Next Article in Journal
Apocarotenoids as Stress Signaling Molecules in Plants
Previous Article in Journal
The Impact of Federal Reserve Monetary Policy on Commodity Prices: Evidence from the U.S. Dollar Index and International Grain Futures and Spot Markets
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Glutamine Supplementation Enhances Growth Performance and Jejunum Development in Kele and Large White Hybrid Weaned Piglets

by
Longjuan Tan
1,2,
Yujie Cheng
1,2,
Guowei Liu
1,2,
Yiyu Zhang
1,2 and
Min Zhu
1,2,*
1
Key Laboratory of Animal Genetics, Breeding and Reproduction in the Plateau Mountainous Region, Ministry of Education, College of Animal Science, Guizhou University, Guiyang 550025, China
2
Institute of Animal Nutrition and Feed Science, Guizhou University, Guiyang 550025, China
*
Author to whom correspondence should be addressed.
Agriculture 2025, 15(9), 924; https://doi.org/10.3390/agriculture15090924
Submission received: 28 March 2025 / Revised: 22 April 2025 / Accepted: 22 April 2025 / Published: 24 April 2025
(This article belongs to the Special Issue Intestinal Health and Immunomodulation in Swine)

Abstract

Glutamine (Gln), a functional amino acid, is effective in reducing weaning stress in piglets. This study aims to assess the effects of dietary Gln supplementation on intestinal morphology and functionality, as well as the growth performance of Kele and Large White hybrid weaned piglets. Forty-eight piglets aged 30 days (Kele × Large White) were randomly divided into three groups: the control group, which received a basal diet supplemented with 2.45% alanine to maintain an isonitrogenous balance; the 1% Gln group, which received the basal diet with 1.0% Gln and 1.23% alanine; and the 2% Gln group, which was given the basal diet supplemented with 2.0% Gln. Intestinal samples from 16 piglets in the control and 1% Gln groups were collected randomly on day 29 of the experiment. The results show that, compared to the control group, the 1% Gln group experienced an increase in the average daily gain (ADG) and gain-to-feed ratio (G:F). In contrast, the 2% Gln group did not demonstrate significant differences in either the ADG or G:F compared to the control group. Additionally, there were no differences in feed intake among the groups. Notably, weaned piglets in both the 1% and 2% Gln supplementation groups had reduced diarrhea rates compared to those in the control group. Furthermore, 1% Gln supplementation significantly increased villus height in both the duodenum and jejunum and the ratio of villus height to crypt depth in weaned piglets. Subsequent analyses revealed that 1% Gln supplementation increased the mRNA expression of antioxidant genes, specifically catalase and superoxide dismutase. Additionally, the mRNA levels of the intestinal tight junction genes zonula occludens-1, Claudin 1, and Occludin in the jejuna of weaned piglets were found to be elevated. In summary, incorporating 1% Gln into the diet can significantly improve intestinal functionality and promote growth in Kele and Large White hybrid weaned piglets.

1. Introduction

The Kele pig is a unique local pig breed from Southwest China known for its excellent meat quality, which can complement the high growth performance of Large White (Yorkshire) pigs when the two breeds are hybridized. The resulting hybrid pigs have considerable economic potential for commercial farming. However, these hybrid offspring face common challenges during the weaning transition period, such as growth retardation and intestinal dysfunction [1]. These issues are similar to those experienced by Duroc–Landrace–Yorkshire hybrids and single-breed pigs. The delayed development of jejunal morphology and barrier function directly limits nutrient absorption efficiency [2]. Therefore, it is essential to implement strategies that mitigate the detrimental effects of stress after weaning. In recent years, attention has increasingly turned to certain functional amino acids, such as glutamine (Gln), arginine, glutamic acid, and glycine. Research has demonstrated that these functional amino acids can enhance nutritional metabolism, protein turnover, and immune function in animals, thereby improving growth performance and feed utilization efficiency in piglets [3,4].
Gln is one of the most abundant amino acids found in plasma, skeletal muscle, amniotic fluid, and milk, and it serves numerous physiological and metabolic functions [5]. Research has indicated that diets for weaned piglets must contain adequate levels of Gln to support optimal growth [6]. Recent studies have highlighted Gln’s significant roles in regulating gene expression [7,8], cell signaling pathways [9,10], nutrient digestion and absorption [11], DNA and protein synthesis [6], antioxidant response [12], injury recovery [13], and immune function [8,14]. Additionally, Gln is the preferred source of metabolic fuel for the small intestine, helping to maintain its digestive functions and protect the integrity of its mucosal lining [3]. It is important to note that, under stress conditions, the body may not synthesize enough Gln. Therefore, exogenous Gln supplementation is recommended during the weaning and high-density feeding of young animals, as it can help to reduce the incidence of diarrhea and other diseases in these young animals [15,16].
Most studies on the impact of Gln on pigs focus on commercial pigs (Landrace × Yorkshire × Duroc) [6,12], while research on local pigs is extremely scarce. Local pig breeds have unique genetic backgrounds, growth characteristics, and adaptability to the local environment [17,18]. However, it is still unclear how Gln affects the intestinal health and growth performance of local pigs. Whether Gln can improve the growth performance of local pigs, as it does in commercial pigs, needs to be studied. Filling these research gaps relating to the effects of Gln in local pigs may help to optimize breeding programs for these pigs, tap the full potential of local pig breeds, and improve their breeding benefits and germplasm advantages.
Gln has been widely used to prevent intestinal damage in weaned piglets [19,20]; however, its effects on weaned Kele and Large White pigs have not been evaluated. Furthermore, as China has banned antibiotics in feed since 2020, a commercially available complete feed that does not contain antibiotics was utilized in this study. Therefore, it is important to ascertain the effects of dietary Gln supplementation on the growth performance and intestinal development of Kele and Large White weaned piglets. This study is the first to confirm the efficacy of Gln in a Kele pig hybrid system. Gln supplementation may provide nutritional support for the development and utilization of local pig breed resources, as well as enhance the theoretical framework of amino acid nutrition for Chinese local pig breeds.

