Comparative Transcriptional Analysis of Long Noncoding RNAs in Oxidative Stress and Inflammation Induced by Potassium Permanganate and Lipopolysaccharide in Rat Uterine Tissues
Abstract
1. Introduction
2. Material and Methods
2.1. Animal Model
2.2. Histopathology and Wet and Dry Weight (W/D)
2.3. Myeloperoxidase (MPO), Malondialdehyde (MDA), and Superoxide Dismutase (SOD) Assays
2.4. RNA Extraction and cDNA Library Construction
2.5. Quality Control Data of Sequencing
2.6. The Alignment of a Reference Genome and the Mapping of Read Distribution Across the Entire Genome
2.7. Analyzing the Differential Expression
2.8. LncRNA-Gene Interaction Predictions
2.9. KEGG and GO-Based Functional Annotation and Enrichment Analysis
2.10. RT-qPCR Validation
2.11. Statistical Analysis
3. Results
3.1. Histopathological Results of Uterine Tissues
3.2. Sequencing Data Statistics of Uterine Tissues
3.3. Chromosomal Distribution of Differentially Expressed Transcripts
3.4. Differentially Expressed Gene Analysis in KMnO4 Treated, LPS Treated, and Normal Uterine Tissues
3.5. GO Functional Analysis of Differentially Expressed mRNA Enrichment
3.6. KEGG Signaling Pathway Enrichment Analysis of Differentially Expressed mRNA
3.7. Identification of Differentially Expressed LncRNAs of Control vs. KMnO4 and Control vs. LPS Groups
3.8. Prediction and Functional Analysis of lncRNA Target Genes and mRNAs
3.9. Analysis of lncRNA Target Genes via GO Enrichment and KEGG Enrichment
3.10. Validation of Genes by RT-qPCR
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ghanem, M.E.; Tezuka, E.; Devkota, B.; Izaike, Y.; Osawa, T. Persistence of uterine bacterial infection, and its associations with endometritis and ovarian function in postpartum dairy cows. J. Reprod. Dev. 2015, 61, 54–60. [Google Scholar] [CrossRef] [PubMed]
- Williams, E.J.; Fischer, D.P.; Pfeiffer, D.U.; England, G.C.; Noakes, D.E.; Dobson, H.; Sheldon, I.M. Clinical evaluation of postpartum vaginal mucus reflects uterine bacterial infection and the immune response in cattle. Theriogenology 2005, 63, 102–117. [Google Scholar] [CrossRef] [PubMed]
- Földi, J.; Kulcsár, M.; Pécsi, A.; Huyghe, B.; de Sa, C.; Lohuis, J.A.; Cox, P.; Huszenicza, G. Bacterial complications of postpartum uterine involution in cattle. Anim. Reprod. Sci. 2006, 96, 265–281. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, Y.; Mao, J.; Li, Y.; Deng, Q.; Jia, Z.; Tang, M.; Zhang, X.; Du, L. Oestrogen receptors ERα, ERβ and GPER mediate the activation of AMPK and the inhibition of the inflammatory signaling pathway TLR4/NFκB in neutrophils of dairy cow. Pak. Vet. J. 2023, 43, 153–159. [Google Scholar] [CrossRef]
- Mandhwani, R.; Bhardwaz, A.; Kumar, S.; Shivhare, M.; Aich, R. Insights into bovine endometritis with special reference to phytotherapy. Vet. World 2017, 10, 1529–1532. [Google Scholar] [CrossRef][Green Version]
- Yin, B.; Umar, T.; Ma, X.; Chen, Y.; Umar, Z.; Umer, S.; Deng, G. Andrograpanin mitigates lipopolysaccharides induced endometritis via TLR4/NF-κB pathway. Reprod. Biol. 2022, 22, 100606. [Google Scholar] [CrossRef] [PubMed]
- Umar, T.; Ma, X.; Yin, B.; Umer, S.; Zahoor, A.; Akhtar, M.; Umar, Z.; Shaukat, A.; Deng, G. miR-424-5p overexpression inhibits LPS-stimulated inflammatory response in bovine endometrial epithelial cells by targeting IRAK2. J. Reprod. Immunol. 2022, 150, 103471. [Google Scholar] [CrossRef]
