(–)-Epicatechin Reduces the Blood Pressure of Young Borderline Hypertensive Rats During the Post-Treatment Period
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Treatment
2.2. Open-Field Test
2.3. Systolic Blood Pressure
2.4. Determination of the Relative Iron Content in Blood
2.5. Superoxide Production
2.6. Nitric Oxide Synthase Activity
2.7. Gene Expression
2.8. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Chobanian:, A.V.; Bakris, G.L.; Black, H.R.; Cushman, W.C.; Green, L.A.; Izzo, J.L., Jr.; Jones, D.W.; Materson, B.J.; Oparil, S.; Wright, J.T., Jr.; et al. Seventh report of the Joint National Committee on Prevention, Detection, Evaluation, and Treatment of High Blood Pressure. Hypertension 2003, 42, 1206–1252. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- National Institutes of Health, National Heart, Lung, and Blood Institute, USA. 2012; Morbidity & Mortality: 2012 Chart Book on Cardiovascular, Lung, and Blood Diseases. Available online: https://www.nhlbi.nih.gov/files/docs/research/2012_ChartBook_508.pdf (accessed on 5 January 2020).
- Redwine, K.M.; Daniels, S.R. Prehypertension in adolescents: Risk and progression. J. Clin. Hypertens. 2012, 6, 360–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Assadi, F. Prehypertension: A warning sign of future cardiovascular risk. Int. J. Prev. Med. 2014, 5 (Suppl. 1), S4–S9. [Google Scholar] [PubMed]
- Huang, Y.; Wang, S.; Cai, X.; Mai, W.; Hu, Y.; Tang, H.; Xu, D. Prehypertension and incidence of cardiovascular disease: A meta-analysis. BMC Med. 2013, 11, 177. [Google Scholar] [CrossRef] [Scilit]
- Williams, B.; Mancia, G.; Spiering, W.; Agabiti Rosei, E.; Azizi, M.; Burnier, M.; Clement, D.L.; Coca, A.; de Simone, G.; Dominiczak, A.; et al. 2018 ESC/ESH guidelines for the management of arterial hypertension. Eur. Heart J. 2018, 39, 3021–3104. [Google Scholar] [CrossRef] [Scilit]
- Whelton, P.K.; Carey, R.M.; Aronow, W.S.; Casey, D.E., Jr.; Collins, K.J.; Dennison Himmelfarb, C.; DePalma, S.M.; Gidding, S.; Jamerson, K.A.; Jones, D.W.; et al. 2017 ACC/AHA/AAPA/ABC/ACPM/AGS/APhA/ASH/ASPC/NMA/PCNA Guideline for the prevention, detection, evaluation, and management of high blood pressure in adults: Executive summary: A report of the American college of cardiology/American heart association task force on clinical practice guidelines. Circulation 2018, 138, e426–e483. [Google Scholar] [CrossRef] [Scilit]
- Baumann, M.; Janssen, B.J.; Hermans, J.J.; Peutz-Kootstra, C.; Witzke, O.; Smits, J.F.; Struijker Boudier, H.A. Transient AT1 receptor-inhibition in prehypertensive spontaneously hypertensive rats results in maintained cardiac protection until advanced age. J. Hypertens. 2007, 25, 207–215. [Google Scholar] [CrossRef] [Scilit]
- Baumann, M.; Megens, R.; Bartholome, R.; Dolff, S.; van Zandvoort, M.A.; Smits, J.F.; Struijker-Boudier, H.A.; De Mey, J.G. Prehypertensive renin-angiotensin-aldosterone system blockade in spontaneously hypertensive rats ameliorates the loss of long-term vascular function. Hypertens. Res. 2007, 30, 853–861. [Google Scholar] [CrossRef] [Scilit]