2. Materials and Methods

2.1. Animals and Management

All experimental protocols performed in the current study were authorized by the Animal Welfare Committee at Guizhou University, China (EAE-GZU-2021-T091). The animal experiments were conducted from November to December 2024.
A total of 48 Kele × Large White (Yorkshire) crossbred weaned pigs, averaging 30 days of age with an initial body weight (BW) of 7.42 ± 0.13 kg, were divided into three groups. Each group consisted of four replications, with four pigs per pen. The male pigs were castrated at day 15 of age. The diets included a control diet and the control diet supplemented with various levels of Gln. The control group received the basal diet supplemented with 2.45% alanine, while the 1% Gln group received the basal diet with 1.23% alanine and 1% Gln. The 2% Gln group received the basal diet with 2% Gln. The control diet and 1% Gln diet were supplemented with 2.45% or 1.23% alanine to create an isonitrogenous diet.
The basal diet was formulated based on a commercial compound feed for weaned pigs (Chia Tai Feed, Guiyang, China, product standard number: Q/GYCT 01-2024) and comprised ingredients such as corn, grains and their processed products, soybean meal (transgenic), calcium hydrogen phosphate, stone powder, sodium chloride, amino acids, amino acid salts and their analogs, vitamins, mineral elements and their complexes, zinc oxide, enzyme preparations, and more. We analyzed the contents of crude protein (18.5%), dry matter (86.29%), moisture (13.71%), calcium (0.82%), and total phosphorus (0.45%). The experiment lasted for a total of 28 days, and the basal diet met the nutritional requirements of the pigs.
All of the piglets in this study had ad libitum access to both water and feed. In the experimental period, the enclosure was regularly cleaned and disinfected, ensuring it remained clean, dry, and well ventilated. Routine management practices of the pig farm were diligently followed. Additionally, the piglets received regular vaccinations and deworming treatments.

2.2. Experimental Sampling

Individual pig body weights were measured initially and again on days 15 and 29 of the experiment. Daily feed intake was accurately recorded throughout the duration of the study. Average daily gain (ADG), average daily feed intake (ADFI), and gain-to-feed ratio (G:F) were calculated based on these measurements.
The stool of the piglets was observed regularly each afternoon from 3:00 PM to 4:00 PM. A score was assigned to the overall stool consistency of piglets in each group (replicate), as illustrated in Figure 1A. A stool score of 3 or higher was classified as diarrhea, while a score below 3 was considered normal. Additionally, jejunal tissue samples were quickly frozen and stored at −80 °C for the analysis of genes related to intestinal antioxidant capacity and tight junction integrity.
After a 12 h fast with free access to water, weaned piglets in the control and 1% Gln groups were euthanized (8 pigs were randomly selected per treatment for a total of 16 pigs) using an intravenous injection of pentobarbital sodium at a dosage of 50 mg/kg of BW. The intestinal tract was separated according to the methodologies outlined by Peng et al. (2019) [21]. A midline incision was made to open the abdominal wall, allowing for the complete exteriorization of the small intestine, which was subsequently divided into three segments. The segment situated approximately 15 cm from the pyloric junction is designated as the duodenum, while the section located 55 cm from the pyloric junction is identified as the jejunum, and a distal segment roughly 15 cm proximal to the ileocecal junction is classified as the ileum. The ileum, jejunum, and duodenum were sampled. Briefly, 4% paraformaldehyde (BL539A, Biosharp, Guangzhou, China) was used to fix about 2 cm of intestinal tissue (without any mechanical treatment), and subsequent HE staining tests were performed. After washing the intestinal contents with phosphate-buffered saline (B0015, Bio-Med Technology Co., Ltd., Shenzhen, China), the intestinal tissue was frozen in liquid nitrogen and stored at −80 °C for subsequent analysis.

2.3. Intestinal Morphology Detection

The small intestine was dehydrated and embedded in paraffin. The morphology of the small intestine was assessed after cutting it into 5 µm sections, which were then stained with hematoxylin and eosin. We measured the morphology using light microscopy (Nikon, Ti–S, Tokyo, Japan) in conjunction with a morphometry system (Nikon). Villus height (VH) was defined as the vertical distance from the tip of the villus to the crypt, while crypt depth (CD) was defined as the vertical distance from the crypt to the base. The results of these measurements were obtained by averaging the values from ten villi across four samples in each group. Additionally, the ratio of VH to CD for each segment was calculated.

