [CrossRef]
- Armas, L.A.G.; Recker, R.R. Pathophysiology of osteoporosis: New mechanistic insights. Endocrinol. Metab. Clin. N. Am. 2012, 41, 475–486. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Wang, Z.; Zhang, D.; Ye, D.; Zhou, Y.; Qin, J.; Zhang, Y. The prevalence and treatment rate trends of osteoporosis in postmenopausal women. PLoS ONE 2023, 18, e0290289. [Google Scholar] [CrossRef]
- Chen, F.; Zhang, Y.; Peng, P.; Huang, X.T.; Qiu, Z.H.; Liu, B.C.; Yang, B.C.; Yang, T.L.; Yang, B.; Guo, Y. Isolation and culture of human primary osteoblasts: Comparing the effects of differences in method details on osteoblast characteristics. Genes Dis. 2023, 11, 546–549. [Google Scholar] [CrossRef]
- Lemos, C.A.A.; Oliveira, A.S.; Faé, D.S.; Oliveira, H.F.F.E.; Rosa, C.D.D.R.D.; Bento, V.A.A.; Verri, F.R.; Pellizzer, E.P. Do dental implants placed in patients with osteoporosis have higher risks of failure and marginal bone loss compared to those in healthy patients? A systematic review with meta-analysis. Clin. Oral Investig. 2023, 27, 2483–2493. [Google Scholar] [CrossRef]
- Gomes-Ferreira, P.H.S.; Micheletti, C.; Frigério, P.B.; Batista, F.R.S.; Monteiro, N.G.; Júnior-Bim, O.; Lisboa-Filho, P.N.; Grandfield, K.; Okamoto, R. PTH 1-34-functionalized bioactive glass improves peri-implant bone repair in orchiectomized rats: Microscale and ultrastructural evaluation. Biomater. Adv. 2022, 134, 112688. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, R.; García, A.J. Biomaterial strategies for engineering implants for enhanced osseointegration and bone repair. Adv. Drug Deliv. Rev. 2015, 94, 53–62. [Google Scholar] [CrossRef]
- Beil, F.T.; Barvencik, F.; Gebauer, M.; Seitz, S.; Rueger, J.M.; Ignatius, A.; Pogoda, P.; Schinke, T.; Amling, M. Effects of estrogen on fracture healing in mice. J. Trauma. 2010, 69, 1259–1265. [Google Scholar] [CrossRef]
- Cheung, W.H.; Miclau, T.; Chow, S.K.; Yang, F.F.; Alt, V. Fracture healing in osteoporotic bone. Injury 2016, 47, S21–S26. [Google Scholar] [CrossRef]
- Du, Z.; Xiao, Y.; Hashimi, S.; Hamlet, S.M.; Ivanovski, S. The effects of implant topography on osseointegration under estrogen deficiency induced osteoporotic conditions: Histomorphometric, transcriptional and ultrastructural analysis. Acta Biomater. 2016, 42, 351–363. [Google Scholar] [CrossRef] [PubMed]
- Glösel, B.; Kuchler, U.; Watzek, G.; Gruber, R. Review of dental implant rat research models simulating osteoporosis or diabetes. Int. J. Oral Maxillofac. Implant. 2010, 25, 516–524. [Google Scholar]
- Mardas, N.; Busetti, J.; de Figueiredo, J.A.; Mezzomo, L.A.; Scarparo, R.K.; Donos, N. Guided bone regeneration in osteoporotic conditions following treatment with zoledronic acid. Clin. Oral Implant. Res. 2017, 28, 362–371. [Google Scholar] [CrossRef]
- Mulinari-Santos, G.; Dos Santos, J.S.; Kitagawa, I.L.; de Souza Batista, F.R.; Botacin, P.R.; Antoniali, C.; Lisboa-Filho, P.N.; Okamoto, R. Estrogen Deficiency Impairs Osseointegration in Hypertensive Rats Even Treated with Alendronate Coated on the Implant Surface. J. Funct. Biomater. 2023, 14, 471. [Google Scholar] [CrossRef]