- Dickhout, J.G.; Lee, R.M. Blood pressure and heart rate development in young spontaneously hypertensive rats. Am. J. Physiol. 1998, 274, H794–H800. [Google Scholar] [CrossRef] [Scilit]
- Puzserova, A.; Kopincova, J.; Slezak, P.; Balis, P.; Bernatova, I. Endothelial dysfunction in femoral artery of the hypertensive rats is nitric oxide independent. Physiol. Res. 2013, 62, 615–629. [Google Scholar]
- Sarenac, O.; Lozic, M.; Drakulic, S.; Bajic, D.; Paton, J.F.; Murphy, D.; Japundzic-Zigon, N. Autonomic mechanisms underpinning the stress response in borderline hypertensive rats. Exp. Physiol. 2011, 96, 574–589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thiyagarajan, R.; Pal, P.; Pal, G.K.; Subramanian, S.K.; Bobby, Z.; Das, A.K.; Trakroo, M. Cardiovagal modulation, oxidative stress, and cardiovascular risk factors in prehypertensive subjects: Cross-sectional study. Am. J. Hypertens. 2013, 26, 850–857. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chrysohoou, C.; Panagiotakos, D.B.; Pitsavos, C.; Skoumas, J.; Economou, M.; Papadimitriou, L.; Stefanadis, C. The association between pre-hypertension status and oxidative stress markers related to atherosclerotic disease: The ATTICA study. Atherosclerosis 2007, 192, 169–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Outten, F.W.; Theil, E.C. Iron-based redox switches in biology. Antioxid. Redox Signal. 2009, 11, 1029–1046. [Google Scholar] [CrossRef] [Scilit]
- Marques, V.B.; Nascimento, T.B.; Ribeiro, R.F., Jr.; Broseghini-Filho, G.B.; Rossi, E.M.; Graceli, J.B.; dos Santos, L. Chronic iron overload in rats increases vascular reactivity by increasing oxidative stress and reducing nitric oxide bioavailability. Life Sci. 2015, 143, 89–97. [Google Scholar] [CrossRef] [Scilit]
- Atsma, F.; Veldhuizen, I.; de Kort, W.; van Kraaij, M.; Pasker-de Jong, P.; Deinum, J. Hemoglobin level is positively associated with blood pressure in a large cohort of healthy individuals. Hypertension 2012, 60, 936–941. [Google Scholar] [CrossRef] [Scilit]
- Zhu, Y.; Chen, G.; Bo, Y.; Liu, Y. Markers of iron status, blood pressure and incident hypertension among Chinese adults. Nutr. Metab. Cardiovasc. Dis. 2019, 29, 830–836. [Google Scholar] [CrossRef] [Scilit]
- Senthil, S.; Krishndasa, S.N. Pre-hypertension in apparently healthy young adults: Incidence and influence of haemoglobin level. J. Clin. Diagn. Res. 2015, 9, CC10–CC12. [Google Scholar] [CrossRef] [Scilit]
- Gaenzer, H.; Marschang, P.; Sturm, W.; Neumayr, G.; Vogel, W.; Patsch, J.; Weiss, G. Association between increased iron stores and impaired endothelial function in patients with hereditary hemochromatosis. J. Am. Coll. Cardiol. 2002, 40, 2189–2194. [Google Scholar] [CrossRef] [Scilit]
- Bernatova, I. Endothelial dysfunction in experimental models of arterial hypertension: Cause or consequence? BioMed Res. Int. 2014, 2014, 598271. [Google Scholar] [CrossRef] [Scilit]
