The Effects of Sand-Fixing Agents and Trichoderma longibrachiatum on Soil Quality and Alfalfa Growth in Wind-Sand Soil

Abstract

The degradation of sandy land in Inner Mongolia presents a substantial threat to regional ecological security and the sustainable development of agriculture and animal husbandry. Planting alfalfa serves as a crucial recovery strategy; however, the inadequate capacity to retain water and nutrients impedes this process. The current reliance on a singular microbial remediation method has demonstrated limited effectiveness in addressing the challenges posed by sandy soil. While traditional sand-fixing agents can improve soil nutrients, they lack biological activity. Furthermore, the synergistic mechanisms between these approaches and their ecological impacts within a single season remain poorly understood. This study involved a pot experiment utilizing wind-sand soil as the substrate to evaluate the soil physicochemical properties, enzyme activities, and microbial community structure associated with the stress resistance of alfalfa. The results indicated that the medium concentration of sand-fixing agent (1:75) exhibited optimal water retention performance, thereby creating a conducive growth microenvironment for Trichoderma longibrachiatum and mitigating fluctuations in surface temperature and humidity. The combined treatment significantly improved the alpha diversity of soil microorganisms, thereby improving the stability and stress resistance of the system. Through the synergistic approach of “sand fixation and water retention–nutrient activation–improved stress resistance”, the microenvironment of sandy land was effectively improved, promoting alfalfa growth. This method offers “environmentally friendly and synergistic” technical support for the efficient cultivation and ecological restoration of alfalfa in sandy regions, while also contributing to the high-quality development of grassland animal husbandry.

1. Introduction

The degradation of Inner Mongolia’s sandy land has posed a serious threat to the regional ecological security and the sustainable development of agriculture and animal husbandry in northern China [1]. Alfalfa (Medicago sativa L.), a high-quality leguminous forage, possesses valuable ecological functions such as nitrogen fixation, soil improvement, windbreak, and sand fixation, while also providing high-protein feed for livestock [2]. However, the poor soil structure, weak water and nutrient retention capacity, and low microbial activity in sandy land present challenges for successful alfalfa establishment and yield stability [3]. Traditional chemical sand-fixing agents can improve soil structure in the short term, but they carry environmental risks such as biological toxicity and poor biodegradability [4]. Bioremediation technology can promote plant growth and soil nutrient cycling, but its ability to combat wind erosion and improve plant growth is limited when applied alone due to the fragility of the ecological environment and the constraints of its growth rate [5]. Therefore, the development of environmentally friendly and synergistic improvement technologies is crucial to overcoming the bottleneck in alfalfa cultivation on sandy land.

Starch-based biomass serves as a renewable raw material for the development of sand-fixing agents. These agents can form a porous network structure that significantly improves the aggregate stability and water-holding capacity of sandy soils. A biodegradable waterborne polyurethane sand-fixing agent was synthesized using polyether diol, toluene diisocyanate (TDI), dimethylolpropionic acid (DMPA), trimethylolpropane (TMP), and soluble starch as raw materials. The influence of the soluble starch content on the agent’s performance was investigated. The results showed that increasing the soluble starch content led to a corresponding increase in the agent’s viscosity and improved its water retention effect on sandy soil [6]. Starch-based sand-fixing agents have emerged as a research focus in recent years for sandy land management owing to their renewable raw materials and favorable environmental compatibility. Furthermore, a cassava starch–bagasse composite film was found to achieve synergistic controlled-release fertilization and rapid biodegradation. As the urea content increased, the material’s degradation rate and nutrient release rate were significantly accelerated. All formulations exhibited a cumulative urea release rate exceeding 90% within 30 days, providing a technical solution for reducing agricultural pollution and improving efficiency [7]. Srinivasan et al. developed a cardanol starch-modified binder for consolidating waste foundry sand, which significantly improved the material’s durability. The resulting composite exhibited a compressive strength of 20.99 MPa, excellent hydrophobicity, and robust anti-ultraviolet aging performance, confirming its efficacy in enhancing the stability of sand aggregates [8]. However, previous studies have primarily focused on optimizing the preparation process of sand-fixing agents, while their inherent biological activity and potential synergistic effects with microorganisms remain underexplored. The long-term ecological implications of these sand-fixing agents warrant further investigation.

The endophytic fungus Trichoderma longibrachiatum has demonstrated significant potential as a plant-growth-promoting agent. Hosseini et al. [9] isolated the strain WKA55 from peanut seeds, which exhibits lytic activities such as cellulase production and phosphorus-solubilizing ability. These characteristics have been shown to substantially improve the peanut germination rate by 91% and seedling vigor index by 70.45%. Additionally, Trichoderma species are known for their robust soil colonization capacity, enabling them to improve the physical and chemical properties of the soil environment while promoting the establishment of beneficial microbial communities. This, in turn, can improve crop stress resistance, growth, and yield [10]. However, the survival, reproduction, and physiological functioning of T. longibrachiatum may be challenged in the harsh conditions of arid sandy habitats, characterized by extreme drought, poor soil, large temperature fluctuations, and intense ultraviolet radiation. Further research is needed to verify the colonization ability and functional stability of this fungus under such environmental stresses.