- Zhuang, G.; Mao, J.; Yang, G.; Wang, H. Influence of different incision designs on bone increment of guided bone regeneration (Bio-Gide® collagen membrane + Bio-Oss® bone powder) during the same period of maxillary anterior tooth implantation. Bioengineered 2021, 12, 2155–2163. [Google Scholar] [CrossRef]
- Van Houdt, C.I.A.; Ulrich, D.J.O.; Jansen, J.A.; Van Den Beucken, J.J.J.P. The performance of CPC/PLGA and Bio-Oss® for bone regeneration in healthy and osteoporotic rats. J. Biomed. Mater. Res. B Appl. Biomater. 2018, 106, 131–142. [Google Scholar] [CrossRef]
- Keil, C.; Gollmer, B.; Zeidler-Rentzsch, I.; Gredes, T.; Heinemann, F. Histological evaluation of extraction sites grafted with Bio-Oss® Collagen: Randomized controlled trial. Ann. Anat. 2021, 237, 151722. [Google Scholar] [CrossRef] [PubMed]
- Wagner, F.; Schuder, K.; Hof, M.; Heuberer, S.; Seemann, R.; Dvorak, G. Does osteoporosis influence the marginal peri-implant bone level in female patients? A cross-sectional study in a matched collective. Clin. Implant. Dent. Relat. Res. 2017, 19, 616–623. [Google Scholar] [CrossRef] [PubMed]
- Spicer, C.D.; Pashuck, E.T.; Stevens, M.M. Achieving Controlled Biomolecule-Biomaterial Conjugation. Chem. Rev. 2018, 118, 7702–7743. [Google Scholar] [CrossRef]
- Zhang, X.; Cui, J.; Cheng, L.; Lin, K. Enhancement of osteoporotic bone regeneration by strontium-substituted 45S5 bioglass via time-dependent modulation of autophagy and the Akt/mTOR signaling pathway. J. Mater. Chem. B 2021, 9, 3489–3501. [Google Scholar] [CrossRef]
- Yu, L.; Rios, E.; Castro, L.; Liu, J.; Yan, Y.; Dixon, D. Genistein: Dual role in women’s health. Nutrients 2021, 13, 3048. [Google Scholar] [CrossRef] [PubMed]
- Garbiec, E.; Cielecka-Piontek, J.; Kowalówka, M.; Holubiec, M.; Zalewski, P. Genistein–Opportunities related to an exciting molecule of natural origin. Molecules 2022, 27, 815. [Google Scholar] [CrossRef] [PubMed]
- Mas-Bargues, C.; Borrás, C.; Viña, J. The multimodal action of genistein in Alzheimer’s and other age-related diseases. Free Radic. Biol. Med. 2022, 183, 127–137. [Google Scholar] [CrossRef]
- Kuiper, G.G.; Lemmen, J.G.; Carlsson, B.; Corton, J.C.; Safe, S.H.; van der Saag, P.T.; van der Burg, B.; Gustafsson, J.A. Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor beta. Endocrinology 1998, 139, 4252–4263. [Google Scholar] [CrossRef]
- Wu, G.J.; Cherng, Y.G.; Chen, J.T.; Chang, C.C.; Liu, S.H.; Chen, R.M. Genistein triggers translocation of estrogen receptor-alpha in mitochondria to induce expressions of ATP synthesis-associated genes and improves energy production and osteoblast maturation. Am. J. Chin. Med. 2021, 42, 901–923. [Google Scholar] [CrossRef]
- Kauffmann, P.; Rau, A.; Seidlová-Wuttke, D.; Jarry, H.; Schminke, B.; Matthes, S.; Wiese, K.G. Effect of dihydrotestosterone, 17-β-estrogen, genistein and equol on remodeling and morphology of bone in osteoporotic male rats during bone healing. Bone Rep. 2020, 13, 100300. [Google Scholar] [CrossRef]