- Forrester, S.J.; Booz, G.W.; Sigmund, C.D.; Coffman, T.M.; Kawai, T.; Rizzo, V.; Scalia, R.; Eguchi, S. Angiotensin II signal transduction: An update on mechanisms of physiology and pathophysiology. Physiol. Rev. 2018, 98, 1627–1738. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bernatova, I. Biological activities of (−)-epicatechin and (−)-epicatechin-containing foods: Focus on cardiovascular and neuropsychological health. Biotechnol. Adv. 2018, 36, 666–681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ottaviani, J.I.; Borges, G.; Momma, T.Y.; Spencer, J.P.; Keen, C.L.; Crozier, A.; Schroeter, H. The metabolome of [2-14C](−)-epicatechin in humans: Implications for the assessment of efficacy, safety, and mechanisms of action of polyphenolic bioactives. Sci. Rep. 2016, 6, 29034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mayorga-Gross, A.L.; Esquivel, P. Impact of cocoa products intake on plasma and urine metabolites: A review of targeted and non-targeted studies in humans. Nutrients 2019, 11, 1163. [Google Scholar] [CrossRef] [Scilit]
- Ellinger, S.; Reusch, A.; Stehle, P.; Helfrich, H.P. Epicatechin ingested via cocoa products reduces blood pressure in humans: A nonlinear regression model with a Bayesian approach. Am. J. Clin. Nutr. 2012, 95, 1365–1377. [Google Scholar] [CrossRef] [Scilit]
- Piotrkowski, B.; Calabro, V.; Galleano, M.; Fraga, C.G. (−)-Epicatechin prevents alterations in the metabolism of superoxide anion and nitric oxide in the hearts of L-NAME-treated rats. Food Funct. 2015, 6, 155–161. [Google Scholar] [CrossRef] [Scilit]
- Litterio, M.C.; Vazquez Prieto, M.A.; Adamo, A.M.; Elesgaray, R.; Oteiza, P.I.; Galleano, M.; Fraga, C.G. (−)-Epicatechin reduces blood pressure increase in high-fructose-fed rats: Effects on the determinants of nitric oxide bioavailability. J. Nutr. Biochem. 2015, 26, 745–751. [Google Scholar] [CrossRef] [Scilit]
- Gomez-Guzman, M.; Jimenez, R.; Sanchez, M.; Zarzuelo, M.J.; Galindo, P.; Quintela, A.M.; Lopez-Sepulveda, R.; Romero, M.; Tamargo, J.; Vargas, F.; et al. Epicatechin lowers blood pressure, restores endothelial function, and decreases oxidative stress and endothelin-1 and NADPH oxidase activity in DOCA-salt hypertension. Free Radic. Biol. Med. 2012, 52, 70–79. [Google Scholar] [CrossRef] [Scilit]
- Kluknavsky, M.; Balis, P. (−)-Epicatechin prevents blood pressure increase and reduces locomotor hyperactivity in young spontaneously hypertensive rats. Oxid. Med. Cell. Longev. 2016, 2016, 6949020. [Google Scholar] [CrossRef] [Scilit]
- Galleano, M.; Bernatova, I.; Puzserova, A.; Balis, P.; Sestakova, N.; Pechanova, O.; Fraga, C.G. (−)-Epicatechin reduces blood pressure and improves vasorelaxation in spontaneously hypertensive rats by NO-mediated mechanism. IUBMB Life 2013, 65, 710–715. [Google Scholar] [CrossRef] [Scilit]
- Gao, L.; Zimmerman, M.C.; Biswal, S.; Zucker, I.H. Selective Nrf2 gene deletion in the rostral ventrolateral medulla evokes hypertension and sympathoexcitation in mice. Hypertension 2017, 69, 1198–1206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barancik, M.; Gresova, L.; Bartekova, M.; Dovinova, I. Nrf2 as a key player of redox regulation in cardiovascular diseases. Physiol. Res. 2016, 65 (Suppl. 