The “Key technical system for the collaborative restoration of microorganisms, soil, biological crusts, and plants” developed by the Inner Mongolia Academy of Forestry Sciences has promoted the formation of biological crusts and the accumulation of soil nutrients [11]. This integrated restoration approach accelerates the transformation of sandy land from bare and vulnerable to vegetation-covered, providing a replicable and scalable model for ecological restoration in arid and semi-arid regions. The synergistic mechanism between starch-based sand-fixing agents and the fungus T. longibrachiatum is crucial for improving the efficiency and long-term effectiveness of sand fixation, as T. longibrachiatum can continue to exert ecological effects after the functional decline of sand-fixing agents. The systematic exploration of this synergistic relationship holds significant academic value and application prospects for desertification control in drylands.

Alfalfa cultivation on sandy soils is challenged by low temperatures, drought, and wind erosion [12]. Mobile drip irrigation (MDI) combined with an optimized deficit schedule can simultaneously raise alfalfa shoot biomass and reduce seasonal water use. Zhang et al. [13] found that, when the lateral move speed was set to 1.0 m h⁻¹ and the irrigation threshold was fixed at 65% of field capacity, a HYDRUS-2D full-cycle simulation predicted a 14% increase in dry-matter yield and a 21% decrease in total water consumption compared with conventional fixed-sprinkler irrigation. Additionally, Frankia forms symbiotic relationships with alfalfa, creating actinorhizal nodules that boost the roots’ ability to absorb nitrogen, phosphorus, and potassium, improve photosynthate transport, and increase biomass [14]. However, prior research predominantly focused on single-technology improvements, lacking comprehensive approaches that address soil properties, microbial communities, and plant physiology.

Despite advancements in sandy land improvement technology and alfalfa cultivation, studies to date have not thoroughly analyzed the synergistic mechanisms between various techniques and crop growth within joint restoration models. This is particularly true for the aeolian sandy soils of Inner Mongolia, which suffer from low organic matter, poor water retention, and severe wind erosion, highlighting the inadequacy of current solutions. This study investigates the synergistic effects of starch-based sand-fixing agents and T. longibrachiatum. By developing a multi-gradient application system for these agents, it systematically examines the coupling effects of this composite regulatory system on the water and salt transport characteristics of sandy soil, as well as the enzyme activity system. Furthermore, it elucidates the comprehensive mechanisms by which this system improves sandy soil quality, influences soil nutrient transformation processes, and promotes the growth and development of alfalfa.

2. Materials and Methods

2.1. Test Material

The starch-based sand-fixing agent utilized in this experiment was the membrane quantum sand-fixing agent produced by Runhan (Shandong, China) Ecological Science and Technology Co., Ltd. This environmentally friendly and biodegradable material is derived from plant components and primarily consists of organic substances, including plant glue and modified starch. The product appears as a light-yellow viscous liquid that readily dissolves in water. It exhibits excellent cementation properties that enable it to bond with sand and soil particles to form a crust layer measuring 1 to 3 mm. This layer effectively resists wind erosion, protects crop seedlings from airborne sand, and improves the survival rate of crops grown in sandy conditions.

The longibrachiatum strain utilized, Trichoderma longibrachiatum (strain preservation number MZSW-2023-014), was acquired from Ningbo Mingzhou Biotechnology Co., Ltd. (Ningbo, China). It is a filamentous fungus classified under the Ascomycetes of Fungi, commonly found in organic-matter-rich habitats such as soil and decaying wood. Initially, its hyphae are slender and white, while mature colonies exhibit a yellowish to dark green color with a villous or cotton-like appearance. The conidia of this fungus are elongated and sparsely branched, with bottle-shaped peduncles at the apex, giving rise to chain-like oval unicellular spores.

The alfalfa plant (Medicago sativa L.), specifically Zhongmu No. 1, serves as a primary forage and ecological plant in western Inner Mongolia due to its extended lifespan and robust regenerative capabilities, making it highly conducive for both environmental improvement and livestock nourishment.

The experiment took place at the Shandong Agricultural University Experimental Base in the Shandong Agricultural Hi-Tech Park, Taishan District, Tai’an City, China. Situated at 36°05′–36°20′ N, 117°03′–117°13′ E, the base experiences a warm temperate semi-humid continental monsoon climate with four distinct seasons. Due to its location at the southern foot of Mount Tai, the area is susceptible to drought, with simultaneous hot and rainy seasons. The local climate averages 13.0 °C, with a frost-free period lasting approximately 195 days annually and an average of 2536.2 h of sunshine per year. The experiment was set up in a solar greenhouse, with the temperature fluctuating in accordance with the local temperature throughout the day and night. Natural light and artificial irrigation were used. The soil used was taken from aeolian sandy soil collected in the Kubuqi Desert.

2.2. Experimental Design

An indoor pot-planting simulation system was utilized in the study, and aeolian sandy soil sourced from the Kubuqi Desert was used as the cultivation substrate. The soil was air-dried and subsequently sieved through a 2 mm mesh for preparation. Its physical and chemical attributes align with the standard features of wind-eroded and desertified soil, with a bulk density of 1.65 ± 0.03 g∙cm⁻³ and an organic matter content of 0.32% ± 0.05%.

T. longibrachiatum was cultured in potato glucose agar medium (PDA) at pH 5.6 ± 0.2 and 28 °C. Subsequently, the fungus was rinsed with sterile distilled water to create a spore suspension. The spore density was determined using a Neubauer chamber (depth of 1.0 mm); following centrifugation (300 rpm, 10 min) and serial dilution, it was adjusted to a standard concentration of 1 × 10⁶ CFU/mL.