2.4. RNA Extraction and RT-PCR

The mRNA expression levels of genes associated with intestinal health were analyzed using quantitative real-time PCR. Total RNA was extracted from tissue samples with the RNA Quick Extraction Kit (ES Science, Shanghai, China) following the user’s guide. cDNA was acquired from 1 μg of obtained total RNA using random primers and reverse transcriptase (Yeasen Biotechnology, Shanghai, China). A real-time quantitative PCR was carried out to analyze the relative mRNA expression of catalase (CAT), superoxide dismutase (SOD), zonula occludens-1 (ZO-1), Claudin1, and Occludin using SYBR Green Master Mix (Yeasen Biotechnology). The PCR conditions consisted of 40 cycles at 95 °C for 10 s and 60 °C for 20 s. Every sample was amplified in duplicate. Data analysis was conducted using β-actin as the internal control and by employing the 2−ΔΔCT method [22]. The gene-specific primers [23,24] utilized are listed in Table 1.

2.5. Statistical Analysis

Data were analyzed by employing ANOVA followed by Duncan’s multiple range tests for growth performance or independent-sample t-tests for intestinal morphology and mRNA expression, utilizing SPSS software version 20.0 (SPSS Inc., Chicago, IL, USA). The data’s variability is represented by the standard error of the mean (SEM). Different lowercase letters and asterisks (*) of peer data indicate statistically significant differences (p < 0.05), and probability values less than 0.05 are considered significant. A p value between 0.05 and 0.1 is considered a significant trend.

3. Results

3.1. Growth Performance

From days 0 to 14, dietary supplementation with 1% Gln and 2% Gln had a positive impact on ADG and ADFI compared to the control group (p < 0.05). There was also a trend toward a difference in the G:F among the three groups (p = 0.059). In addition, the G:F in the 1% Gln group was significantly increased compared to that in the control group (p < 0.05) and had a trend toward a difference compared to that in the 2% Gln group (p = 0.068). From days 15 to 28, no significant differences were detected in ADG or ADFI among the three groups (p > 0.05), while the G:F in the 1% Gln group increased compared to those in the control and 2% Gln groups (p < 0.05). Throughout the entire 28-day period, 1% Gln supplementation enhanced ADG and improved the G:F compared to the control group, while no differences were observed in ADFI. Additionally, 2% Gln supplementation did not have a significant effect on ADG, ADFI, or G:F (Table 2).
Given that growth performance in the 1% Gln treatment, but not in the 2% Gln treatment, was significantly different compared to the control group (Table 2), we used these two treatments only for the slaughter experiment (total 16 pigs), with 8 pigs each in the control and 1% Gln groups.

3.2. Diarrhea Rate

The diarrhea rate in the 1% Gln and 2% Gln groups was visibly reduced compared to the control group (p < 0.05), with no obvious difference found between the two Gln groups (Figure 1).

3.3. Small Intestinal Mucosal Morphology

After feeding piglets a diet containing 1% Gln, we observed some effects on the villus morphology of the small intestine. In the duodenum and jejunum, the VH and VH/CD were significantly higher in the 1% Gln group than in the control group (p < 0.05). However, there was no significant difference in CD between the two groups (p > 0.05). Additionally, there were no significant differences in ileal VH, CD, or VH/CD when comparing the control group and the 1% Gln group (p > 0.05) (Figure 2, Table 3).

3.4. Tight Junctions

Intestinal barrier function was assessed. Compared to the control group, 1% Gln supplementation significantly increased the mRNA expression levels of ZO-1, Occludin, and Claudin1 (p < 0.05) (Figure 3).

3.5. Antioxidant Ability

To investigate the impact of Gln on the intestinal antioxidant capabilities of weaned piglets, we examined the mRNA expression of the antioxidant factors CAT and SOD1. As shown in Figure 4, supplementation with 1% Gln significantly increased the mRNA expression of both CAT and SOD1 compared to the control group (p < 0.05) (Figure 4).