- Umar, T.; Wenjing, L.; Feng, H.; Feng, W.; Bin, M.; Umar, Z.; Naeem, M.; Umar, A.S.; Asif, S.; Usman, M.; et al. A review on the applications of potassium permanganate in veterinary medicine: Toxicity, efficacy, and future considerations. Pak. Vet. J. 2024, 44, 214–221. [Google Scholar] [CrossRef]
- Willhite, C.C.; Bhat, V.S.; Ball, G.L.; McLellan, C.J. Emergency Do Not Consume/do Not Use concentrations for potassium permanganate in drinking water. Hum. Exp. Toxicol. 2013, 32, 275–298. [Google Scholar] [CrossRef]
- Manpoong, N.K.; Ahmed, K.; Bhattacharya, D.K.; Sarma, D.; Ahmed, N.; Das, A. Efficacy of potassium permanganate and turmeric as antimicrobial agents on the bacterial load and quality of boar semen during preservation at 15 °C. Vet. Arh. 2020, 90, 443–451. [Google Scholar] [CrossRef]
- House, J.E. Inorganic Chemistry; Academic Press: Waltham, MA, USA, 2013. [Google Scholar]
- Li, X.; Wang, H.; Zhang, Y.; Zhang, J.; Qi, S.; Zhang, Y.; Gao, M.Q. Overexpression of lncRNA H19 changes basic characteristics and affects immune response of bovine mammary epithelial cells. PeerJ 2019, 7, e6715. [Google Scholar] [CrossRef]
- Lodde, V.; Murgia, G.; Simula, E.R.; Steri, M.; Floris, M.; Idda, M.L. Long Noncoding RNAs and Circular RNAs in Autoimmune Diseases. Biomolecules 2020, 10, 1044. [Google Scholar] [CrossRef]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef]
- Qian, W.; Cao, Y. An overview of the effects and mechanisms of m6 A methylation on innate immune cells in sepsis. Front. Immunol. 2022, 13, 1041990. [Google Scholar] [CrossRef] [PubMed]
- Ganesan, G.; Rao, S.M. A novel noncoding RNA processed by Drosha is restricted to nucleus in mouse. RNA 2008, 14, 1399–1410. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Zhu, J.; Ye, F.; Duan, Z.; Zhou, J.; Huang, Z.; Wang, L. Upregulation of the lncRNA SRLR in polycystic ovary syndrome regulates cell apoptosis and IL-6 expression. Cell Biochem. Funct. 2020, 38, 880–885. [Google Scholar] [CrossRef]
- Nakagawa, S.; Shimada, M.; Yanaka, K.; Mito, M.; Arai, T.; Takahashi, E.; Fujita, Y.; Fujimori, T.; Standaert, L.; Marine, J.C.; et al. The lncRNA Neat1 is required for corpus luteum formation and the establishment of pregnancy in a subpopulation of mice. Development 2014, 141, 4618–4627. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Qiu, J.; Tang, X.; Cui, H.; Zhang, Q.; Yang, Q. LncRNA-H19 regulates cell proliferation and invasion of ectopic endometrium by targeting ITGB3 via modulating miR-124-3p. Exp. Cell Res. 2019, 381, 215–222. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Qiu, J.; Tang, X.; Li, Q.; Shao, W. Estrogen Regulates the Expression and Function of lncRNA-H19 in Ectopic Endometrium. Int. J. Women’s Health 2022, 14, 821–830. [Google Scholar] [CrossRef]
- Özdemir, S.; Altun, S. Genome-wide analysis of mRNAs and lncRNAs in Mycoplasma bovis infected and non-infected bovine mammary gland tissues. Mol. Cell. Probes 2020, 50, 101512. [Google Scholar] [CrossRef] [PubMed]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Jing, H.; Chen, M.; Liang, W.; Yang, J.; Deng, G.; Guo, M. Transcriptional Profiling of Exosomes Derived from Staphylococcus aureus-Infected Bovine Mammary Epithelial Cell Line MAC-T by RNA-Seq Analysis. Oxidative Med. Cell. Longev. 2021, 2021, 8460355. [Google Scholar] [CrossRef]
