Protective Efficacy Induced by the Common Eimeria Antigen Elongation Factor 2 against Challenge with Three Eimeria Species in Chickens
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals, Parasites and Antiserum
2.2. Cloning of EmEF2 and Recombinant Plasmid Construction of pET-32a-EmEF2
2.3. Expression of Recombinant Protein EmEF2 and Western Blot Analysis
2.4. Determination of the Immune Responses Induced by rEmEF2 in Chickens
2.5. Experimental Assessment of Protective Efficacy of rEmEF2 against Infections by Three Eimeria Species in Chickens
2.6. Statistical Analysis
3. Results
3.1. Cloning of EmEF2 and Recombinant Plasmid Construction of pET-32a-EmEF2
3.2. Purification of Recombinant Protein EmEF2 and Western Blot Analysis
3.3. The Evaluation of Immune Responses Induced by rEmEF2 in Chickens
3.4. Protective Efficacy of rEmEF2 Vaccines against E. maxima, E. acervulina, E. tenella and Mixed Eimeria
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blake, D.P.; Marugan-Hernandez, V.; Tomley, F.M. Spotlight on avian pathology: Eimeria and the disease coccidiosis. Avian Pathol. 2021, 20, 209–213. [Google Scholar] [CrossRef] [PubMed]
- El-Shall, N.A.; Abd El-Hack, M.E.; Albaqami, N.M.; Khafaga, A.F.; Taha, A.E.; Swelum, A.A.; El-Saadony, M.T.; Salem, H.M.; El-Tahan, A.M.; AbuQamar, S.F.; et al. Phytochemical control of poultry coccidiosis: A review. Poult. Sci. 2022, 101, 101542. [Google Scholar] [CrossRef] [PubMed]
- Blake, D.P.; Knox, J.; Dehaeck, B.; Huntington, B.; Rathinam, T.; Ravipati, V.; Ayoade, S.; Gilbert, W.; Adebambo, A.O.; Jatau, I.D.; et al. Re-calculating the cost of coccidiosis in chickens. Vet. Res. 2020, 51, 115. [Google Scholar] [CrossRef] [PubMed]
- Lillehoj, H.S. Role of T lymphocytes and cytokines in coccidiosis. Int. J. Parasitol. 1998, 28, 1071–1081. [Google Scholar] [CrossRef] [PubMed]
- Zaheer, T.; Abbas, R.Z.; Imran, M.; Abbas, A.; Butt, A.; Aslam, S.; Ahmad, J. Vaccines against chicken coccidiosis with particular reference to previous decade: Progress, challenges, and opportunities. Parasitol. Res. 2022, 121, 2749–2763. [Google Scholar] [CrossRef] [PubMed]
- Lan, L.H.; Sun, B.B.; Zuo, B.X.; Chen, X.Q.; Du, A.F. Prevalence and drug resistance of avian Eimeria species in broiler chicken farms of Zhejiang province, China. Poult. Sci. 2017, 96, 2104–2109. [Google Scholar] [CrossRef]
- Li, J.; Yang, X.; Jia, Z.; Ma, C.; Pan, X.; Ma, D. Activation of ChTLR15/ChNF-kappaB-ChNLRP3/ChIL-1beta signaling transduction pathway mediated inflammatory responses to E. tenella infection. Vet. Res. 2021, 52, 15. [Google Scholar] [CrossRef]
- Zhang, L.; Liu, R.; Ma, L.; Wang, Y.; Pan, B.; Cai, J.; Wang, M. Eimeria tenella: Expression profiling of toll-like receptors and associated cytokines in the cecum of infected day-old and three-week old SPF chickens. Exp. Parasitol. 2012, 130, 442–448. [Google Scholar] [CrossRef]
- Blake, D.P.; Tomley, F.M. Securing poultry production from the ever-present Eimeria challenge. Trends Parasitol. 2014, 30, 12–19. [Google Scholar] [CrossRef]