1), S1–S10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Majzunova, M.; Dovinova, I.; Barancik, M.; Chan, J.Y. Redox signaling in pathophysiology of hypertension. J. Biomed. Sci. 2013, 20, 69. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmed, S.M.; Luo, L.; Namani, A.; Wang, X.J.; Tang, X. Nrf2 signaling pathway: Pivotal roles in inflammation. Biochim. Biophys. Acta Mol. Basis Dis. 2017, 1863, 585–597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kvandova, M.; Barancik, M.; Balis, P.; Puzserova, A.; Majzunova, M.; Dovinova, I. The peroxisome proliferator-activated receptor gamma agonist pioglitazone improves nitric oxide availability, renin-angiotensin system and aberrant redox regulation in the kidney of pre-hypertensive rats. J. Physiol. Pharmacol. 2018, 69, 231–243. [Google Scholar] [CrossRef] [Scilit]
- Silva-Palacios, A.; Konigsberg, M.; Zazueta, C. Nrf2 signaling and redox homeostasis in the aging heart: A potential target to prevent cardiovascular diseases? Ageing Res. Rev. 2016, 26, 81–95. [Google Scholar] [CrossRef] [Scilit]
- Sugawara, A.; Uruno, A.; Kudo, M.; Matsuda, K.; Yang, C.W.; Ito, S. Effects of PPARγ on hypertension, atherosclerosis, and chronic kidney disease. Endocr. J. 2010, 57, 847–852. [Google Scholar] [CrossRef] [Scilit]
- Puzserova, A.; Slezak, P.; Balis, P.; Bernatova, I. Long-term social stress induces nitric oxide-independent endothelial dysfunction in normotensive rats. Stress 2013, 16, 331–339. [Google Scholar] [CrossRef] [Scilit]
- Kumar, P.; Bulk, M.; Webb, A.; van der Weerd, L.; Oosterkamp, T.H.; Huber, M.; Bossoni, L. A novel approach to quantify different iron forms in ex-vivo human brain tissue. Sci. Rep. 2016, 6, 38916. [Google Scholar] [CrossRef] [Scilit]
- Zysler, R.D.; Lima, E., Jr.; Vasquez Mansilla, M.; Troiani, H.E.; Mojica Pisciotti, M.L.; Gurman, P.; Lamagna, A.; Colombo, L. A new quantitative method to determine the uptake of SPIONs in animal tissue and its application to determine the quantity of nanoparticles in the liver and lung of Balb-c mice exposed to the SPIONs. J. Biomed. Nanotechnol. 2013, 9, 142–145. [Google Scholar] [CrossRef] [Scilit]
- Hashimoto, S.; Oda, T.; Yamada, K.; Takagi, M.; Enomoto, T.; Ohkohchi, N.; Takagi, T.; Kanamori, T.; Ikeda, H.; Yanagihara, H.; et al. The measurement of small magnetic signals from magnetic nanoparticles attached to the cell surface and surrounding living cells using a general-purpose SQUID magnetometer. Phys. Med. Biol. 2009, 54, 2571–2583. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Janus, B.; Bućko, M.S.; Chrobak, A.; Wasilewski, J.; Zych, M. Magnetic characterization of human blood in the atherosclerotic process in coronary arteries. J. Magn. Magnet. Mat. 2011, 323, 479–485. [Google Scholar] [CrossRef] [Scilit]
- Slezak, P.; Puzserova, A.; Balis, P.; Sestakova, N.; Majzunova, M. Genotype-related effect of crowding stress on blood pressure and vascular function in young female rats. BioMed. Res. Int. 2014, 2014, 413629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sagvolden, T.; Metzger, M.A.; Schiorbeck, H.K.; Rugland, A.L.; Spinnangr, I.; Sagvolden, G. The spontaneously hypertensive rat (SHR) as an animal model of childhood hyperactivity (ADHD): Changed reactivity to reinforcers and to psychomotor stimulants. Behav. Neural. Biol. 1992, 58, 103–112. [Google Scholar] [CrossRef] [Scilit]