- Dennis, G., Jr.; Sherman, B.T.; Hosack, D.A.; Yang, J.; Gao, W.; Lane, H.C.; Lempicki, R.A. DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol. 2003, 4, P3. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. Omics 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Li, W.; Fu, K.; Lv, X.; Wang, Y.; Wang, J.; Li, H.; Tian, W.; Cao, R. Lactoferrin suppresses lipopolysaccharide-induced endometritis in mice via down-regulation of the NF-κB pathway. Int. Immunopharmacol. 2015, 28, 1567–5769. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Gao, D.; Kim, J.; Kim, H.; Phang, T.L.; Selby, H.; Tan, A.C.; Tong, T. A survey of statistical software for analysing RNA-seq data. Hum. Genom. 2010, 5, 56–60. [Google Scholar] [CrossRef]
- Jiang, K.; Guo, S.; Yang, C.; Yang, J.; Chen, Y.; Shaukat, A.; Zhao, G.; Wu, H.; Deng, G. Barbaloin protects against lipopolysaccharide (LPS)-induced acute lung injury by inhibiting the ROS-mediated PI3K/AKT/NF-κB pathway. Int. Immunopharmacol. 2018, 64, 140–150. [Google Scholar] [CrossRef]
- Meyer, A.; Laverny, G.; Bernardi, L.; Charles, A.L.; Alsaleh, G.; Pottecher, J.; Sibilia, J.; Geny, B. Mitochondria: An Organelle of Bacterial Origin Controlling Inflammation. Front. Immunol. 2018, 9, 536. [Google Scholar] [CrossRef] [PubMed]
- Rojas, M.; Woods, C.R.; Mora, A.L.; Xu, J.; Brigham, K.L. Endotoxin-induced lung injury in mice: Structural, functional, and biochemical responses. Am. J. Physiol.-Lung Cell. Mol. Physiol. 2005, 288, L333–L341. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Yang, L.; Sun, J.; Zheng, J.; Shi, L.; Zhang, G.; Cui, N. Tumor suppressors microRNA-302d and microRNA-16 inhibit human glioblastoma multiforme by targeting NF-κB and FGF2. Mol. Biosyst. 2017, 13, 1345–1354. [Google Scholar] [CrossRef]
- Yue, S.; Qian, J.; Du, J.; Liu, X.; Xu, H.; Liu, H.; Zhang, J.; Chen, X. Heat stress negatively influence mammary blood flow, mammary uptake of amino acids and milk amino acids profile of lactating holstein dairy cows. Pak. Vet. J. 2023, 43, 73–78. [Google Scholar] [CrossRef]
- Bravo, A.; Ruiz-Cruz, S.; Alkorta, I.; Espinosa, M. When Humans Met Superbugs: Strategies to Tackle Bacterial Resistances to Antibiotics. Biomol. Concepts 2018, 9, 216–226. [Google Scholar] [CrossRef]
- Adegboyega, P.A.; Pei, Y.; McLarty, J. Relationship between eosinophils and chronic endometritis. Hum. Pathol. 2010, 41, 33–37. [Google Scholar] [CrossRef]
- Palaniappan, V.; Karthikeyan, K. Potassium permanganate: A ’desert island drug’ in dermatology. Clin. Exp. Dermatol. 2022, 47, 1650–1657. [Google Scholar] [CrossRef] [PubMed]
- Jiang, K.; Yang, J.; Yang, C.; Zhang, T.; Shaukat, A.; Yang, X.; Dai, A.; Wu, H.; Deng, G. miR-148a suppresses inflammation in lipopolysaccharide-induced endometritis. J. Cell. Mol. Med. 2020, 24, 405–417. [Google Scholar] [CrossRef] [PubMed]
- Winkle, M.; El-Daly, S.M.; Fabbri, M.; Calin, G.A. Noncoding RNA therapeutics—Challenges and potential solutions. Nat. Rev. Drug Discov. 2021, 20, 629–651. [Google Scholar] [CrossRef]