- da Silva Giacomini, L.; Fernandes, F.D.; Guerra, R.R.; de Avila Botton, S.; Sangioni, L.A.; Vogel, F.S.F. Production performance and economic analysis of broiler chickens after vaccination with a live attenuated vaccine against avian coccidiosis. Parasitol. Res. 2023, 122, 1677–1683. [Google Scholar] [CrossRef]
- Ma, C.; Li, G.; Chen, W.; Jia, Z.; Yang, X.; Pan, X.; Ma, D. Eimeria tenella: IMP1 protein delivered by Lactococcus lactis induces immune responses against homologous challenge in chickens. Vet. Parasitol. 2021, 289, 109320. [Google Scholar] [CrossRef] [PubMed]
- Venkatas, J.; Adeleke, M.A. A review of Eimeria antigen identification for the development of novel anticoccidial vaccines. Parasitol. Res. 2019, 118, 1701–1710. [Google Scholar] [CrossRef] [PubMed]
- Vermeulen, A.N. Progress in recombinant vaccine development against coccidiosis. A review and prospects into the next millennium. Int. J. Parasitol. 1998, 28, 1121–1130. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Ma, C.; Wang, D.; Li, G.; Ma, D. Immune response and protective efficacy of recombinant Enterococcus faecalis displaying dendritic cell-targeting peptide fused with Eimeria tenella 3-1E protein. Poult. Sci. 2020, 99, 2967–2975. [Google Scholar] [CrossRef] [PubMed]
- Appledorn, D.M.; Aldhamen, Y.A.; Depas, W.; Seregin, S.S.; Liu, C.J.; Schuldt, N.; Quach, D.; Quiroga, D.; Godbehere, S.; Zlatkin, I.; et al. A new adenovirus based vaccine vector expressing an Eimeria tenella derived TLR agonist improves cellular immune responses to an antigenic target. PLoS ONE 2010, 5, e9579. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.; Tian, D.; Su, J.; Liu, X.; Shah, M.A.A.; Li, X.; Xu, L.; Yan, R.; Song, X. Protective Efficacy of Rhomboid-Like Protein 3 as a Candidate Antigen Against Eimeria maxima in Chickens. Front. Microbiol. 2021, 12, 614229. [Google Scholar] [CrossRef] [PubMed]
- Geng, T.; Luo, L.; Wang, Y.; Shen, B.; Fang, R.; Hu, M.; Zhao, J.; Zhou, Y. Evaluation of immunoprotective effects of recombinant proteins and DNA vaccines derived from Eimeria tenella surface antigen 6 and 15 in vivo. Parasitol. Res. 2022, 121, 235–243. [Google Scholar] [CrossRef] [PubMed]
- Pastor-Fernandez, I.; Kim, S.; Marugan-Hernandez, V.; Soutter, F.; Tomley, F.M.; Blake, D.P. Vaccination with transgenic Eimeria tenella expressing Eimeria maxima AMA1 and IMP1 confers partial protection against high-level E. maxima challenge in a broiler model of coccidiosis. Parasites Vectors 2020, 13, 343. [Google Scholar] [CrossRef]
- Wang, M.; Tian, D.; Xu, L.; Lu, M.; Yan, R.; Li, X.; Song, X. Protective efficacy induced by Eimeria maxima rhomboid-like protein 1 against homologous infection. Front. Vet. Sci. 2022, 9, 1049551. [Google Scholar] [CrossRef]
- Yang, G.; Li, J.; Zhang, X.; Zhao, Q.; Liu, Q.; Gong, P. Eimeria tenella: Construction of a recombinant fowlpox virus expressing rhomboid gene and its protective efficacy against homologous infection. Exp. Parasitol. 2008, 119, 30–36. [Google Scholar] [CrossRef]