Three concentration gradients of sand-fixing agent were set: 1:100 (low concentration, T1), 1:75 (medium concentration, T2), and 1:50 (high concentration, T3). These gradients were prepared using the spore suspension of T. longibrachiatum, while the control group (CK) was treated with an equal volume of spore suspension instead of the sand-fixing agent. In addition, a control group with only clear water added to sandy soil was set up for microbial sequencing for comparison with the other experimental groups (CK1). All treatment groups were uniformly sprayed on the substrate surface at an application rate of 800 g/m² using a pressure atomizer nozzle.

The experiment utilized standard polyethylene plastic pots (Φ19.5 cm × H 14.0 cm) filled with 3.5 kg of sandy soil per pot (on an air-dried basis). Alfalfa seeds were sown with precision, with 20 seeds evenly distributed on the surface of each pot at a depth of 2 cm. Following sowing, a sand-fixing agent solution was promptly applied based on the treatment plan. Water management was implemented through manual sprinkler irrigation, ensuring that water replenishment was maintained at 60% of the maximum water-holding capacity in the field every two days. Concurrently, overall water loss and temperature were monitored.

The experimental period spanned from 1 September to 30 November 2024. Morphological indices and physicochemical parameters of the substrate were assessed at the harvest stage. Agronomic management practices followed a uniform standard across all treatment groups, with the only distinction being the application of a sand fixation agent (

Table 1. Experimental design.

Group	Concentration of Sand-Fixing Agent	Whether to Add Trichoderma longiflorum	Remarks
CK	0	Yes
T1	1:100	Yes
T2	1:75	Yes
T3	1:50	Yes
CK1	0	No	For microbial sequencing only

).

2.3. Measurement Items and Methods

2.3.1. Determination of Crust Hardness of Sand Fixer

Sand was uniformly distributed in a flat-bottomed culture dish, followed by an even application of a sand-fixing agent based on preset parameters and concentration gradient. Subsequently, the specimen was left to dry in a cool, ventilated setting. The surface hardness of the dried sand samples was assessed using a texture analyzer [15]. Three distinct points were chosen from each sample for repeated measurements during the assessment, with three parallel experiments conducted for each concentration gradient of the sand-fixing agent to guarantee data reliability.

2.3.2. Determination of Soil Physical and Chemical Properties

After collection, the soil samples underwent thorough mixing. Approximately 200 g of the samples were then selected and transferred to a well-ventilated area indoors for natural air-drying. Once the soil sample achieved complete air-drying, any gravel, plant roots, litter, or other impurities were removed. Subsequently, the sample was sieved sequentially through 2.00 mm and 0.15 mm sieves, placed into a sealed bag, labeled with pertinent information, and stored in a cool, dry location for subsequent utilization.

The organic carbon content in the soil was assessed using the potassium dichromate external heating method [16]. Total nitrogen content [16] was measured using the Kjeldahl method, while available phosphorus content [17] was determined through the NaHCO₃ extraction method. Soil alkali-hydrolyzed nitrogen was determined via the alkali-hydrolyzed diffusion method [18] and soil available potassium content was determined using ammonium acetate extraction–flame photometry [18]. Catalase activity [19] was quantified using the sodium thiosulfate titration method, and urease activity [19] was assessed through the indophenol blue colorimetry method. Invertase and amylase activities [19] were determined using 3,5-dinitrosalicylic acid, and neutral phosphatase [19] in the soil was measured using sodium phenyl phosphate colorimetry.

2.3.3. Determination of Alfalfa Indicators

Alfalfa samples were collected in their entirety five days after the final watering. This was accomplished by gently rinsing the attached sand with deionized water and drying the surface with filter paper. First, measure the height and root length of the plant. The samples were then rapidly frozen in liquid nitrogen to halt physiological activity and subsequently transferred to an incubator containing dry ice for temporary storage. Upon returning to the laboratory, a precooled phosphoric acid buffer solution (concentration: 0.05 mol/L) was added as the extraction solution in a controlled manner under ice bath conditions. The tissues were thoroughly ground and crushed using a mortar. The ground sample was then centrifuged at 4 °C (12,000 rpm for 10 min), after which the supernatant was collected, dispensed into a cryopreservation tube, labeled, and stored in a refrigerator at −20 °C for subsequent analysis.

2.3.4. Soil Microbial Sequencing

Upon harvest, the sand and soil samples were collected from the pots, immediately stored at −80 °C, and subsequently shipped to Beijing Novo gene Co., Ltd. (Beijing, China) for sequencing analysis. For the fungal community, the ITS1-5F region was amplified using the primers ITS5-1737F(5′ggaagtaaaagtcgtaacaagg3′)/ITS2-2043R(5′gctgcgttcttcatcgatgc3′). The amplicon library was sequenced by PE250 using the Illumina NovaSeq 6000 platform. After the offline data were split by barcode, sequence concatenation was performed using FLASH (Version 1.2.11), and quality control filtering was carried out through fastp to obtain high-quality Clean Tags. The DADA2 module in QIIME2 (v2022.02) was used to denoise the sequences after quality control to generate amplicon sequence variations (ASVs). Fungal ASVs were annotated using the UNITE v9.0 database. The Chao1, Shannon, and Simpson indices reported in the article are all the result of alpha diversity analysis for the fungi community.