- Chen, C.; Liu, C.; Niu, Z.; Li, M.; Zhang, Y.; Gao, R.; Chen, H.; Wang, Q.; Zhang, S.; Zhou, R.; et al. RNA-seq analysis of the key long noncoding RNAs and mRNAs related to cognitive impairment after cardiac arrest and cardiopulmonary resuscitation. Aging 2020, 12, 14490–14505. [Google Scholar] [CrossRef] [PubMed]
- Gene Ontology Consortium: Going forward. Nucleic Acids Res. 2015, 43, D1049–D1056. [CrossRef] [PubMed]
- Kanehisa, M.; Sato, Y.; Kawashima, M.; Furumichi, M.; Tanabe, M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 2016, 44, D457–D462. [Google Scholar] [CrossRef]
- Tina, E.; Prosén, S.; Lennholm, S.; Gasparyan, G.; Lindberg, M.; Göthlin Eremo, A. Expression profile of the amino acid transporters SLC7A5, SLC7A7, SLC7A8 and the enzyme TDO2 in basal cell carcinoma. Br. J. Dermatol. 2019, 180, 130–140. [Google Scholar] [CrossRef] [PubMed]
- Zuo, T.; Chen, P.; Jing, S.; Zhang, T.; Chang, L.; Xu, F.; Zhao, C.; Xu, P. Quantitative Proteomics Reveals the Development of HBV-Associated Glomerulonephritis Triggered by the Downregulation of SLC7A7. J. Proteome Res. 2020, 19, 1556–1564. [Google Scholar] [CrossRef]
- Chiang, N.; Libreros, S.; Norris, P.C.; de la Rosa, X.; Serhan, C.N. Maresin 1 activates LGR6 receptor promoting phagocyte immunoresolvent functions. J. Clin. Investig. 2023, 133, 5294–5311. [Google Scholar] [CrossRef]
- Jansson, L.; Ebeid, M.; Shen, J.W.; Mokhtari, T.E.; Quiruz, L.A.; Ornitz, D.M.; Huh, S.H.; Cheng, A.G. β-Catenin is required for radial cell patterning and identity in the developing mouse cochlea. Proc. Natl. Acad. Sci. USA 2019, 116, 21054–21060. [Google Scholar] [CrossRef] [PubMed]
- Miller, S.J.; Philips, T.; Kim, N.; Dastgheyb, R.; Chen, Z.; Hsieh, Y.C.; Daigle, J.G.; Datta, M.; Chew, J.; Vidensky, S.; et al. Molecularly defined cortical astroglia subpopulation modulates neurons via secretion of Norrin. Nat. Neurosci. 2019, 22, 741–752. [Google Scholar] [CrossRef]
- Krishnamoorthy, N.; Walker, K.H.; Brüggemann, T.R.; Tavares, L.P.; Smith, E.W.; Nijmeh, J.; Bai, Y.; Ai, X.; Cagnina, R.E.; Duvall, M.G.; et al. The Maresin 1-LGR6 axis decreases respiratory syncytial virus-induced lung inflammation. Proc. Natl. Acad. Sci. USA 2023, 120, e2206480120. [Google Scholar] [CrossRef]
- Li, X.; Xu, B.; Wu, J.; Pu, Y.; Wan, S.; Zeng, Y.; Wang, M.; Luo, L.; Zhang, F.; Jiang, Z.; et al. Maresin 1 Alleviates Diabetic Kidney Disease via LGR6-Mediated cAMP-SOD2-ROS Pathway. Oxidative Med. Cell. Longev. 2022, 2022, 7177889. [Google Scholar] [CrossRef]
- Li, Z.; Yuan, W.; Yang, X.; Jiang, J.; Zhang, Q.-L.; Yan, X.-X.; Zuo, Y.-C. Maresin 1 Activates LGR6 to Alleviate Neuroinflammation via the CREB/JMJD3/IRF4 Pathway in a Rat Model of Subarachnoid Hemorrhage. Neuroscience 2024, 542, 21–32. [Google Scholar] [CrossRef]
Name | Accession Number | Product Size (bp) | Primer Sequence (5′-3′) |
---|---|---|---|
PTK2 | NM_013081.2 | 246 | Forward:CGTGTGGATGTTTGGTGTGT Reverse:TGCACCTTCTCTTCCTCCAG |
Slc7a7 | NM_031341.2 | 190 | Forward:CCTGTTCTTCCCCATCGTCT Reverse:TGTGGTAGACGCTACGATCC |
Nars2 | NM_001034921.2 | 235 | Forward:GTGGATCCGGTCAGTCAGAT Reverse:AAATGCCTTGGCTTCACAGG |
Timd2 | NM_001013855.1 | 223 | Forward:ACTGAAGCAATCCCTCCACA Reverse:CTTCAATTCTGGCCTGCTCC |
Wnt7b | NM_001009695.2 | 161 | Forward:TTCACAACAATGAGGCAGGC Reverse:AGCTGCGTTGTACTTCTCCT |