- Talebi, A. Protein profiles of five avian Eimeria species. Avian Pathol. 1995, 24, 731–735. [Google Scholar] [CrossRef]
- Sasai, K.; Lillehoj, H.S.; Hemphill, A.; Matsuda, H.; Hanioka, Y.; Fukata, T.; Baba, E.; Arakawa, A. A chicken anti-conoid monoclonal antibody identifies a common epitope which is present on motile stages of Eimeria, Neospora, and Toxoplasma. J. Parasitol. 1998, 84, 654–656. [Google Scholar] [CrossRef]
- Liu, J.; Liu, L.; Li, L.; Tian, D.; Li, W.; Xu, L.; Yan, R.; Li, X.; Song, X. Protective immunity induced by Eimeria common antigen 14-3-3 against Eimeria tenella, Eimeria acervulina and Eimeria maxima. BMC Vet. Res. 2018, 14, 337. [Google Scholar] [CrossRef]
- Liu, L.; Huang, X.; Liu, J.; Li, W.; Ji, Y.; Tian, D.; Tian, L.; Yang, X.; Xu, L.; Yan, R.; et al. Identification of common immunodominant antigens of Eimeria tenella, Eimeria acervulina and Eimeria maxima by immunoproteomic analysis. Oncotarget 2017, 8, 34935–34945. [Google Scholar] [CrossRef]
- Tian, L.; Li, W.; Huang, X.; Tian, D.; Liu, J.; Yang, X.; Liu, L.; Yan, R.; Xu, L.; Li, X.; et al. Protective Efficacy of Coccidial Common Antigen Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH) against Challenge with Three Eimeria Species. Front. Microbiol. 2017, 8, 1245. [Google Scholar] [CrossRef]
- Flygaard, R.K.; Malacrida, B.; Kiely, P.; Jenner, L.B. Purification and characterization of native human elongation factor 2. Protein Expr. Purif. 2019, 158, 15–19. [Google Scholar] [CrossRef]
- Kaul, G.; Pattan, G.; Rafeequi, T. Eukaryotic elongation factor-2 (eEF2): Its regulation and peptide chain elongation. Cell Biochem. Funct. 2011, 29, 227–234. [Google Scholar] [CrossRef]
- Ryazanov, A.G. Elongation factor-2 kinase and its newly discovered relatives. FEBS Lett. 2002, 514, 26–29. [Google Scholar] [CrossRef]
- Zhu, H.; Yang, X.; Liu, J.; Zhou, L.; Zhang, C.; Xu, L.; Qin, Q.; Zhan, L.; Lu, J.; Cheng, H.; et al. Eukaryotic elongation factor 2 kinase confers tolerance to stress conditions in cancer cells. Cell Stress Chaperones 2015, 20, 217–220. [Google Scholar] [CrossRef]
- Atkinson, G.C. The evolutionary and functional diversity of classical and lesser-known cytoplasmic and organellar translational GTPases across the tree of life. BMC Genom. 2015, 16, 78. [Google Scholar] [CrossRef]
- Susorov, D.; Zakharov, N.; Shuvalova, E.; Ivanov, A.; Egorova, T.; Shuvalov, A.; Shatsky, I.N.; Alkalaeva, E. Eukaryotic translation elongation factor 2 (eEF2) catalyzes reverse translocation of the eukaryotic ribosome. J. Biol. Chem. 2018, 293, 5220–5229. [Google Scholar] [CrossRef]
- Agallou, M.; Pantazi, E.; Tsiftsaki, E.; Toubanaki, D.K.; Gaitanaki, C.; Smirlis, D.; Karagouni, E. Induction of protective cellular immune responses against experimental visceral leishmaniasis mediated by dendritic cells pulsed with the N-terminal domain of Leishmania infantum elongation factor-2 and CpG oligodeoxynucleotides. Mol. Immunol. 2018, 103, 7–20. [Google Scholar] [CrossRef]