2.3.5. Data Processing and Analysis

The data were computed with Microsoft Office 2021, processed with SPSS 26, and visualized with Origin 2021. Mean values represented the data in graphs and tables. Each experimental index was analyzed using one-way ANOVA and the Duncan test (α = 0.05). Principal component analysis was employed for an overall comparison of the results. Mantel test analysis was conducted using the “ggcor” (v0.9.8.1) package of R software (v4.5.0), and the results were visualized using the “ggplot2” (v3.5.2) package.

3. Results

3.1. Effect of Sand-Fixing Agent Application on Soil Temperature and Humidity

As illustrated in Figure 1a, marked differences were observed during the initial phase of the experiment when the sand-fixing agent was applied in combination with T. longibrachiatum at varying dilution ratios. On day 3, the control group showed the highest water loss (16.3%), followed by treatments T1, T3, and T2, with losses of 12.8%, 9.1%, and 7.5%, respectively. By day 30, the relative order of water loss across groups remained unchanged, although the values increased to 22.6%, 20.1%, 18.7%, and 16.3%, respectively. Although the differences among groups gradually diminished in the later stages of the experiment, statistically significant disparities persisted. The temperature trend is presented in Figure 1b. Initially, the temperature rose with increasing concentrations of the sand-fixing agent. However, by the end of the experimental period, only the temperature in group T3 exceeded that of the other treatment groups, recorded as 26.8 °C on day 3 and 18.7 °C on day 30. No significant differences were detected among the remaining experimental groups.

3.2. Soil Catalase

The catalase activity of the soil in the control group (CK) was significantly higher than that of the other treatment groups, as shown in Figure 2. Compared to CK, the catalase activity in the T1, T2, and T3 treatment groups decreased by 61.59%, 76.23%, and 20.08%, respectively, with the T2 group exhibiting the lowest catalase activity. Overall, soil catalase activity decreased gradually with increasing sand-fixing agents, and then increased.

3.3. Soil Carbon-to-Nitrogen Ratio, Available Nitrogen, Available Phosphorus, and Available Potassium

Compared with the treatment groups, the control group (CK) exhibited lower levels of soil carbon and nitrogen (Figure 3a). The soil carbon–nitrogen ratios in T1, T2, and T3 were 227.08, 298.63, and 182.17, respectively, in contrast to 147.93 in CK. These values corresponded to significant increases of 53.51%, 101.88%, and 23.15%, with T2 showing the most pronounced improvement. The response of soil alkali-hydrolyzable nitrogen to sand-fixing agent concentration followed a unimodal pattern, initially increasing and then decreasing (Figure 3b). The alkali-hydrolyzable nitrogen content in T1 and T2 was 5.48 mg∙kg⁻¹ and 5.82 mg∙kg⁻¹, respectively, representing increases of 45.51% and 54.49% compared to CK. In contrast, T3 decreased significantly to 2.74 mg∙kg⁻¹, a reduction of 27.24% relative to CK. Sand-fixing agent application significantly influenced soil available potassium. As the agent concentration increased, the available potassium declined sharply before recovering gradually (Figure 3c). Compared with CK (33.97 mg∙kg⁻¹), T1 and T2 decreased by 18.78% and 55.73% to 27.59 mg∙kg⁻¹ and 15.04 mg∙kg⁻¹, respectively, while T3 increased by 18.92% to 40.56 mg∙kg⁻¹. All treatments resulted in significantly lower soil available phosphorus relative to CK (16.40 mg∙kg⁻¹; p < 0.05; Figure 3d). The values for T1, T2, and T3 were 10.64 mg∙kg⁻¹, 6.35 mg∙kg⁻¹, and 10.01 mg∙kg⁻¹, reflecting reductions of 35.11%, 61.27%, and 38.93%, respectively, indicating an inhibitory effect of the sand-fixing agent. In summary, the soil carbon–nitrogen ratio and alkali-hydrolyzable nitrogen showed an initial increase followed by a decrease with rising sand-fixing agent concentration, while the available potassium and available phosphorus showed a V-shaped trend of first decreasing and then increasing.

3.4. Effects of Different Treatments on Soil Enzymes

The addition of the sand-fixing agent significantly improved soil amylase activity (Figure 4a). The amylase activity in treatment groups T1, T2, and T3 increased by 19.92%, 48.59%, and 53.42%, respectively, compared to the control. Amylase activity was the highest in T3, though not significantly different from T2. Soil urease activity exhibited a nonlinear response, initially increasing, then decreasing, and finally increasing again with increasing sand-fixing agent concentration (Figure 4b). However, the differences between the treatment groups and the control were not statistically significant. In contrast, sucrase activity (Figure 4c) was significantly elevated in all treatment groups compared to the control, increasing by 33.85%, 117.55%, and 383.32% in T1, T2, and T3, respectively. Notably, sucrase activity showed a sharp upward trend at higher sand-fixing agent concentrations. Soil neutral phosphatase activity (Figure 4d) was slightly higher in the treatment groups compared to the control, but the overall differences were not statistically significant. The activity exhibited an initial increase followed by a decrease with increasing sand-fixing agent concentration.