- Yamada, T.; Yamada, Y.; Okano, Y.; Terashima, T.; Yokogoshi, H. Anxiolytic effects of short- and long-term administration of cacao mass on rat elevated T-maze test. J. Nutr. Biochem. 2009, 20, 948–955. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Messaoudi, M.; Bisson, J.F.; Nejdi, A.; Rozan, P.; Javelot, H. Antidepressant-like effects of a cocoa polyphenolic extract in Wistar-Unilever rats. Nutr. Neurosci. 2008, 11, 269–276. [Google Scholar] [CrossRef] [Scilit]
- Abd El Mohsen, M.M.; Kuhnle, G.; Rechner, A.R.; Schroeter, H.; Rose, S.; Jenner, P.; Rice-Evans, C.A. Uptake and metabolism of epicatechin and its access to the brain after oral ingestion. Free Rad. Biol. Med. 2002, 33, 1693–1702. [Google Scholar] [CrossRef] [Scilit]
- Horvathova, M.; Zitnanova, I.; Kralovicova, Z.; Balis, P.; Puzserova, A.; Muchova, J.; Kluknavsky, M.; Durackova, Z.; Bernatova, I. Sex differences in the blood antioxidant defense system in juvenile rats with various genetic predispositions to hypertension. Hypertens. Res. 2016, 39, 64–69. [Google Scholar] [CrossRef] [Scilit]
- Zicha, J.; Kunes, J. Ontogenetic aspects of hypertension development: Analysis in the rat. Physiol. Rev. 1999, 79, 1227–1282. [Google Scholar] [CrossRef] [Scilit]
- Petyaev, I.M.; Dovgalevsky, P.Y.; Chalyk, N.E.; Klochkov, V.; Kyle, N.H. Reduction in blood pressure and serum lipids by lycosome formulation of dark chocolate and lycopene in prehypertension. Food Sci. Nutr. 2014, 2, 744–750. [Google Scholar] [CrossRef] [Scilit]
- Sudarma, V.; Sukmaniah, S.; Siregar, P. Effect of dark chocolate on nitric oxide serum levels and blood pressure in prehypertension subjects. Acta Med. Indones. 2011, 43, 224–228. [Google Scholar] [PubMed]
- Ried, K.; Frank, O.R.; Stocks, N.P. Dark chocolate or tomato extract for prehypertension: A randomised controlled trial. BMC Complement. Altern. Med. 2009, 9, 22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stroh, A.; Zimmer, C.; Gutzeit, C.; Jakstadt, M.; Marschinke, F.; Jung, T.; Pilgrimm, H.; Grune, T. Iron oxide particles for molecular magnetic resonance imaging cause transient oxidative stress in rat macrophages. Free Rad. Biol. Med. 2004, 36, 976–984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dal-Pizzol, F.; Klamt, F.; Frota, M.L., Jr.; Andrades, M.E.; Caregnato, F.F.; Vianna, M.M.; Schroder, N.; Quevedo, J.; Izquierdo, I.; Archer, T.; et al. Neonatal iron exposure induces oxidative stress in adult Wistar rat. Brain Res. Dev. Brain Res. 2001, 130, 109–114. [Google Scholar] [CrossRef] [Scilit]