- Kushawaha, P.K.; Gupta, R.; Sundar, S.; Sahasrabuddhe, A.A.; Dube, A. Elongation factor-2, a Th1 stimulatory protein of Leishmania donovani, generates strong IFN-gamma and IL-12 response in cured Leishmania-infected patients/hamsters and protects hamsters against Leishmania challenge. J. Immunol. 2011, 187, 6417–6427. [Google Scholar] [CrossRef]
- Probst, P.; Stromberg, E.; Ghalib, H.W.; Mozel, M.; Badaro, R.; Reed, S.G.; Webb, J.R. Identification and characterization of T cell-stimulating antigens from Leishmania by CD4 T cell expression cloning. J. Immunol. 2001, 166, 498–505. [Google Scholar] [CrossRef]
- Baragana, B.; Hallyburton, I.; Lee, M.C.; Norcross, N.R.; Grimaldi, R.; Otto, T.D.; Proto, W.R.; Blagborough, A.M.; Meister, S.; Wirjanata, G.; et al. A novel multiple-stage antimalarial agent that inhibits protein synthesis. Nature 2015, 522, 315–320. [Google Scholar] [CrossRef]
- Dechering, K.J.; Duerr, H.P.; Koolen, K.M.J.; Gemert, G.V.; Bousema, T.; Burrows, J.; Leroy, D.; Sauerwein, R.W. Modelling mosquito infection at natural parasite densities identifies drugs targeting EF2, PI4K or ATP4 as key candidates for interrupting malaria transmission. Sci. Rep. 2017, 7, 17680. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Hodgson, J.N. Coccidiosis: Oocyst counting technique for coccidiostat evaluation. Exp. Parasitol. 1970, 28, 99–102. [Google Scholar] [CrossRef]
- Johnson, J.; Reid, W.M. Anticoccidial drugs: Lesion scoring techniques in battery and floor-pen experiments with chickens. Exp. Parasitol. 1970, 28, 30–36. [Google Scholar] [CrossRef]
- McManus, E.C.; Campbell, W.C.; Cuckler, A.C. Development of resistance to quinoline coccidiostats under field and laboratory conditions. J. Parasitol. 1968, 54, 1190–1193. [Google Scholar] [CrossRef]
- Britez, J.D.; Rodriguez, A.E.; Di Ciaccio, L.; Marugan-Hernandez, V.; Tomazic, M.L. What Do We Know about Surface Proteins of Chicken Parasites Eimeria? Life 2023, 13, 1295. [Google Scholar] [CrossRef]
- Zhou, X.; Wang, L.; Wang, Z.; Zhu, P.; Chen, Y.; Yu, C.; Chen, S.; Xie, Y. Impacts of Eimeria coinfection on growth performance, intestinal health and immune responses of broiler chickens. Vet. Parasitol. 2023, 322, 110019. [Google Scholar] [CrossRef]
- Tomal, F.; Sadrin, G.; Gaboriaud, P.; Guitton, E.; Sedano, L.; Lallier, N.; Rossignol, C.; Larcher, T.; Rouille, E.; Ledevin, M.; et al. The caecal microbiota promotes the acute inflammatory response and the loss of the intestinal barrier integrity during severe Eimeria tenella infection. Front. Cell. Infect. Microbiol. 2023, 13, 1250080. [Google Scholar] [CrossRef]
- Dhama, K.; Mahendran, M.; Gupta, P.K.; Rai, A. DNA vaccines and their applications in veterinary practice: Current perspectives. Vet. Res. Commun. 2008, 32, 341–356. [Google Scholar] [CrossRef]
- Yu, Z.; Chen, S.; Huang, J.; Ding, W.; Chen, Y.; Su, J.; Yan, R.; Xu, L.; Song, X.; Li, X. A multiepitope vaccine encoding four Eimeria epitopes with PLGA nanospheres: A novel vaccine candidate against coccidiosis in laying chickens. Vet. Res. 2022, 53, 27. [Google Scholar] [CrossRef]