3.5. Effects of Different Treatments on the Germination Rate of Alfalfa

As shown in Figure 5b, the hardness of the sand-consolidated layer increased linearly with the concentration of the sand-fixing agent across the tested range. At dilution ratios of 1:100, 1:75, and 1:50, the hardness values were 4.41 N, 6.35 N, and 8.39 N, representing significant increases of 204.29%, 338.74%, and 479.25%, respectively, compared to untreated land. In terms of alfalfa germination (Figure 5a), the application ratio of 1:75 resulted in a germination rate slightly higher than that of other treatments, though the difference was not statistically significant. Germination rates in the CK, T1, and T2 groups all exceeded 85%, whereas the T3 group showed a significantly lower rate of 68.33% compared to the other experimental groups.

3.6. Effects of Different Treatments on Enzyme Activities and Growth Status in Alfalfa

The activities of four key stress-resistant enzymes in alfalfa leaves were examined under different treatment conditions (Figure 6). Catalase activity (Figure 6a) was significantly lower in the T2 treatment group compared to the control (CK) and other treatments, exhibiting a 23.11% decrease. This suggests that the combined application of high-concentration sand-fixing agent and T. longibrachiatum improved the oxidative stress tolerance of alfalfa. Glutathione reductase activity (Figure 6b) initially decreased and then increased, with activities in T1, T2, and T3 being significantly lower than CK by 68.12%, 80.63%, and 42.50%, respectively. Polyphenol oxidase activity (Figure 6c) was significantly reduced in the T1, T2, and T3 groups compared to CK, with decreases of 48.03%, 60.93%, and 29.92%, respectively, indicating its role in phenolic metabolism and stress response. Superoxide dismutase activity (Figure 6d) was also significantly lower in the treatment groups compared to CK, with decreases of 74.89%, 90.22%, and 71.46% in T1, T2, and T3, respectively. In conclusion, the combined application of sand-fixing agents and T. longibrachiatum had a significant regulatory effect on alfalfa’s resistance to oxidative stress pressure. Alfalfa plants showed variations in both height and root length across different groups: the control group had a plant height of 13.5 cm; in comparison, the T1 group saw an 11.61% decrease in plant height, while the T2 and T3 groups experienced increases of 22.96% and 11.11%, respectively. For root length, the control group measured 13.6 cm, and by contrast, the T1, T2, and T3 groups all showed growth, with increases of 3.68%, 21.08%, and 15.93%, respectively, compared to the control.

3.7. Soil Microorganisms

In this study, we utilized high-throughput sequencing to analyze the soil microbial community upon harvest to optimize the biological functions of T. longibrachiatum. A control group (CK1) comprising only aeolian sandy soil and water was included for comparative purposes. The results, depicted in Figure 7a, revealed a marked increase in the relative abundance of T. longibrachiatum in the treatment groups where it was introduced compared to CK1. Furthermore, significant variations in the soil microbial community composition were observed between the treatment groups with and without T. longibrachiatum, while no notable distinctions were noted among the treatment groups with T. longibrachiatum.

The Chao1 index is employed for estimating species richness within a community, with a higher value indicating a greater number of species present. The Shannon index assesses species diversity by considering both richness and evenness, where a higher value signifies increased diversity within the community. Similarly, the Simpson index evaluates species diversity, with a focus on the dominance of particular species within the community. A lower Simpson index value indicates higher diversity within the community.

Figure 7b–d illustrate that the Chao1 index increased progressively in the experimental groups treated with T. longibrachiatum, indicating a favorable impact of medium and high concentrations of sand-fixing agents on microbial abundance. Correspondingly, the Shannon index exhibited a similar pattern in these groups, with a decline observed solely at high concentrations, implying a reduction in microbial evenness with high-concentration sand-fixing agents. Conversely, the Simpson index displayed distinct patterns among the experimental groups, with only the T2 group showing a lower value, indicative of higher species diversity and reduced dominance of specific species within its community, contrasting with the relatively higher concentration observed in CK1.

3.8. Correlation Analysis Between Stress-Resistant Protective Enzymes, Germination Rate of Alfalfa, and Soil Factors

Figure 8 illustrates that, at a significance threshold of p < 0.05, all measured soil indicators exhibited a strong correlation with alfalfa stress protection enzymes. Notably, a significant spatial coupling was observed between soil carbon–nitrogen ratio (S.C.N), alkalizable nitrogen (AN), and soil catalase (S.CAT) and crop stress protection enzyme activities. This finding suggests that these environmental factors may significantly influence the abundance and composition of T. longibrachiatum communities in wind-sand soil by modulating oxidative stress levels or nutrient availability. Furthermore, the results of Mantel’s r correlation strength analysis highlight a strong negative correlation between soil carbon–nitrogen ratio (S.C.N) and soil catalase activity (S.CAT), indicating that an increase in environmental pressure indicated by soil catalase activity corresponds to a decrease in soil nutrient levels. Additionally, a strong positive correlation was observed between soil sucrase activity (S.SC) and soil amylase activity (S.NP), underscoring a significant synergistic effect between these two soil enzymes in functional performance.