- Kolios, L.; Sehmisch, S.; Daub, F.; Rack, T.; Tezval, M.; Stuermer, K.M.; Stuermer, E.K. Equol but not genistein improves early metaphyseal fracture healing in osteoporotic rats. Planta Med. 2009, 75, 459–465. [Google Scholar] [CrossRef] [PubMed]
- Inpan, R.; Takuathung, M.N.; Sakuludomkan, W.; Dukaew, N.; Teekachunhatean, S.; Koonrungsesomboon, N. Isoflavone intervention and its impact on bone mineral density in postmenopausal women: A systematic review and meta-analysis of randomized controlled trials. Osteoporos. Int. 2024, 35, 413–430. [Google Scholar] [CrossRef]
- Zou, Z.; Lin, K.; Chen, L.; Chang, J. Ultrafast synthesis and characterization of carbonated hydroxyapatite nanopowders via sonochemistry-assisted microwave process. Ultrason. Sonochem 2012, 19, 1174–1179. [Google Scholar] [CrossRef]
- Arruda, L.B.; Orlandi, M.O.; Lisboa-Filho, P.N. Morphological modifications and surface amorphization in ZnO sonochemically treated nanoparticles. Ultrason. Sonochem 2013, 20, 799–804. [Google Scholar] [CrossRef]
- McMahon, R.E.; Wang, L.; Skoracki, R.; Mathur, A.B. Development of nanomaterials for bone repair and regeneration. J. Biomed. Mater. Res. B 2013, 10, 387–397. [Google Scholar] [CrossRef] [PubMed]
- Gomes-Ferreira, P.H.S.; Lisboa-Filho, P.N.; Silva, A.C.; Bim-Júnior, O.; Batista, F.R.S.; Ervolino-Silva, A.C.; Garcia-Junior, I.R.; Okamoto, R. Sonochemical time standardization for bioactive materials used in peri-implant defects filling. Ultrason. Sonochem. 2019, 56, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Percie du Sert, N.; Hurst, V.; Ahluwalia, A.; Alam, S.; Avey, M.T.; Baker, M.; Browne, W.J.; Clark, A.; Cuthill, I.C.; Dirnagl, U.; et al. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. PLoS Biol. 2020, 18, e3000410. [Google Scholar]
- Long, J.A.; Evans, H.M. The Oestrus Cycle in the Rat and Its Related Phenomena, 1st ed.; University of California Press: Berkeley, CA, USA, 1922. [Google Scholar]
- Maeng, L.Y.; Cover, K.K.; Landau, A.J.; Milad, M.R.; Lebron-Milad, K. Protocol for studying extinction of conditioned fear in naturally cycling female rats. J. Vis. Exp. 2015, 96, 52202. [Google Scholar]
- Mulinari-Santos, G.; de Souza Batista, F.R.; Kirchweger, F.; Tangl, S.; Gruber, R.; Okamoto, R. Losartan reverses impaired osseointegration in spontaneously hypertensive rats. Clin. Oral Implant. Res. 2018, 29, 1126–1134. [Google Scholar] [CrossRef]
- Lisboa-Filho, P.N.; Gomes-Ferreira, P.H.S.; Batista, F.R.S.; Momesso, G.A.C.; Faverani, L.P.; Okamoto, R. Bone repair with raloxifene and bioglass nanoceramic composite in animal experiment. Connect. Tissue Res. 2018, 58, 97–100. [Google Scholar] [CrossRef]
- Inoue, B.K.N.; Paludetto, L.V.; Monteiro, N.G.; Batista, F.R.S.; Kitagawa, I.L.; da Silva, R.S.; Antoniali, C.; Lisboa Filho, P.N.; Okamoto, R. Synergic Action of Systemic Risedronate and Local Rutherpy in Peri-implantar Repair of Ovariectomized Rats: Biomechanical and Molecular Analysis. Int. J. Mol. Sci. 2023, 24, 16153. [Google Scholar] [CrossRef]