4. Discussion

At present, little is known about the intestinal development rules and the requirements for key nutrients in young Kele and Large White pigs. Gln is essential for intestinal development in piglets. In this study, the effect of Gln on the growth performance and intestinal development of weaned piglets of young Kele and Large White pigs was explored with experiments that provided a theoretical basis for the development of special feed for young Kele and Large White pigs. Improving the growth performance and health of pigs is crucial for the economic benefit of the pig industry. Weaning stress can lead to depressed growth performance, as evidenced by decreased feed intake, lower ADG, increased intestinal permeability, and lowered jejunal VH [25]. These findings suggest that stressful events occur in weanling piglets [26,27].
Gln has been suggested to alleviate weaning stress and is recognized to be an essential feed supplement due to its numerous beneficial effects for weaned pigs [15]. The European Food Safety Authority has deemed the utilization of Gln in animals to be safe and effective [28]. Much research has examined the effect of dietary Gln supplementation on growth performance in piglets. For instance, Li et al. (2024) discovered that a low-protein diet supplemented with 1% Gln improved growth performance, while higher concentrations of 2% and 3% L-Gln significantly hindered growth. This suggests that the appropriate concentration of Gln for piglets on low-protein diets should be below 2% [29]. Our findings align with this conclusion. In the current study, 1% Gln supplementation increased the ADG by 22.2% and increased the G:F by 16.8% compared to the control group. This aligns with the conclusions of He et al. (2016), who reported that 1% Gln supplementation in the control diet for weaning pigs increased the ADG by 24.1% and enhanced the G:F by 15.0% [12]. Other researchers have observed similar results [29,30]. Unfortunately, our results indicate that 2% Gln did not promote growth within 0–28 d, suggesting that this higher concentration does not achieve the beneficial effects seen with 1% Gln. One possible reason for this is that excessive Gln may inhibit the metabolism of other amino acids, such as arginine, leading to metabolic disorders that negatively affect growth performance [31]. There were no differences in ADG, ADFI, or G:F among the three treatments between days 15 and 28, except for a notable increase in the G:F in the 1% Gln group compared to the control, which was noted two weeks after weaning, and 2% Gln could enhance the ADG and ADFI, with effects similar to those of 1% Gln. This further emphasizes the importance of Gln supplementation for two weeks post-weaning. Additionally, dietary supplementation of 0.8% Gln can effectively increase the ADG of Min piglets (a local breed in Northeast China) and promote jejunal development in these piglets to some extent [23]. To the best of our knowledge, this is the only in vivo experiment examining the application of Gln in local pig breeds (Min piglets) in China. More research is needed to explore the effects of dietary Gln on growth performance in Kele piglets and Kele × Large White crossbred piglets.
The digestive system of weaned piglets is not fully mature, and the stress of weaning can damage intestinal mucosal cells. Gln serves as the primary energy source for these cells, supporting their proliferation, differentiation, and repair. By providing energy, Gln helps to maintain the normal morphology and structure of the intestinal mucosa and enhances its mechanical barrier function. This is important because it reduces the entry of harmful substances, such as bacteria and toxins, into the body, thereby lowering the risk of diarrhea [32]. Our results show that both 1% and 2% Gln can significantly reduce the diarrhea rate in weaned piglets, which aligns with the findings of Zou et al. They found that piglets nourished with a 1% Gln-enriched diet exhibited a reduced incidence of diarrhea and a shorter duration of diarrhea compared to those that were provided with the standard control diet following weaning [30].
Intestinal villi play a crucial role in the absorption of nutrients in the intestines. An increase in the height of these villi signifies a larger surface area and enhanced absorption capacity. The depth of the crypts indicates the regeneration rate and proliferation ability of intestinal cells. Hsu et al. (2010) discovered that supplementation with 1% and 2% Gln observably increased the VH in the duodena and jejuna of piglets [33]. Gln promotes the proliferation of crypt cells and aids in the repair of villi morphology. It helps expand the intestinal absorption area, thereby improving the utilization of feed nutrients [34,35]. In this study, the addition of 1% Gln resulted in an apparent increase in both the VH and VH/CD in the duodenum and jejunum. This indicates that Gln is beneficial for maintaining the integrity of intestinal morphology and structure, helping to alleviate intestinal damage caused by digestion and adaptation to dry feed and post-weaning stress in piglets.
The intestinal epithelium serves as the primary barrier of immune defense in piglets, and weaning stress significantly impacts its structure and function. Following weaning, the balance between the proliferation and apoptosis of intestinal epithelial cells is disrupted. This disruption results in the atrophy of intestinal villi and increased crypt cell proliferation. Consequently, the surface area available for nutrient absorption is reduced, while the gut’s barrier function weakens, making it easier for pathogens and toxins to enter the body [36,37]. Strategies to alleviate the adverse effects of weaning on the integrity of the intestinal mucosal barrier are critical for the health of neonates. As an antioxidant precursor, Gln plays an essential protective role under oxidative stress conditions, such as those associated with weaning. It increases glutathione synthesis, scavenges free radicals, reduces oxidative damage to the intestinal mucosa, and helps to maintain the intestinal mucosal barrier integrity [38,39]. The intestinal barrier is often assessed using various indicators, including tight junction proteins. Occludin and Claudins are the primary components of these proteins and connect with cytoskeletal proteins through ZO-1, playing a vital role in maintaining the structural integrity of the intestinal mucosa [40]. Tight junction proteins serve as the connections between intestinal epithelial cells, creating a physical barrier that prevents toxins and pathogens from accessing the body. This connection not only preserves the structural integrity of the intestinal epithelial cells, but also regulates intestinal permeability. When these tight junctions are damaged or destroyed, the intestinal barrier is compromised, leading to the invasion of pathogens and a heightened inflammatory response. Research has shown that Gln supplementation significantly mitigates the decrease in the protein levels of occludin, claudin-1, ZO-2, and ZO-3 induced by weaning [25]. Additionally, this study shows that Gln can increase the mRNA expression of ZO-1, occludin, and claudin-1 in the jejunum. This suggests that Gln can enhance the mucosal mechanical barrier function, reduce intestinal permeability, and maintain the intestinal health of piglets by modulating the expression of tight junction proteins.
Superoxide dismutase (SOD) is the primary antioxidant enzyme that protects against oxygen free radicals. It effectively prevents damage to proteins, lipids, and DNA caused by excessive oxygen free radicals. CAT plays a critical role in breaking down hydrogen peroxide in cells, converting it into water and oxygen. While hydrogen peroxide is a relatively stable reactive oxygen species, it can be toxic in high concentrations, leading to oxidative stress and compromising cell structure and function. CAT helps maintain redox balance by effectively decomposing hydrogen peroxide, which is attributed to the iron ion in its active site, which can combine with hydrogen peroxide and convert it into harmless by-products through a series of chemical reactions. In jejunal cells, CAT works alongside other antioxidant enzymes, such as SOD, to create a robust antioxidant defense system [41]. Early-weaned piglets are prone to oxidative stress in the small intestine. As the primary energy source for the intestinal mucosa, Gln can generate a significant amount of ATP, inhibit cell apoptosis, and participate in the synthesis of glutathione. This helps protect endothelial cells from oxygen free radical-mediated damage and enhances the body’s antioxidant capacity [5]. The addition of 0.8% Gln to the diet of piglets significantly increased the expression of SOD in the jejunum [23], and the addition of 1% Gln to the diet significantly upregulated the serum levels of CAT and SOD in weaned piglets [29]. Consistent with these findings, the present study indicates that the inclusion of Gln in the diet markedly enhances the expression of SOD1 and CAT mRNA, suggesting that glutamine effectively improves the antioxidant capacity of the jejunum and protects intestinal tissues from oxidative damage. This study reveals that Gln increases the mRNA expression of both CAT and SOD1, indicating that Gln enhances the antioxidant capacity of the jejunum and protects intestinal tissue from oxidative damage.