- Mladenka, P.; Macakova, K.; Filipsky, T.; Zatloukalova, L.; Jahodar, L.; Bovicelli, P.; Silvestri, I.P.; Hrdina, R.; Saso, L. In vitro analysis of iron chelating activity of flavonoids. J. Inorg. Biochem. 2011, 105, 693–701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Delimont, N.M.; Haub, M.D.; Lindshield, B.L. The impact of tannin consumption on iron bioavailability and status: A narrative review. Curr. Dev. Nutr. 2017, 1, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Ruijters, E.J.; Weseler, A.R.; Kicken, C.; Haenen, G.R.; Bast, A. The flavanol (−)-epicatechin and its metabolites protect against oxidative stress in primary endothelial cells via a direct antioxidant effect. Eur. J. Pharmacol. 2013, 715, 147–153. [Google Scholar] [CrossRef] [Scilit]
- Quine, S.D.; Raghu, P.S. Effects of (−)-epicatechin, a flavonoid on lipid peroxidation and antioxidants in streptozotocin-induced diabetic liver, kidney and heart. Pharmacol. Rep. 2005, 57, 610–615. [Google Scholar]
- Steffen, Y.; Gruber, C.; Schewe, T.; Sies, H. Mono-O-methylated flavanols and other flavonoids as inhibitors of endothelial NADPH oxidase. Arch. Biochem. Biophys. 2008, 469, 209–219. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Taubert, D.; Roesen, R.; Lehmann, C.; Jung, N.; Schomig, E. Effects of low habitual cocoa intake on blood pressure and bioactive nitric oxide: A randomized controlled trial. JAMA 2007, 298, 49–60. [Google Scholar] [CrossRef] [Scilit]
- Melikian, N.; Seddon, M.D.; Casadei, B.; Chowienczyk, P.J.; Shah, A.M. Neuronal nitric oxide synthase and human vascular regulation. Trends Cardiovasc. Med. 2009, 9, 256–262. [Google Scholar] [CrossRef] [Scilit]
- Shabeeh, H.; Khan, S.; Jiang, B.; Brett, S.; Melikian, N.; Casadei, B.; Chowienczyk, P.J.; Shah, A.M. Blood pressure in healthy humans is regulated by neuronal NO synthase. Hypertension 2017, 69, 970–976. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koskenkorva-Frank, T.S.; Weiss, G.; Koppenol, W.H.; Burckhardt, S. The complex interplay of iron metabolism, reactive oxygen species, and reactive nitrogen species: Insights into the potential of various iron therapies to induce oxidative and nitrosative stress. Free Rad. Biol. Med. 2013, 65, 1174–1194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Strand, E.; Lysne, V. Short-term activation of peroxisome proliferator-activated receptors alpha and gamma induces tissue-specific effects on lipid metabolism and fatty acid composition in male Wistar rats. PPAR Res. 2019, 2019, 8047627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, Z.; Aslam, S.; Welch, W.J.; Wilcox, C.S. Activation of nuclear factor erythroid 2-related factor 2 coordinates dimethylarginine dimethylaminohydrolase/PPAR-gamma/endothelial nitric oxide synthase pathways that enhance nitric oxide generation in human glomerular endothelial cells. Hypertension 2015, 65, 896–902. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mohamed, R.H.; Karam, R.A.; Amer, M.G. Epicatechin attenuates doxorubicin-induced brain toxicity: Critical role of TNF-alpha, iNOS and NF-kappaB. Brain Res. Bull. 2011, 86, 22–28. [Google Scholar] [CrossRef] [Scilit]
- Litterio, M.C.; Jaggers, G.; Sagdicoglu Celep, G.; Adamo, A.M.; Costa, M.A.; Oteiza, P.I.; Fraga, C.G.; Galleano, M. Blood pressure-lowering effect of dietary (−)-epicatechin administration in L-NAME-treated rats is associated with restored nitric oxide levels. Free Rad. Biol. Med. 2012, 53, 1894–1902. [Google Scholar] [CrossRef] [Scilit]