- Blake, D.P.; Worthing, K.; Jenkins, M.C. Exploring Eimeria Genomes to Understand Population Biology: Recent Progress and Future Opportunities. Genes 2020, 11, 1103. [Google Scholar] [CrossRef]
- Brown Jordan, A.; Blake, D.; Beard, J.; Beharry, A.; Serrette, L.; Soleyn, A.; Sookhoo, J.; Blake, L.; Brown, G.; Oura, C. Molecular Identification of Eimeria Species in Broiler Chickens in Trinidad, West Indies. Vet. Sci. 2018, 5, 12. [Google Scholar] [CrossRef]
- Jatau, I.D.; Lawal, I.A.; Kwaga, J.K.; Tomley, F.M.; Blake, D.P.; Nok, A.J. Three operational taxonomic units of Eimeria are common in Nigerian chickens and may undermine effective molecular diagnosis of coccidiosis. BMC Vet. Res. 2016, 12, 86. [Google Scholar] [CrossRef]
- Song, X.; Ren, Z.; Yan, R.; Xu, L.; Li, X. Induction of protective immunity against Eimeria tenella, Eimeria necatrix, Eimeria maxima and Eimeria acervulina infections using multivalent epitope DNA vaccines. Vaccine 2015, 33, 2764–2770. [Google Scholar] [CrossRef]
- Innes, E.A.; Vermeulen, A.N. Vaccination as a control strategy against the coccidial parasites Eimeria, Toxoplasma and Neospora. Parasitology 2006, 133, 145–168. [Google Scholar] [CrossRef] [PubMed]
- Zhao, P.; Wang, C.; Ding, J.; Zhao, C.; Xia, Y.; Hu, Y.; Zhang, L.; Zhou, Y.; Zhao, J.; Fang, R. Evaluation of immunoprotective effects of recombinant protein and DNA vaccine based on Eimeria tenella surface antigen 16 and 22 in vivo. Parasitol. Res. 2021, 120, 1861–1871. [Google Scholar] [CrossRef]
- Song, X.; Xu, L.; Yan, R.; Huang, X.; Li, X. Construction of Eimeria tenella multi-epitope DNA vaccines and their protective efficacies against experimental infection. Vet. Immunol. Immunopathol. 2015, 166, 79–87. [Google Scholar] [CrossRef]
- Chapman, H.D. Milestones in avian coccidiosis research: A review. Poult. Sci. 2014, 93, 501–511. [Google Scholar] [CrossRef]
- Yun, C.H.; Lillehoj, H.S.; Lillehoj, E.P. Intestinal immune responses to coccidiosis. Dev. Comp. Immunol. 2000, 24, 303–324. [Google Scholar] [CrossRef]
- Lillehoj, H.S.; Choi, K.D. Recombinant chicken interferon-gamma-mediated inhibition of Eimeria tenella development in vitro and reduction of oocyst production and body weight loss following Eimeria acervulina challenge infection. Avian Dis. 1998, 42, 307–314. [Google Scholar] [CrossRef]
- Bremner, A.; Kim, S.; Morris, K.M.; Nolan, M.J.; Borowska, D.; Wu, Z.; Tomley, F.; Blake, D.P.; Hawken, R.; Kaiser, P.; et al. Kinetics of the Cellular and Transcriptomic Response to Eimeria maxima in Relatively Resistant and Susceptible Chicken Lines. Front. Immunol. 2021, 12, 653085. [Google Scholar] [CrossRef]
- Kogut, M.H.; Lange, C. Interferon-gamma-mediated inhibition of the development of Eimeria tenella in cultured cells. J. Parasitol. 1989, 75, 313–317. [Google Scholar] [CrossRef]
- Laidlaw, B.J.; Craft, J.E.; Kaech, S.M. The multifaceted role of CD4(+) T cells in CD8(+) T cell memory. Nat. Rev. Immunol. 2016, 16, 102–111. [Google Scholar] [CrossRef]