RIPK3 | NM_139342.2 | 182 | Forward:TCCACATTTCAGGGAGGGTC Reverse:ACCACCTCAGCTTCTCTTCC |
TCOS_000719 | - | 216 | Forward:AACAAGGAACAAGGCCACAC Reverse:GGCTTTCCCAGGTCTTAGGT |
TCOS_000226 | - | 234 | Forward:CTGTCTGAAGGGCACATGTG Reverse:TCCAGGATCTCAGCCACAAA |
TCOS_000571 | - | 197 | Forward:GCTGGATGTTGAGAGCACAG Reverse:TTCTAGCTCCCCACTCCTCT |
TCOS_0003185 | - | 250 | Forward:ACTGTGTGTGCTGGGTATGA Reverse:TGGCAAGTTTCGACTGTGTG |
TCOS_13552 | - | 207 | Forward: ACAACACTACCAGGGGACAG Reverse:GCAGAGGCCCATAGTCTAGG |
TCOS_000214 | - | 201 | Forward:GTTCCCAAGGCTTGACCCAA Reverse:AAGAATTGCCTGGTGTGTCCT |
Sample Name | Clean Reads | Clean GC (%) | Mapped Reads (%) | Effective Rate (%) |
---|---|---|---|---|
Control_1 | 57,300,644 | 50.09 | 93.54 | 87.53 |
Control_2 | 51,742,860 | 50.69 | 91.38 | 85.51 |
KMnO4_1 | 57,128,986 | 49.36 | 94.43 | 88.36 |
KMnO4_2 | 51,422,446 | 50.56 | 93.09 | 88.63 |
LPS | 65,824,496 | 49.65 | 92.68 | 85.74 |
LPS | 78,704,690 | 49.41 | 92.91 | 87.48 |
KEGG Pathways | Enrichment | Genes |
---|---|---|
MAPK signaling pathway | 1.98 | Rac3; Cacnla; Cacnalc; Mef2c; Dusp8 |
cGMP-PKG signaling pathway | 2.95 | Wos3; Kcnj8; Pde3a; Mylk; Kcnmal; Mef2c; Pde5a; Kcnmb1 |
Necroptosis | 3.17 | RIPK1; RIPK3; MLKL; H2afx |
FOXO signaling pathway | 4.78 | Cdkn2b; Tgfb2; Pck1; Fbxo32; PlKI; Ccdn2; Ccnb1; Irs2; Slc2a4 |
GnRH pathway | 2.99 | Plcb1; Cacnalc; Plcb4; Adcy3; Calml3; Camk2g; Adcy9 |
Wnt pathway | 4 | SfrD2; Plcbl; Rspo3; Camk2g; Nfatc4; Rac3; Sfrp4; Ccdn2; Plcb4 |
PI3K-AKT signaling pathway | 5.1 | PI3K; PTEN; AKT; FOXO; CytokineR |
P53 signaling pathway | 2.99 | CHK2; P53; Fas; Caspase8 |
TNF signaling pathway | 2.21 | TNFR1; TRADD; TRAF; TAK1; TAB1/2; MKK; IL18R |
JAK-STAT signaling pathway | 2.38 | JAK; STAT; IL13ra; IL6r; IL11r; IL4r |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Umar, T.; Feng, H.; Feng, W.; Zhou, H.; Chen, N.; Zhang, J.; Liu, W.; Wang, X.; Umer, S.; Umar, Z.; et al. Comparative Transcriptional Analysis of Long Noncoding RNAs in Oxidative Stress and Inflammation Induced by Potassium Permanganate and Lipopolysaccharide in Rat Uterine Tissues. Antioxidants 2025, 14, 251. https://doi.org/10.3390/antiox14030251
Umar T, Feng H, Feng W, Zhou H, Chen N, Zhang J, Liu W, Wang X, Umer S, Umar Z, et al. Comparative Transcriptional Analysis of Long Noncoding RNAs in Oxidative Stress and Inflammation Induced by Potassium Permanganate and Lipopolysaccharide in Rat Uterine Tissues. Antioxidants. 2025; 14(3):251. https://doi.org/10.3390/antiox14030251
Chicago/Turabian StyleUmar, Talha, Huili Feng, Wen Feng, Han Zhou, Nuoer Chen, Jinxin Zhang, Wenjing Liu, Xiao Wang, Saqib Umer, Zaima Umar, and et al. 2025. "Comparative Transcriptional Analysis of Long Noncoding RNAs in Oxidative Stress and Inflammation Induced by Potassium Permanganate and Lipopolysaccharide in Rat Uterine Tissues" Antioxidants 14, no. 3: 251. https://doi.org/10.3390/antiox14030251
APA StyleUmar, T., Feng, H., Feng, W., Zhou, H., Chen, N., Zhang, J., Liu, W., Wang, X., Umer, S., Umar, Z., Asad, M., Naeem, M., Qiu, C., & Deng, G. (2025). Comparative Transcriptional Analysis of Long Noncoding RNAs in Oxidative Stress and Inflammation Induced by Potassium Permanganate and Lipopolysaccharide in Rat Uterine Tissues. Antioxidants, 14(3), 251. https://doi.org/10.3390/antiox14030251