- Prince, P.D.; Lanzi, C.R.; Toblli, J.E.; Elesgaray, R.; Oteiza, P.I.; Fraga, C.G.; Galleano, M. Dietary (−)-epicatechin mitigates oxidative stress, NO metabolism alterations, and inflammation in renal cortex from fructose-fed rats. Free Rad. Biol. Med. 2016, 90, 35–46. [Google Scholar] [CrossRef] [Scilit]
- Gomez-Guzman, M.; Jimenez, R.; Sanchez, M.; Romero, M.; O’Valle, F.; Lopez-Sepulveda, R.; Quintela, A.M.; Galindo, P.; Zarzuelo, M.J.; Bailon, E.; et al. Chronic (−)-epicatechin improves vascular oxidative and inflammatory status but not hypertension in chronic nitric oxide-deficient rats. Br. J. Nutr. 2011, 106, 1337–1348. [Google Scholar] [CrossRef] [Scilit]







| Gene | Forward (Sense) Primer | Reverse (Antisense) Primer | Temp |
|---|---|---|---|
| eNOS | CGGCGCAAAAGGAAGGAATC | CCAGCCCAAACACACAGAAC | 60 °C |
| iNOS | TGGAGGTGCTGG AAGAGTT | GGAGGAGCTGATGGAGTAGT | 57 °C |
| nNOS | CGCTACGCGGGCTACAAGCA | GCACGTCGAAGCGGCCTCTT | 60 °C |
| Nrf2 | AGGTTGCCCACATTCCCAAA | TATCCAGGGCAAGCGACTCA | 60 °C |
| PPAR-γ | TCCCGTTCACAAGAGCTGAC | GCTCTACTTTGATCGCACTTTGG | 60 °C |
| β-actin | AATCGTGCGTGACATCAAAG | ATGCCACAGGATTCCATACC | 57 °C |
| Group | BW (g) n = 7 | LHV/BW (mg/g) n = 7 | (LK + RK)/BW (mg/g) n = 7 | Ms (10−3 Am2/kg) n = 5 | Mr (10−2 Am2/kg) n = 5 | Hc (A/m) n = 5 |
|---|---|---|---|---|---|---|
| C7 | 178 ± 5.9 | 1.98 ± 0.10 | 9.33 ± 0.18 | 210 ± 13.85 | 0.19 ± 0.07 | 1569 ± 727 |
| Epi | 177 ± 2.1 | 1.89 ± 0.09 | 9.40 ± 0.26 | 98 ± 26.26 x | 0.08 ± 0.01 | 1260 ± 244 |
| C9 | 249 ± 4.6 x | 1.84 ± 0.04 | 8.07 ± 0.09 x | N.D. | N.D. | N.D. |
| PE | 244 ± 4.0 + | 1.95 ± 0.05 | 8.11 ± 0.05 + | N.D. | N.D. | N.D. |
| Nrf2 | ||||||
|---|---|---|---|---|---|---|
| Aorta | Left Heart Ventricle | |||||
| r | p < | n | r | p < | n | |
| PPAR-γ | 0.896 | 0.0001 | 26 | 0.714 | 0.0001 | 24 |
| eNOS | 0.772 | 0.0001 | 28 | 0.719 | 0.0001 | 24 |
| nNOS | 0.694 | 0.0001 | 27 | 0.570 | 0.004 | 24 |
| iNOS | 0.689 | 0.0001 | 27 | 0.508 | 0.01 | 25 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kluknavsky, M.; Balis, P.; Skratek, M.; Manka, J.; Bernatova, I. (–)-Epicatechin Reduces the Blood Pressure of Young Borderline Hypertensive Rats During the Post-Treatment Period. Antioxidants 2020, 9, 96. https://doi.org/10.3390/antiox9020096
Kluknavsky M, Balis P, Skratek M, Manka J, Bernatova I. (–)-Epicatechin Reduces the Blood Pressure of Young Borderline Hypertensive Rats During the Post-Treatment Period. Antioxidants. 2020; 9(2):96. https://doi.org/10.3390/antiox9020096
Chicago/Turabian StyleKluknavsky, Michal, Peter Balis, Martin Skratek, Jan Manka, and Iveta Bernatova. 2020. "(–)-Epicatechin Reduces the Blood Pressure of Young Borderline Hypertensive Rats During the Post-Treatment Period" Antioxidants 9, no. 2: 96. https://doi.org/10.3390/antiox9020096
APA StyleKluknavsky, M., Balis, P., Skratek, M., Manka, J., & Bernatova, I. (2020). (–)-Epicatechin Reduces the Blood Pressure of Young Borderline Hypertensive Rats During the Post-Treatment Period. Antioxidants, 9(2), 96. https://doi.org/10.3390/antiox9020096