5. Conclusions

In summary, our study verifies that 1% Gln supplementation significantly enhances growth performance, jejunal antioxidative capacity, and tight junction function in piglets fed a commercial complete diet during an early age. Additionally, Gln supplementation reduced the rate of diarrhea. Overall, our results highlight the critical role of Gln in regulating antioxidative gene expression and tight junction gene expression in the jejunum of Kele and White pig crossbred weanling piglets. This suggests a beneficial impact on intestinal barrier function and overall health in weaned piglets. In the future, integrated multi-omics investigations that encompass the interplay between gut microbiota metagenomics, metabolomics, and host amino acid metabolism may serve as a promising avenue for thoroughly clarifying the nutritional and physiological impacts of Gln.

Author Contributions

Conceptualization and methodology, M.Z.; software, validation, formal analysis, investigation, resources, Y.C. and G.L.; data curation, Y.C. and L.T.; writing—original draft preparation, L.T.; writing—review and editing, Y.Z. and M.Z.; visualization, L.T.; supervision, Y.Z.; funding acquisition, M.Z.; project administration, M.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by funding from the National Natural Science Foundation of China (32202710), the Science and Technology Project of Guizhou Province (Qiankehe foundation-ZK [2022] General 159).

Institutional Review Board Statement

Animal experimental protocols performed in current study were approved by the Animal Welfare Committee at Guizhou University, China (EAE-GZU-2021-T091, 14 July 2021).

Data Availability Statement

The data supporting the findings of the present study are available from the corresponding author upon reasonable request.