- Zhou, B.H.; Jia, L.S.; Guo, H.W.; Ding, H.Y.; Yang, J.Y.; Wang, H.W. Eukaryotic elongation factor 2 is involved in the anticoccidial action of diclazuril in the second-generation merozoites of Eimeria tenella. Vet. Parasitol. 2019, 276, 108991. [Google Scholar] [CrossRef] [PubMed]
- Constantinoiu, C.C.; Molloy, J.B.; Jorgensen, W.K.; Coleman, G.T. Antibody response against endogenous stages of an attenuated strain of Eimeria tenella. Vet. Parasitol. 2008, 154, 193–204. [Google Scholar] [CrossRef] [PubMed]
- Wallach, M. Role of antibody in immunity and control of chicken coccidiosis. Trends Parasitol. 2010, 26, 382–387. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.H.; Wang, H.W.; Wang, X.Y.; Zhang, L.F.; Zhang, K.Y.; Xue, F.Q. Eimeria tenella: Effects of diclazuril treatment on microneme genes expression in second-generation merozoites and pathological changes of caeca in parasitized chickens. Exp. Parasitol. 2010, 125, 264–270. [Google Scholar] [CrossRef] [PubMed]
- Francis, M.J. Recent Advances in Vaccine Technologies. Vet. Clin. N. Am. Small Anim. Pract. 2018, 48, 231–241. [Google Scholar] [CrossRef] [PubMed]
- Nelde, A.; Rammensee, H.G.; Walz, J.S. The Peptide Vaccine of the Future. Mol. Cell. Proteom. 2021, 20, 100022. [Google Scholar] [CrossRef] [PubMed]
- O’Neill, C.L.; Shrimali, P.C.; Clapacs, Z.E.; Files, M.A.; Rudra, J.S. Peptide-based supramolecular vaccine systems. Acta Biomater. 2021, 133, 153–167. [Google Scholar] [CrossRef] [PubMed]
- Alharbi, N.; Skwarczynski, M.; Toth, I. The influence of component structural arrangement on peptide vaccine immunogenicity. Biotechnol. Adv. 2022, 60, 108029. [Google Scholar] [CrossRef] [PubMed]
- Mahmoodi, S.; Amirzakaria, J.Z.; Ghasemian, A. In silico design and validation of a novel multi-epitope vaccine candidate against structural proteins of Chikungunya virus using comprehensive immunoinformatics analyses. PLoS ONE 2023, 18, e0285177. [Google Scholar] [CrossRef]
- Blake, D.P.; Pastor-Fernandez, I.; Nolan, M.J.; Tomley, F.M. Recombinant anticoccidial vaccines—A cup half full? Infect. Genet. Evol. 2017, 55, 358–365. [Google Scholar] [CrossRef]
- Yang, X.; Song, X.; Liu, J.; Chen, Q.; An, T.; Liu, Q. Protection of hatchlings against coccidiosis by maternal antibodies to four recombinant proteins of Eimeria tenella, Eimeria acervulina and Eimeria maxima. Vet. Parasitol. 2022, 312, 109813. [Google Scholar] [CrossRef]
- Juarez-Estrada, M.A.; Tellez-Isaias, G.; Graham, D.M.; Laverty, L.; Gayosso-Vazquez, A.; Alonso-Morales, R.A. Identification of Eimeria tenella sporozoite immunodominant mimotopes by random phage-display peptide libraries-a proof of concept study. Front. Vet. Sci. 2023, 10, 1223436. [Google Scholar] [CrossRef]
- Ding, J.; Qian, W.; Liu, Q.; Liu, Q. Multi-epitope recombinant vaccine induces immunoprotection against mixed infection of Eimeria spp. Parasitol. Res. 2012, 110, 2297–2306. [Google Scholar] [CrossRef] [PubMed]