3.9. Scoring Based on Principal Component Analysis

Principal component analysis was used to compare the overall performance of the treatments and to support practical recommendations for their application [20]. The measured data were categorized into two groups based on the varying concerns related to crops, environment, and soil conditions: soil nutrients (including total nitrogen, available nitrogen, available phosphorus, available potassium, amylase, invertase, urease, and phosphatase) and alfalfa stress protection enzymes (comprising catalase, polyphenol oxidase, glutathione reductase, and superoxide dismutase). In regions with poor soil quality, emphasis should be placed on soil nutrient scores, whereas in areas facing strong environmental stress, priority should be given to the scores of crop stress resistance protective enzymes. Figure 9 illustrates the outcomes of the sand-fixing agent gradient experiment, where the soil nutrient score of the high-concentration treatment (T3) notably decreased, and the alfalfa stress resistance enzyme activity was lower compared to the control group. The soil nutrient scores of the low-concentration treatment (T1) were inferior to those of the medium-concentration treatment (T2), while the stress resistance enzyme activities of alfalfa fell between the medium- and high-concentration treatments and the control group. The medium-concentration treatment exhibited the highest soil nutrient score and the lowest alfalfa stress resistance protective enzyme score.

4. Discussion

4.1. Dynamic Effect of Sand-Fixing Agent on Water and Heat Preservation

The application of sand-fixing agents modulates water and heat retention near the ground surface by modifying the physical properties of the consolidated layer on the sand surface. Following initial application, the near-surface temperatures of all sand-fixing agent treatments with varying concentrations were higher compared to the control group. This temperature difference can be attributed to the formation of a crust layer by the sand-fixing agent, which reduces surface heat loss and establishes a localized heat-preserving microenvironment. During this initial phase, the structure of the crust layer remains relatively undisturbed by environmental factors, and the impact of concentration variations on heat retention is not yet fully evident. Previous studies have suggested that the consolidated layer created by sand-fixing agents also influences soil temperature [21]. Similarly, in the early stages of application, the protective layer formed by the sand-fixing agent on the sand surface decreases the rate of heat exchange between the air and the sand, resulting in elevated surface temperatures. However, after 27 days of exposure to environmental elements such as irrigation and wind erosion, significant differences in heat retention performance were observed: the group with a concentration ratio of 1:50 exhibited the highest temperature, followed by the 1:75 concentration group, while the 1:100 concentration group showed similar temperatures to the control group (Figure 1b). The compactness of the crust layer formed by high-concentration sand-fixing agents improves resistance to wind erosion, thereby preserving the structural integrity of the crust. This intact crust layer minimizes heat loss due to water evaporation, leading to improved heat retention performance. Conversely, the low-concentration crust layer is susceptible to damage from irrigation, resulting in the rapid deterioration of its heat retention capacity. Studies have indicated that, in regions prone to intense sandstorms, the robust crust layer formed by high-concentration sand-fixing agents exhibits greater stability, effectively resisting sand erosion, maintaining crust integrity, and sustaining heat preservation benefits [22]. Chemical sand-fixing agents also impact seedling emergence, with higher concentrations leading to increased surface crust hardness, impeding seedling growth and reducing germination rates [23]. Under the combined effects of sandstorms and irrigation, the low-concentration crust layer is prone to cracking and breakage, accelerating heat loss. Ren Tingjie et al. [24] observed that, when the consolidated layer is exposed to infrared heat, it absorbs infrared energy, converting it into heat and raising the temperature of the consolidated layer, thereby expediting the aging process of the sand-fixing agent.

The 1:75 concentration group demonstrated superior water retention performance compared to the 1:100 concentration group, with the 1:50 concentration group showing similar water retention capacity to the control group (Figure 1a). This highlights the nonlinear impact of sand-fixing agent concentration on water retention performance. Specifically, a moderate concentration (1:75) formed a crust layer that effectively reduced water evaporation without impeding water infiltration and storage due to excessive compactness. Conversely, a high concentration (1:50) resulted in a hard crust layer prone to pore clogging, hindering deep soil water penetration and leading to decreased water retention efficiency. A low concentration (1:100) yielded an inadequately structured crust layer that failed to inhibit evaporation effectively, resulting in limited water retention capacity. Elevated temperatures also contributed to accelerated water loss. In a study by Lu Liu et al. [25] on varying application rates of poly-γ-glutamic acid (γ-PGA), lower application rates improved soil water infiltration but produced a thin consolidation layer vulnerable to damage. Higher application rates reduced soil water permeability, aligning with the findings of this study. Despite the relatively minor loss of structural integrity in the high-concentration (1:50) treatment group, elevated near-surface temperatures accelerated water evaporation, leading to higher water loss rates compared to other concentration groups [24]. Previous research has indicated that improved crop growth often correlates with increased water consumption (transpiration) rates [26]. Investigations into different sand-fixing agents revealed that a moderate concentration performed optimally in maintaining soil moisture, with both excessively high and low concentrations proving detrimental to water retention [27], consistent with the current study’s outcomes.

4.2. Effects of Sand-Fixing Agents on the Germination Rate of Alfalfa

The concentration of sand-fixing agents significantly influences the germination rate of alfalfa, underscoring their crucial role in regulating the sandy land microenvironment. The medium-concentration (1:75) sand-fixing agent treatment resulted in a substantially higher alfalfa germination rate compared to the other groups, while the high-concentration (1:50) treatment markedly inhibited germination (Figure 5a). This phenomenon is closely linked to the crust hardness of the sand-fixing agent. Although the dense crust layer formed by the high-concentration sand-fixing agent has strong wind erosion resistance, its significantly increased hardness hinders the emergence of alfalfa seedlings, leading to a decrease in germination rate. As a dicotyledonous plant, alfalfa has a weak soil-penetrating ability and is particularly sensitive to surface crust hardness [28]. In contrast, the crust layer formed by the medium-concentration sand-fixing agent maintains structural stability without excessive hardening, providing a suitable physical environment for seed germination. While the low-concentration (1:100) treatment has a low crust hardness, its insufficient water retention capacity fails to maintain the optimal humidity for germination, resulting in no significant difference in germination rate compared to the control group. These findings suggest that, in practical applications, the concentration of the sand-fixing agent must be optimized to balance crust hardness and water retention in order to create a favorable initial habitat for alfalfa establishment.

4.3. Comprehensive Regulation of Sand-Fixing Agents on Soil Physical and Chemical Properties, Enzyme Activities, and Stress-Resistant Enzyme Activities of Alfalfa

Amylase, sucrase, urease, and phosphatase play crucial roles in the cycling of soil carbon, nitrogen, and phosphorus [29]. Their enzymatic activities serve as indicators of nitrogen transformation status and phosphorus availability in soil. Both microorganisms and soil enzymes profoundly influence soil structure, stability, nutrient dynamics, and vegetation restoration, thereby defining soil fertility and environmental quality [30]. The combined application of sand-fixing agents and T. longibrachiatum substantially impacts soil physicochemical properties. The soil carbon–nitrogen ratio exhibits a unimodal pattern of “initial increase followed by decrease” with rising sand-fixing agent concentrations (Figure 3a). Notably, the T2 group displays the highest carbon–nitrogen ratio, suggesting that T. longibrachiatum may modulate carbon–nitrogen balance by regulating their transformation processes. Regarding soil nutrient indicators, available nitrogen peaks in the T2 group, available phosphorus significantly rises in the CK group, and available potassium remains elevated in the T3 group (Figure 3b–d). This indicates that the combined effect of sand-fixing agents and Trichoderma alters nutrient utilization and accumulation by enhancing soil colloid adsorption or microbial transformation, with medium sand-fixing agent concentrations favoring nutrient accumulation and release. Busato Jader Galba et al. [31] investigated apatite-enriched vermicompost supplemented with Trichoderma asperellum and Trichoderma virens, revealing significant alterations in carbon and phosphorus contents due to Trichoderma activity.

Soil catalase activity exhibited a V-shaped trend in response to increasing concentrations of the sand-fixing agent (Figure 2). Notably, the activity in the control group exceeded that in the high-concentration treatment group. This difference was not attributed to the inhibition of microbial activity by the sand-fixing agent, but rather linked to environmental stress. Specifically, the near-surface temperature in the high-concentration sand-fixing agent treatment group was elevated, leading to accelerated water loss, reduced soil humidity, and heightened environmental stress. Therefore, soil catalase activity should be stimulated to counteract the pressure that may be caused by oxidative stress. The response of stress-resistant enzymes in alfalfa to the sand-fixing agent and Trichoderma was also influenced by environmental stress. Catalase activity was notably improved in the presence of Trichoderma, peaking in the T3 group (high-concentration sand-fixing agent + Trichoderma) within the experimental cohort. This improvement was attributed to the intense stress environment in the high-concentration treatment and the synergistic regulation of Trichoderma. Trichoderma was observed to further boost catalase activity to combat decreased humidity stress by enhancing crop stress perception. Conversely, the activities of catalase, glutathione reductase, polyphenol oxidase, and superoxide dismutase fluctuated across different concentrations, reflecting the intricate adaptation strategies of crops to humidity stress induced by sand-fixing agent concentration and the regulatory impact of alfalfa. It is worth noting that under the treatment of medium-concentration sand-fixing agents, the oxidative stress pressure may be relatively low, resulting in a decrease in the demand for enzyme activity. Plants respond to environmental stresses such as water stress by upregulating stress-resistant enzyme activities and other substances to maintain cell homeostasis. When analyzed in conjunction with the data on plant height and root length, a clear correlation emerges: experimental groups subjected to lower levels of oxidative stress exhibited relatively greater plant height and root length, accompanied by a more favorable growth status. (Figure 6e,f). Microbial intervention can influence this process through plant interactions, as noted in previous studies [32]. This finding aligns with the observed synergistic effect of Trichoderma and the sand-fixing agent on enzyme activity in the current study.