Acknowledgments

We thank Guizhou Union Nature Group Ecological Industry Co., Ltd., for providing the experimental site and Kele and Large White Hybrid weaning piglets.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Zhang, C.; Wu, Z.; Hu, G.; Zhang, Y.; Ao, Z. Exploring characteristics of placental transcriptome and cord serum metabolome associated with low birth weight in kele pigs. Trop. Anim. Health Prod. 2023, 55, 340. [Google Scholar] [CrossRef] [Scilit]
  2. Tang, X.; Xiong, K. Intrauterine growth retardation affects intestinal health of suckling piglets via altering intestinal antioxidant capacity, glucose uptake, tight junction, and immune responses. Oxid. Med. Cell Longev. 2022, 2022, 2644205. [Google Scholar] [CrossRef] [Scilit]
  3. Hou, Y.; Yin, Y.; Wu, G. Dietary essentiality of “nutritionally non-essential amino acids” for animals and humans. Exp. Biol. Med. 2015, 240, 997–1007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Wu, G.; Wu, Z.; Dai, Z.; Yang, Y.; Wang, W.; Liu, C.; Wang, B.; Wang, J.; Yin, Y. Dietary requirements of "nutritionally non-essential amino acids" by animals and humans. Amino Acids 2013, 44, 1107–1113. [Google Scholar] [CrossRef] [Scilit]
  5. Wu, G.; Bazer, F.W.; Johnson, G.A.; Knabe, D.A.; Burghardt, R.C.; Spencer, T.E.; Li, X.L.; Wang, J.J. Triennial growth symposium: Important roles for l-glutamine in swine nutrition and production. J. Anim. Sci. 2011, 89, 2017–2030. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Wang, L.; Shen, M.; Liu, J.; Zhang, Y.; Zhu, Z.; Li, B.; Guo, S.; Yi, D.; Ding, B.; Wu, T.; et al. Effects of dietary l-glutamine supplementation on the intestinal function and muscle growth of piglets. Life 2024, 14, 405. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Leite, J.S.M.; Vilas-Boas, E.A.; Takahashi, H.K.; Munhoz, A.C.; Araujo, L.C.C.; Carvalho, C.R.; Donato, J., Jr.; Curi, R.; Carpinelli, A.R.; Cruzat, V. Liver lipid metabolism, oxidative stress, and inflammation in glutamine-supplemented ob/ob mice. J. Nutr. Biochem. 2025, 138, 109842. [Google Scholar] [CrossRef] [Scilit]
  8. Zhu, M.; Lai, W.; Yao, L.; Xu, E.; Chen, X.; Zhang, Y.; Li, X. Glutamine regulates gene expression profiles to increase the proliferation of porcine intestinal epithelial cells and the expansion of intestinal stem cells. Animals 2023, 13, 2917. [Google Scholar] [CrossRef] [Scilit]
  9. Fang, Y.; Lu, E.; Cheng, Y.; Xu, E.; Zhu, M.; Chen, X. Glutamine promotes porcine intestinal epithelial cell proliferation through the wnt/beta-catenin pathway. J. Agric. Food Chem. 2024, 72, 7155–7166. [Google Scholar] [CrossRef] [Scilit]
  10. Yan, L.; Fang, Y.; Lu, E.; Xu, E.; Zhang, Y.; Chen, X.; Zhu, M. Extracellular glutamine promotes intestinal porcine epithelial cell proliferation via arf1-mTORC1 pathway independently of rag GTPases. J. Agric. Food Chem. 2023, 71, 14251–14262. [Google Scholar] [CrossRef] [Scilit]
  11. Dai, Z.; Li, X.; Xi, P.; Zhang, J.; Wu, G.; Zhu, W. L-glutamine regulates amino acid utilization by intestinal bacteria. Amino Acids 2013, 45, 501–512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. He, J.; Feng, G.D.; Ao, X.; Li, Y.F.; Qian, H.X.; Liu, J.B.; Bai, G.Y.; He, Z.Z. Effects of l-glutamine on growth performance, antioxidant ability, immunity and expression of genes related to intestinal health in weanling pigs. Livest. Sci. 2016, 189, 102–109. [Google Scholar] [CrossRef] [Scilit]
  13. Li, Y.; Yu, Y.; Zhao, F.; Zhao, Z.; Dou, M.; Cao, Z.; Li, W.; Ding, K.; Zhang, C. Glutamine protects cow’s ruminal epithelial cells from acid-induced injury in vitro. Czech J. Anim. Sci. 2024, 69, 410–418. [Google Scholar] [CrossRef] [Scilit]
  14. Li, S.; Wen, X.; Yang, X.; Wang, L.; Gao, K.; Liang, X.; Xiao, H. Glutamine protects intestinal immunity through microbial metabolites rather than microbiota. Int. Immunopharmacol. 2023, 124, 110832. [Google Scholar] [CrossRef] [Scilit]
  15. Ji, F.J.; Wang, L.X.; Yang, H.S.; Hu, A.; Yin, Y.L. Review: The roles and functions of glutamine on intestinal health and performance of weaning pigs. Animal 2019, 13, 2727–2735. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Kim, S.W.; Wu, G. Regulatory role for amino acids in mammary gland growth and milk synthesis. Amino Acids 2009, 37, 89–95. [Google Scholar] [CrossRef] [Scilit]
  17. Poklukar, K.; Mestre, C.; Skrlep, M.; Candek-Potokar, M.; Ovilo, C.; Fontanesi, L.; Riquet, J.; Bovo, S.; Schiavo, G.; Ribani, A.; et al. A meta-analysis of genmetic and phenotypic diversity of European local pig breeds reveals genomic regions associated with breed differentiation for production traits. Genet. Sel. Evol. 2023, 55, 88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Liu, C.; Ran, X.; Wang, J.; Li, S.; Liu, J. Detection of genomic structural variations in Guizhou indigenous pigs and the comparison with other breeds. PLoS ONE 2018, 13, e0194282. [Google Scholar] [CrossRef] [Scilit]
  19. Leite Da Silva, A.; Dos Santos, S.G.C.G.; Saraiva, E.P.; Fonsêca, V.D.F.C.; Givisiez, P.E.N.; Pascoal, L.A.F.; Martins, T.D.D.; de Amorim, M.L.C.M. Supplementation of diets with glutamine and glutamic acid attenuated the effects of cold stress on intestinal mucosa and performance of weaned piglets. Anim. Prod. Sci. 2019, 59, 1880. [Google Scholar] [CrossRef] [Scilit]