- Talebi, A.; Mulcahy, G. Eimeria tenella: B-cell epitope mapping following primary and secondary infections. Exp. Parasitol. 2006, 113, 235–238. [Google Scholar] [CrossRef] [PubMed]
- Ma, D.; Gao, M.; Li, J.; Ma, C.; Li, G. Construction of novel cytokine by fusion of chicken IL-2 signal peptide to mature chicken IL-15 and comparison of the adjuvant effects by DNA immunization against Eimeria challenge. Vet. Immunol. Immunopathol. 2013, 156, 114–120. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.; Park, I.; Wickramasuriya, S.S.; Arous, J.B.; Koziol, M.E.; Lillehoj, H.S. Co-administration of chicken IL-7 or NK-lysin peptide 2 enhances the efficacy of Eimeria elongation factor-1alpha vaccination against Eimeria maxima infection in broiler chickens. Poult. Sci. 2022, 101, 102013. [Google Scholar] [CrossRef]
- Wang, Q.; Chen, L.; Li, J.; Zheng, J.; Cai, N.; Gong, P.; Li, S.; Li, H.; Zhang, X. A novel recombinant BCG vaccine encoding eimeria tenella rhomboid and chicken IL-2 induces protective immunity against coccidiosis. Korean J. Parasitol. 2014, 52, 251–256. [Google Scholar] [CrossRef]
- Schunk, M.K.; Macallum, G.E. Applications and optimization of immunization procedures. ILAR J. 2005, 46, 241–257. [Google Scholar] [CrossRef]
- Nasri, T.; Sangmaneedet, S.; Nam, N.H.; Worawong, K.; Taweenan, W.; Sukon, P. Protective efficacy of new-generation anticoccidial vaccine candidates against Eimeria infection in chickens: A meta-analysis of challenge trials. Vet. Parasitol. 2022, 306, 109724. [Google Scholar] [CrossRef]
- Elnaggar, A.; Mahmoud, H.; Saber, S. Quality control procedure for Coccidial vaccines versus different routes of immunization. Vet. World 2022, 15, 2342–2347. [Google Scholar] [CrossRef]
- Gaghan, C.; Adams, D.; Mohammed, J.; Crespo, R.; Livingston, K.; Kulkarni, R.R. Characterization of vaccine-induced immune responses against coccidiosis in broiler chickens. Vaccine 2022, 40, 3893–3902. [Google Scholar] [CrossRef]
- Li, W.C.; Zhang, X.K.; Du, L.; Pan, L.; Gong, P.T.; Li, J.H.; Yang, J.; Li, H.; Zhang, X.C. Eimeria maxima: Efficacy of recombinant Mycobacterium bovis BCG expressing apical membrane antigen1 against homologous infection. Parasitol. Res. 2013, 112, 3825–3833. [Google Scholar] [CrossRef]
Gene | Primer (5′-3′) | Accession No. |
---|---|---|
EmEF2 | Forward: CCGGAATTCATGGTGAATTTTTCAGTGGATC | 25335462 |
Reverse: CCCAAGCTTTTACAGCTTGTCGTAGTAGTGGTCG |
RNA Target | Primer Sequence (5′-3′) | Accession No. |
---|---|---|
GAPDH | Forward: GGTGGTGCTAAGCGTGTTAT | K01458 |
Reverse: ACCTCTGTCATCTCTCCACA | ||
IL-4 | Forward: ACCCAGGGCATCCAGAAG | AJ621735 |
Reverse: CAGTGCCGGCAAGAAGTT | ||
IFN-γ | Forward: GGTGGTGCTAAGCGTGTTAT | Y07922 |
Reverse: ACCTCTGTCATCTCTCCACA |
Trials | Groups | N | Initial Body Weight (g) | Weight Gain (g) | Relative Body Weight Gain (%) | Mean Enteric Lesion Scores | OPG (×105) | Oocyst Decreased Ratio (%) | Anticoccidial Index (ACI) |
---|---|---|---|---|---|---|---|---|---|
1 | Non-immunized non-challenged | 14 | 138.25 ± 6.96 a | 103.83 ± 36.48 b | 100.00 | 0 ± 0 a | 0 ± 0 a | 100.00 | 200 |