The introduction of T. longibrachiatum markedly increased its relative abundance within microbial communities (Figure 7a–d). Alpha diversity analysis revealed that in the T1 and CK groups, where sand-fixing agents were not applied, the diversity of the microbial community significantly declined following the introduction of T. longibrachiatum. This decline may be attributed to the relatively simple structure of the soil microbial community and its fragile ecological functions in the absence of sand-fixing agents. As a rapidly growing and highly competitive filamentous fungus, T. longibrachiatum effectively occupies the ecological niches of other microorganisms during colonization, leveraging its efficient nutrient acquisition mechanisms and antagonistic properties. For example, it secretes antibiotics, cell-wall-degrading enzymes, and other substances that inhibit the growth and reproduction of competing microorganisms [33], resulting in a significant reduction in species richness (Chao1 index) and diversity (Shannon index) within the community. In the treatment group receiving sand-fixing agents, the combined application of Trichoderma and medium to low concentrations of these agents significantly improved species richness and diversity. Notably, even at high concentrations of sand-fixing agents, microbial diversity remained unaffected. This observation further substantiates the conclusion that high concentrations of sand-fixing agents do not directly inhibit biological activity. Mantel test analysis further elucidated the intrinsic linkages between soil factors and alfalfa physiological stress. Both the soil carbon-to-nitrogen ratio (S.C.N) and alkali-hydrolyzable nitrogen (AN) showed significant spatial coupling with the activities of crop-stress-resistant enzymes, indicating that soil nutrient status serves as a key environmental driver regulating oxidative stress levels in alfalfa. Furthermore, a significant negative correlation was observed between soil catalase (S.CAT) and the carbon-to-nitrogen ratio (S.C.N), corroborating our finding that under high concentrations of the sand-fixing agent, intensified hydrothermal stress—reflected in elevated S.CAT activity—inhibited the accumulation of soil nutrients. In addition, the strong positive synergy between soil sucrase (S.SC) and amylase (S.AL) activities suggests that these two enzymes function in a coupled manner to drive soil carbon cycling and mitigate environmental stress. Relevant studies indicate that soil moisture status is a fundamental factor influencing the structure of microbial communities [33]. The reduction in humidity resulting from high-concentration sand-fixing agents may indirectly impact community composition by favoring drought-tolerant microbial groups. Nevertheless, T. longibrachiatum can still establish stable colonization and exert a regulatory role in such stress conditions, thereby demonstrating its robust environmental adaptability. Relevant studies indicate that soil moisture status is a fundamental factor influencing the structure of microbial communities [34]. The reduction in humidity resulting from high-concentration sand-fixing agents may indirectly impact community composition by favoring drought-tolerant microbial groups. Nevertheless, T. longibrachiatum can still establish stable colonization and exert a regulatory role in such stress conditions, thereby demonstrating its robust environmental adaptability.

4.4. Guiding Significance of Comprehensive Scores Based on Principal Component Analysis for Practical Applications

Principal component analysis scores [20] are calculated based on two main evaluation indicators—soil nutrients and alfalfa stress protection enzymes—offering a scientific basis for prioritizing the application of sand-fixing agents and T. longibrachiatum. The results indicate that the medium concentration of sand-fixing agent (T2) optimizes soil nutrient content and minimizes alfalfa stress-resistant enzyme scores. This suggests that, at this concentration, the agent sustains high soil fertility and improves nutrient conversion efficiency by boosting enzyme activities like amylase and sucrase, creating a favorable environment for crops in nutrient-poor soils. Conversely, the high-concentration treatment (T3) results in lower soil nutrient levels but forms a hard crust, suitable for sandy areas with severe wind erosion but minimal short-term fertility needs. Low-concentration treatments (T1) fall between the medium concentration and control, with enzyme activities balancing stress response and growth, making them apt for low-stress environments (Figure 9a,b).

The proposed classification and evaluation system enables the targeted selection of treatment solutions tailored to the specific requirements of diverse agricultural contexts. In regions with low soil fertility and high environmental stress, a combined application of a medium-concentration sand-fixing agent and Trichoderma is recommended to improve nutrient availability and create a favorable habitat. For areas facing severe soil erosion, a high-concentration sand-fixing agent should be employed to stabilize the soil surface. Conversely, in environments with low levels of environmental stress, a low-concentration treatment may be more conducive to the stable growth of crops.

5. Conclusions

This study examined the impact of varying concentrations of sand-fixing agents, both alone and in combination with T. longibrachiatum, on the micro-environment of sandy soils, soil physical and chemical properties, soil enzymes, and the stress-resistance enzymes of alfalfa. The primary conclusions are as follows.

(1)

The concentration of the sand-fixing agent critically influences water and heat retention. At a low concentration (1:100), the crust is thin and decomposes easily, initially providing some heat and water retention, but this effect diminishes over time. The medium concentration (1:75) offers optimal water retention by balancing evaporation suppression and water infiltration. Conversely, the high concentration (1:50) forms a dense crust that impedes water infiltration, while elevated surface temperatures increase evaporation, leading to poor water retention. The physical consolidation effect of the sand-fixing agent is temporary, hindering long-term stable microenvironment regulation.

(2)

The synergistic application of a sand-fixing agent and T. longibrachiatum improves soil physical and chemical properties and enzyme activities. A medium concentration of the sand-fixing agent, combined with Trichoderma, optimally regulates the soil carbon–nitrogen ratio and nutrient dynamics. Soil catalase activity indicates environmental stress levels: high activity under high-concentration treatment suggests strong stress, while medium-concentration treatment results in lower enzyme activity, indicating a more favorable environment. Low-concentration treatment shows intermediate enzyme activity.

(3)

The introduction of T. longibrachiatum markedly improved alfalfa’s stress resistance. The sand-fixing agent and Trichoderma exhibited complementary functions over time: initially, the sand-fixing agent retained water, facilitating Trichoderma colonization; subsequently, Trichoderma improved soil quality through metabolic activity, bolstering crop stress resistance.

(4)

Principal component analysis revealed that the combined application of a medium-concentration sand-fixing agent (1:75) and T. longibrachiatum exhibited superior performance in enhancing soil nutrients, enzyme activities, and crop stress resistance. This synergy of physical consolidation and biological regulation continuously optimized the sandy land microenvironment.