  20. Wang, J.; Wang, N.; Qi, M.; Li, J.; Tan, B. Glutamine, glutamate, and aspartate differently modulate energy homeostasis of small intestine under normal or low energy status in piglets. Anim. Nutr. 2022, 8, 216–226. [Google Scholar] [CrossRef] [Scilit]
  21. Peng, P.; Chen, J.; Yao, K.; Yin, Y.; Long, L.; Fang, R. The effects of dietary supplementation with porous zinc oxide on growth performance, intestinal microbiota, morphology, and permeability in weaned piglets. Anim. Sci. J. 2019, 90, 1220–1228. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Rao, X.; Huang, X.; Zhou, Z.; Lin, X. An improvement of the 2^(-delta delta CT) method for quantitative real-time polymerase chain reaction data analysis. Biostat. Bioinform. Biomath. 2013, 3, 71–85. [Google Scholar]
  23. Zhang, J.; Wu, G.; Shan, A.; Han, Y.; Jin, Y.; Fang, H.; Zhao, Y.; Shen, J.; Zhou, C.; Li, C.; et al. Dietary glutamine supplementation enhances expression of ZO-1 and occludin and promotes intestinal development in min piglets. Acta Agric. Scand. Sect. A Anim. Sci. 2017, 67, 15–21. [Google Scholar] [CrossRef] [Scilit]
  24. Zhu, M.; Fang, Y.; Cheng, Y.; Xu, E.; Zhang, Y.; Zhai, Z. The Alleviating effect of taxifolin on deoxynivalenol-induced damage in porcine intestinal epithelial cells. Vet. Sci. 2024, 11, 156. [Google Scholar] [CrossRef] [Scilit]
  25. Wang, H.; Zhang, C.; Wu, G.; Sun, Y.; Wang, B.; He, B.; Dai, Z.; Wu, Z. Glutamine enhances tight junction protein expression and modulates corticotropin-releasing factor signaling in the jejunum of weanling piglets1,2. J. Nutr. 2015, 145, 25–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Campbell, J.M.; Crenshaw, J.D.; Polo, J. The biological stress of early weaned piglets. J. Anim. Sci. Biotechnol. 2013, 4, 124–127. [Google Scholar] [CrossRef] [Scilit]
  27. Gu, X.; Li, D.; She, R. Effect of weaning on small intestinal structure and function in the piglet. Arch. Tierernähr. 2002, 56, 275–286. [Google Scholar] [CrossRef] [Scilit]
  28. Bampidis, V.; Azimonti, G.; Lourdes Bastos, M.; Christensen, H.; Dusemund, B.; Kos Durjava, M.; Kouba, M.; López Alonso, M.; López Puente, S.; Marcon, F.; et al. Safety and efficacy of l-glutamine produced using corynebacterium glutamicum NITE BP-02524 for all animal species. EFSA J. 2020, 18, 6075. [Google Scholar]
  29. Li, J.; Bai, J.; Yang, Y.; Wu, Z. Low-protein diet supplemented with 1% l-glutamine improves growth performance, serum biochemistry, redox status, plasma amino acids, and alters fecal microbiota in weaned piglets. Anim. Nutr. 2024, 17, 144–154. [Google Scholar] [CrossRef] [Scilit]
  30. Zou, X.T.; Zheng, G.H.; Fang, X.J.; Jiang, J.F. Effects of glutamine on growth performance of weanling piglets. Czech J. Anim. Sci. 2006, 51, 444–448. [Google Scholar] [CrossRef] [Scilit]
  31. Holecek, M. Side effects of long-term glutamine supplementation. JPEN. J. Parenter. Enter. Nutr. 2013, 37, 607–616. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Wu, G.; Meier, S.A.; Knabe, D.A. Dietary glutamine supplementation prevents jejunal atrophy in weaned pigs. J. Nutr. 1996, 126, 2578–2584. [Google Scholar] [CrossRef] [Scilit]
  33. Hsu, C.B.; Huang, H.J.; Wang, C.H.; Yen, H.T.; Yu, B. The effect of glutamine supplement on small intestinal morphology and xylose absorptive ability of weaned piglets. Afr. J. Biotechnol. 2010, 9, 7003–7008. [Google Scholar]
  34. Chen, S.; Xia, Y.; Zhu, G.; Yan, J.; Tan, C.; Deng, B.; Deng, J.; Yin, Y.; Ren, W. Glutamine supplementation improves intestinal cell proliferation and stem cell differentiation in weanling mice. Food Nutr. Res. 2018, 62, 1439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Zou, T.D.; Deng, C.X.; Wang, Z.R.; Ye, Y.L.; You, J.M. Dietary alanyl-glutamine improves growth performance of weaned piglets through maintaining intestinal morphology and digestion–absorption function. Animal 2019, 13, 1826–1833. [Google Scholar] [CrossRef] [Scilit]
  36. Moeser, A.J.; Klok, C.V.; Ryan, K.A.; Wooten, J.G.; Little, D.; Cook, V.L.; Blikslager, A.T. Stress signaling pathways activated by weaning mediate intestinal dysfunction in the pig. Am. J. Physiol. Gastrointest. Liver Physiol. 2007, 292, G173–G181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Montagne, L.; Boudry, G.; Favier, C.; Huërou-Luron, I.L.; Lallès, J.; Sève, B. Main intestinal markers associated with the changes in gut architecture and function in piglets after weaning. Br. J. Nutr. 2007, 97, 45–57. [Google Scholar] [CrossRef] [Scilit]
  38. Bai, X.; Wang, K.; Khan, R.U.; Zhang, C.; Hu, H. Effect of glutamine on the growth performance, oxidative stress, and nrf2/p38 MAPK expression in the livers of heat-stressed broilers. Animals 2023, 13, 652. [Google Scholar] [CrossRef] [Scilit]
  39. Moine, L.; Díaz De Barboza, G.; Pérez, A.; Benedetto, M.; Tolosa De Talamoni, N. Glutamine protects intestinal calcium absorption against oxidative stress and apoptosis. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2017, 212, 64–71. [Google Scholar] [CrossRef] [Scilit]
  40. Schneeberger, E.E.; Lynch, R.D. The tight junction: A multifunctional complex. Am. J. Physiol. Cell Physiol. 2004, 286, C1213–C1228. [Google Scholar] [CrossRef] [Scilit]