Non-immunized challenged | 9 | 135.32 ± 10.01 a | 26.82 ± 16.00 a | 25.13 | 3.78 ± 0.44 c | 1.79 ± 0.985 c | 0.00 | 47.35 | |
pET-32a tag protein control | 12 | 138.73 ± 7.22 a | 43.31 ± 12.22 a | 39.99 | 3.92 ± 0.29 c | 2.07 ± 1.05 c | −15.64 | 60.82 | |
rEmEF2 | 14 | 140.68 ± 4.52 a | 94.21 ± 20.06 b | 87.06 | 1.07 ± 0.47 b | 0.522 ± 0.257 b | 70.84 | 166.35 | |
2 | Non-immunized non-challenged | 14 | 138.25 ± 6.96 a | 78.36 ± 34.14 b | 100.00 | 0 ± 0 a | 0 ± 0 a | 100.00 | 200 |
Non-immunized challenged | 15 | 140.9 ± 4.70 a | 52.13 ± 16.2 a | 64.16 | 3.93 ± 0.26 b | 10.1 ± 8.22 c | 0.00 | 84.78 | |
pET-32a tag protein control | 14 | 138.34 ± 6.17 a | 52.01 ± 25.14 a | 65.47 | 3.79 ± 0.43 b | 6.67 ± 4.79 c | 33.96 | 107.61 | |
rEmEF2 | 16 | 136.76 ± 10.54 a | 76.41 ± 21.81 b | 97.58 | 0.75 ± 0.58 a | 1.67 ± 1.31 b | 83.47 | 185.08 | |
3 | Non-immunized non-challenged | 14 | 138.25 ± 6.96 a | 103.83 ± 36.48 b | 100.00 | 0 ± 0 a | 0 ± 0 a | 100.00 | 200 |
Non-immunized challenged | 14 | 138.51 ± 6.71 a | 25.84 ± 36.86 a | 24.08 | 3.86 ± 0.36 c | 91.9 ± 64.8 c | 0.00 | 65.51 | |
pET-32a tag protein control | 10 | 139.65 ± 6.12 a | 45.36 ± 14.78 a | 43.11 | 3.80 ± 0.42 c | 138 ± 98.2 c | −50.16 | 65.11 | |
rEmEF2 | 14 | 140.34 ± 3.48 a | 78.23 ± 31.54 b | 71.87 | 2.29 ± 1.38 b | 5 ± 6.4 b | 94.56 | 144.01 | |
4 | Non-immunized non-challenged | 14 | 138.25 ± 6.96 ab | 103.83 ± 36.48 b | 100.00 | 0 ± 0 a | 0 ± 0 a | 100.00 | 200 |
Non-immunized challenged | 7 | 140.06 ± 5.46 ab | 0.10 ± 25.34 a | 0.10 | 3.71 ± 0.49 c | 36.4 ± 32.9 c | 0.00 | 22.96 | |
pET-32a tag protein control | 15 | 140.06 ± 6.85 b | −5.41 ± 14.44 a | −5.23 | 3.93 ± 0.26 c | 41.3 ± 32.3 c | −13.46 | 15.44 | |
rEmEF2 | 13 | 134.88 ± 5.41 a | 59.47 ± 22.91 b | 57.56 | 2.46 ± 1.33 b | 2.6 ± 1.1 b | 92.86 | 127.94 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mi, Y.; Ding, W.; Xu, L.; Lu, M.; Yan, R.; Li, X.; Song, X. Protective Efficacy Induced by the Common Eimeria Antigen Elongation Factor 2 against Challenge with Three Eimeria Species in Chickens. Vaccines 2024, 12, 18. https://doi.org/10.3390/vaccines12010018
Mi Y, Ding W, Xu L, Lu M, Yan R, Li X, Song X. Protective Efficacy Induced by the Common Eimeria Antigen Elongation Factor 2 against Challenge with Three Eimeria Species in Chickens. Vaccines. 2024; 12(1):18. https://doi.org/10.3390/vaccines12010018
Chicago/Turabian StyleMi, Yuxuan, Wenxi Ding, Lixin Xu, Mingmin Lu, Ruofeng Yan, Xiangrui Li, and Xiaokai Song. 2024. "Protective Efficacy Induced by the Common Eimeria Antigen Elongation Factor 2 against Challenge with Three Eimeria Species in Chickens" Vaccines 12, no. 1: 18. https://doi.org/10.3390/vaccines12010018
APA StyleMi, Y., Ding, W., Xu, L., Lu, M., Yan, R., Li, X., & Song, X. (2024). Protective Efficacy Induced by the Common Eimeria Antigen Elongation Factor 2 against Challenge with Three Eimeria Species in Chickens. Vaccines, 12(1), 18. https://doi.org/10.3390/vaccines12010018