- Bouxsein, M.L.; Boyd, S.K.; Christiansen, B.A.; Guldberg, R.E.; Jepsen, K.J.; Müller, R. Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. J. Bone Miner. Res. 2010, 27, 1468–1486. [Google Scholar] [CrossRef]
- Dhayanithi, J.; Rajasekar, A. Comparison of Alveolar Bone Level around Osseointegrated Dental Implants among Premenopausal and Postmenopausal Women: A 2-Year Study. J. Long. Term. Eff. Med. Implant. 2024, 34, 89–92. [Google Scholar] [CrossRef]
- Murphy, E. Estrogen signaling and cardiovascular disease. Circ. Res. 2011, 109, 687–696. [Google Scholar] [CrossRef]
- Yasuda, H. Discovery of the RANKL/RANK/OPG system. J. Bone Miner. Metab. 2021, 39, 2–11. [Google Scholar] [CrossRef] [PubMed]
- Komori, T. Functions of osteocalcin in bone, pancreas, testis, and muscle. Int. J. Mol. Sci. 2020, 21, 7513. [Google Scholar] [CrossRef] [PubMed]
- Chavez, M.B.; Tan, M.H.; Kolli, T.N.; Zachariadou, C.; Farah, F.; Mohamed, F.F.; Chu, E.Y.; Foster, B.L. Bone sialoprotein is critical for alveolar bone healing in mice. J. Dent. Res. 2023, 102, 187–196. [Google Scholar] [CrossRef] [PubMed]
- Micheletti, C.; DiCecco, L.A.; Deering, J.; Chen, W.; Ervolino da Silva, A.C.; Shah, F.A.; Palmquist, A.; Okamoto, R.; Grandfield, K. Mesoscale characterization of osseointegration around an additively manufactured genistein-coated implant. Sci. Rep. 2024, 14, 15339. [Google Scholar] [CrossRef]
- Cepeda, S.B.; Sandoval, M.J.; Crescitelli, M.C.; Rauschemberger, M.B.; Massheimer, V.L. The isoflavone genistein enhances osteo-blastogenesis: Signaling pathways involved. J. Physiol. Biochem. 2020, 76, 99–110. [Google Scholar] [CrossRef]
- Kumar, R.; Kumar, V.B.; Gedanken, A. Sonochemical synthesis of carbon dots, mechanism, effect of parameters, and catalytic, energy, biomedical and tissue engineering applications. Ultrason. Sonochem. 2020, 64, 105009. [Google Scholar] [CrossRef]
- Low, S.S.; Yew, M.; Lim, C.N.; Chai, W.S.; Low, L.E.; Manickam, S.; Tey, B.T.; Show, P.L. Sonoproduction of nanobiomaterials—A critical review. Ultrason. Sonochem. 2022, 82, 105887. [Google Scholar] [CrossRef]
- Bharadwaz, A.; Jayasuriya, A.C. Recent trends in the application of widely used natural and synthetic polymer nanocomposites in bone tissue regeneration. Mater. Sci. Eng. C Mater. Biol. Appl. 2020, 110, 110698. [Google Scholar] [CrossRef]
- Bhatnagar, A.; Kekatpure, A.L. Postmenopausal Osteoporosis: A Literature Review. Cureus 2022, 14, e29367. [Google Scholar] [CrossRef]
- Li, Y.Q.; Xing, X.H.; Wang, H.; Weng, X.L.; Yu, S.B.; Dong, G.Y. Dose-dependent effects of genistein on bone homeostasis in rats’ mandibular subchondral bone. Acta Pharmacol. Sin. 2012, 33, 66–74. [Google Scholar] [CrossRef]
- Hilakivi-Clarke, L.; Assis, S.; Warri, A. Exposures to synthetic estrogens at different times during life, and their effect on breast cancer risk. J. Mammary Gland. Biol. Neoplasia 2013, 18, 25–42. [Google Scholar] [CrossRef] [PubMed]
- Martiniakova, M.; Babikova, M.; Omelka, R. Pharmacological agents and natural compounds: Available treatments for osteoporosis. J. Physiol. Pharmacol. 2020, 71, 1–14. [Google Scholar]
- Ruggiero, S.L.; Dodson, T.B.; Aghaloo, T.; Carlson, E.R.; Ward, B.B.; Kademani, D. American Association of Oral and Maxillofacial Surgeons’ Position Paper on Medication-Related Osteonecrosis of the Jaws-2022 Update. J. Oral Maxillofac. Surg. 2022, 80, 920–943. [Google Scholar] [CrossRef] [PubMed]
- Mei, S.; Wang, F.; Hu, X.; Yang, K.; Xie, D.; Yang, L.; Wu, Z.; Wei, J. Construction of a hierarchical micro & nanoporous surface for loading genistein on the composite of polyetheretherketone/tantalum pentoxide possessing antibacterial activity and accelerated osteointegration. Biomater. Sci. 2021, 9, 167–185. [Google Scholar]
- Sarasquete, C.; Úbeda-Manzanaro, M.; Ortiz-Delgado, J.B. Toxicity and non-harmful effects of the soya isoflavones, genistein and daidzein, in embryos of the zebrafish, Danio rerio. Comp. Biochem. Physiology. Toxicol. Pharmacol. CBP 2018, 211, 57–67. [Google Scholar] [CrossRef]
Gene | Gene Reference | Forward Primer, 5′ → 3′ | Reverse Primer, 5′ → 3′ |
---|---|---|---|
OPG | NM_057149.2 | GCACTCCTGGTGTTCTTGGA | TTTGGTCCCAGGCAAACTGT |
RANKL | NM_057149.1 | CGAGCGCAGATGGATCCTAA | GAGCCACGAACCTTCCATCA |
IBSP | NM_012587.2 | GTACCGGCCACGCTACTTTC | ATCTCCAGCCTTCTTGGGTAGC |
OCN | NM_013414.1 | CTCTGAGTCTGACAAAGCCTTCAT | GTAGCGCCGGAGTCTATTCA |
ß-actin | NM_031144.3 | CCACCATGTACCCAGGCATT | CCTAGAAGCATTTGCGGTGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Duarte, N.D.; Mulinari-Santos, G.; Batista, F.R.d.S.; Gomes, M.B.; Monteiro, N.G.; Silva, A.C.E.d.; Gruber, R.; Lisboa-Filho, P.N.; Gomes-Ferreira, P.H.S.; Okamoto, R. Sonification of Deproteinized Bovine Bone Functionalized with Genistein Enhances Bone Repair in Peri-Implant Bone Defects in Ovariectomized Rats. J. Funct. Biomater. 2024, 15, 328. https://doi.org/10.3390/jfb15110328
Duarte ND, Mulinari-Santos G, Batista FRdS, Gomes MB, Monteiro NG, Silva ACEd, Gruber R, Lisboa-Filho PN, Gomes-Ferreira PHS, Okamoto R. Sonification of Deproteinized Bovine Bone Functionalized with Genistein Enhances Bone Repair in Peri-Implant Bone Defects in Ovariectomized Rats. Journal of Functional Biomaterials. 2024; 15(11):328. https://doi.org/10.3390/jfb15110328
Chicago/Turabian StyleDuarte, Nathália Dantas, Gabriel Mulinari-Santos, Fábio Roberto de Souza Batista, Marcelly Braga Gomes, Naara Gabriela Monteiro, Ana Cláudia Ervolino da Silva, Reinhard Gruber, Paulo Noronha Lisboa-Filho, Pedro Henrique Silva Gomes-Ferreira, and Roberta Okamoto. 2024. "Sonification of Deproteinized Bovine Bone Functionalized with Genistein Enhances Bone Repair in Peri-Implant Bone Defects in Ovariectomized Rats" Journal of Functional Biomaterials 15, no. 11: 328. https://doi.org/10.3390/jfb15110328
APA StyleDuarte, N. D., Mulinari-Santos, G., Batista, F. R. d. S., Gomes, M. B., Monteiro, N. G., Silva, A. C. E. d., Gruber, R., Lisboa-Filho, P. N., Gomes-Ferreira, P. H. S., & Okamoto, R. (2024). Sonification of Deproteinized Bovine Bone Functionalized with Genistein Enhances Bone Repair in Peri-Implant Bone Defects in Ovariectomized Rats. Journal of Functional Biomaterials, 15(11), 328. https://doi.org/10.3390/jfb15110328