  41. Yin, J.; Ren, W.; Liu, G.; Duan, J.; Yang, G.; Wu, L.; Li, T.; Yin, Y. Birth oxidative stress and the development of an antioxidant system in newborn piglets. Free Radic. Res. 2013, 47, 1027–1035. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Dietary Gln supplementation reduces the diarrhea rate. (A) Representative image of feces from weaned piglets and scoring criteria. (B) Statistics on the diarrhea rate. * p < 0.05. Note: When the score reaches or exceeds 3 points, it is classified as diarrhea; if the score is lower than 3, it is considered normal. The formula for calculating the diarrhea rate: diarrhea rate (%) = number of piglets with diarrhea ÷ (number of piglets × test days) × 100%.
Figure 1. Dietary Gln supplementation reduces the diarrhea rate. (A) Representative image of feces from weaned piglets and scoring criteria. (B) Statistics on the diarrhea rate. * p < 0.05. Note: When the score reaches or exceeds 3 points, it is classified as diarrhea; if the score is lower than 3, it is considered normal. The formula for calculating the diarrhea rate: diarrhea rate (%) = number of piglets with diarrhea ÷ (number of piglets × test days) × 100%.
Agriculture 15 00924 g001
Figure 2. The intestinal villus morphology of the small intestine in weaned piglets (n = 8). The small intestinal morphology of both the control and 1% Gln groups is displayed above.
Figure 2. The intestinal villus morphology of the small intestine in weaned piglets (n = 8). The small intestinal morphology of both the control and 1% Gln groups is displayed above.
Agriculture 15 00924 g002
Figure 3. The effect of Gln supplementation on the tight junctions of jejunal tissue in weaned piglets. (A) ZO-1 expression. (B) Occludin expression. (C) Claudin-1 expression. Data are presented as mean ± SEM, n = 4. * p < 0.05.
Figure 3. The effect of Gln supplementation on the tight junctions of jejunal tissue in weaned piglets. (A) ZO-1 expression. (B) Occludin expression. (C) Claudin-1 expression. Data are presented as mean ± SEM, n = 4. * p < 0.05.
Agriculture 15 00924 g003
Figure 4. Effects of Gln supplementation on the jejunal antioxidant capacity of weaned piglets. (A) CAT expression. (B) SOD1 expression. Data are presented as mean ± SEM, n = 4. * p < 0.05.
Figure 4. Effects of Gln supplementation on the jejunal antioxidant capacity of weaned piglets. (A) CAT expression. (B) SOD1 expression. Data are presented as mean ± SEM, n = 4. * p < 0.05.
Agriculture 15 00924 g004
Table 1. Primers for fluorescence quantitative PCR (n = 4).
Table 1. Primers for fluorescence quantitative PCR (n = 4).
GenesPrimer (5′-3′)Product Size (bp)
Claudin1F: TGCTGCTTCTCTCTGCCTTCTG
R: GCCTTGGTGTTGGGTAAGATGTTG
83
ZO-1F: CGGCGAAGGTAATTCAGTGT
R: TCTTCTCGGTTTGGTGGTCT
111
OccludinF: CAGCAGCAGTGGTAACTTGG
R: CCGTCGTGTAGTCTGTCTCG
110
CATF: TCCAGCCAGTGACCAGATGA
R: CCCGGTCAAAGTGAGCCATT
182
SOD1F: AAGGCCGTGTGTGTGCTGAA
R: GATCACCTTCAGCCAGTCCTTT
118
β-ActinF: TGCGGGACATCAAGGAGAAG
R: AGTTGAAGGTAGTTTCGTGG
216
Notes: CAT: catalase; SOD1: superoxide dismutase 1; ZO-1: zonula occludens-1.
Table 2. Effects of dietary Gln supplementation on growth performance in weanling pigs (n = 4).
Table 2. Effects of dietary Gln supplementation on growth performance in weanling pigs (n = 4).
ItemsControl1% Gln2% GlnSEMp-Value
Initial BW, kg7.437.507.350.100.600
Final BW, kg16.76 b18.89 a17.72 ab0.380.011
d 0–14
ADG, g276 b369 a335 a17.90.015
ADFI, g445 b508 a522 a16.60.022
G:F0.6190.7260.6430.030.059
d 15–28
ADG, g39144540619.30.181
ADFI, g78477579624.70.835
G:F0.499 b0.574 a0.508 b0.020.036
d 0–28
ADG, g333 b407 a370 ab13.0.0.010
ADFI, g61564265917.00.232
G:F0.543 b0.634 a0.562 b0.020.017
Values in the same row with distinct superscripts (a, b) have a statistically significant difference when compared to one another (p < 0.05).
Table 3. Effects of dietary Gln supplementation on intestinal morphology in weanling pigs.
Table 3. Effects of dietary Gln supplementation on intestinal morphology in weanling pigs.
ItemsControl1% Glnp-Value
Duodenum
VH, μM403.15 ± 12.81453.20 ± 7.860.029
CD, μM350.47 ± 8.95337.24 ± 3.810.245
VH/CD1.16 ± 0.021.35 ± 0.030.004
Jejunum
VH, μM261.50 ± 6.02356.31 ± 14.690.004
CD, μM243.25 ± 16.50233.73 ± 2.780.600
VH/CD1.10 ± 0.081.54 ± 0.070.014
Ileum
VH, μM339.19 ± 8.52336.55 ± 6.580.818
CF, μM246.97 ± 9.12243.83 ± 1.270.750
VH/CD1.38 ± 0.081.39 ± 0.020.916
Note: Data are presented as mean ± SEM, n = 8. VH: villus height; CD: crypt depth.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Tan, L.; Cheng, Y.; Liu, G.; Zhang, Y.; Zhu, M. Dietary Glutamine Supplementation Enhances Growth Performance and Jejunum Development in Kele and Large White Hybrid Weaned Piglets. Agriculture 2025, 15, 924. https://doi.org/10.3390/agriculture15090924

AMA Style

Tan L, Cheng Y, Liu G, Zhang Y, Zhu M. Dietary Glutamine Supplementation Enhances Growth Performance and Jejunum Development in Kele and Large White Hybrid Weaned Piglets. Agriculture. 2025; 15(9):924. https://doi.org/10.3390/agriculture15090924

Chicago/Turabian Style

Tan, Longjuan, Yujie Cheng, Guowei Liu, Yiyu Zhang, and Min Zhu. 2025. "Dietary Glutamine Supplementation Enhances Growth Performance and Jejunum Development in Kele and Large White Hybrid Weaned Piglets" Agriculture 15, no. 9: 924. https://doi.org/10.3390/agriculture15090924

APA Style

Tan, L., Cheng, Y., Liu, G., Zhang, Y., & Zhu, M. (2025). Dietary Glutamine Supplementation Enhances Growth Performance and Jejunum Development in Kele and Large White Hybrid Weaned Piglets. Agriculture, 15(9), 924. https://doi.org/10.3390/agriculture15090924

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop