In Vitro Anti-Aging Effects of Yeast/Rice Fermentation Filtrate Combined with Sialic Acid in Cosmetic Applications
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Cell Culture
2.3. RNA Immunoprecipitation Assay
2.4. Transcriptomic Analysis
2.5. Real-Time PCR for Collagen mRNA Detection
2.6. Luciferase Reporter Assay
2.7. ELISA
2.8. Nucleocytoplasmic Separation
2.9. Western Blot
2.10. Statistical Analysis
3. Results
3.1. RFF–SA Combination Significantly Enhance Collagen Expression
3.2. RFF–SA Combination Regulate Anti-Aging Genes via the IL-17 Signaling Pathway
3.3. SA Strongly Enhances Collagen Gene Promoters Compared to RFF
3.4. RFF–SA Combination Promotes HuR Nuclear Translocation
3.5. RFF–SA Combination Increase COL1A1 mRNA Stability
3.6. RFF–SA Combination Increase Skin Cell Resistance to Inflammatory Responses and Oxidation
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Purohit, T.; He, T.; Qin, Z.; Li, T.; Fisher, G.J.; Yan, Y.; Voorhees, J.J.; Quan, T. Smad3-Dependent Regulation of Type I Collagen in Human Dermal Fibroblasts: Impact on Human Skin Connective Tissue Aging. J. Dermatol. Sci. 2016, 83, 80–83. [Google Scholar] [CrossRef] [PubMed]
- Fisher, G.J.; Wang, Z.-Q.; Datta, S.C.; Varani, J.; Kang, S.; Voorhees, J.J. Pathophysiology of Premature Skin Aging Induced by Ultraviolet Light. N. Engl. J. Med. 1997, 337, 1419–1428. [Google Scholar] [CrossRef]
- Cole, M.A.; Quan, T.; Voorhees, J.J.; Fisher, G.J. Extracellular Matrix Regulation of Fibroblast Function: Redefining Our Perspective on Skin Aging. J. Cell Commun. Signal. 2018, 12, 35–43. [Google Scholar] [CrossRef]
- Bottoms, E.; Shuster, S. Effect of Ultra-Violet Light on Skin Collagen. Nature 1963, 199, 192–193. [Google Scholar] [CrossRef]
- Zhou, H.; He, J.; Liu, R.; Cheng, J.; Yuan, Y.; Mao, W.; Zhou, J.; He, H.; Liu, Q.; Tan, W.; et al. Microenvironment-Responsive Metal-Phenolic Network Release Platform with ROS Scavenging, Anti-Pyroptosis, and ECM Regeneration for Intervertebral Disc Degeneration. Bioact. Mater. 2024, 37, 51–71. [Google Scholar] [CrossRef]
- Chavoshnejad, P.; Foroughi, A.H.; Dhandapani, N.; German, G.K.; Razavi, M.J. Effect of Collagen Degradation on the Mechanical Behavior and Wrinkling of Skin. Phys. Rev. E 2021, 104, 034406. [Google Scholar] [CrossRef]
- Quan, T.; He, T.; Kang, S.; Voorhees, J.J.; Fisher, G.J. Solar Ultraviolet Irradiation Reduces Collagen in Photoaged Human Skin by Blocking Transforming Growth Factor-β Type II Receptor/Smad Signaling. Am. J. Pathol. 2004, 165, 741–751. [Google Scholar] [CrossRef]
- García, R.; Merino, D.; Gómez, J.M.; Nistal, J.F.; Hurlé, M.A.; Cortajarena, A.L.; Villar, A.V. Extracellular Heat Shock Protein 90 Binding to TGFβ Receptor I Participates in TGFβ-Mediated Collagen Production in Myocardial Fibroblasts. Cell. Signal. 2016, 28, 1563–1579. [Google Scholar] [CrossRef]
- Quan, T.; Shao, Y.; He, T.; Voorhees, J.J.; Fisher, G.J. Reduced Expression of Connective Tissue Growth Factor (CTGF/CCN2) Mediates Collagen Loss in Chronologically Aged Human Skin. J. Investig. Dermatol. 2010, 130, 415–424. [Google Scholar] [CrossRef] [PubMed]
- Akhter, S.; Tasnim, F.M.; Islam, M.N.; Rauf, A.; Mitra, S.; Emran, T.B.; Alhumaydhi, F.A.; Khalil, A.A.; Aljohani, A.S.M.; Al Abdulmonem, W.; et al. Role of Th17 and IL-17 Cytokines on Inflammatory and Auto-immune Diseases. Curr. Pharm. Des. 2023, 29, 2078–2090. [Google Scholar] [CrossRef] [PubMed]
- Chung, S.H.; Ye, X.-Q.; Iwakura, Y. Interleukin-17 Family Members in Health and Disease. Int. Immunol. 2021, 33, 723–729. [Google Scholar] [CrossRef]
- Amatya, N.; Garg, A.V.; Gaffen, S.L. IL-17 Signaling: The Yin and the Yang. Trends Immunol. 2017, 38, 310–322. [Google Scholar] [CrossRef]
- Herjan, T.; Yao, P.; Qian, W.; Li, X.; Liu, C.; Bulek, K.; Sun, D.; Yang, W.-P.; Zhu, J.; He, A.; et al. HuR Is Required for IL-17-Induced Act1-Mediated CXCL1 and CXCL5 mRNA Stabilization. J. Immunol. 2013, 191, 640–649. [Google Scholar] [CrossRef] [PubMed]
- Herjan, T.; Xiao, J.; Dziendziel Kolanek, M. RNA-Binding Protein HuR Promotes Airway Inflammation in a House Dust Mite-Induced Allergic Asthma Model. J. Interferon Cytokine Res. 2022, 42, 29–38. [Google Scholar] [CrossRef]
- Glisovic, T.; Bachorik, J.L.; Yong, J.; Dreyfuss, G. RNA-Binding Proteins and Post-Transcriptional Gene Regulation. FEBS Lett. 2008, 582, 1977–1986. [Google Scholar] [CrossRef]
- Pan, H.; Strickland, A.; Madhu, V.; Johnson, Z.I.; Chand, S.N.; Brody, J.R.; Fertala, A.; Zheng, Z.; Shapiro, I.M.; Risbud, M.V. RNA-Binding Protein HuR Regulates Extracellular Matrix Gene Expression and pH Homeostasis Independent of Controlling HIF-1α Signaling in Nucleus Pulposus Cells. Matrix Biol. 2019, 77, 23–40. [Google Scholar] [CrossRef]
- Brennan, C.M.; Steitz, J.A. HuR and mRNA Stability. Cell. Mol. Life Sci. 2001, 58, 266–277. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Zhou, Z.; Guo, M.; Zhou, Z. Validation of the Tight Junction Promotion and Skin Barrier Enhancement by Saccharomyces Rice Ferment Filtrate. J. Cosmet. Sci. 2022, 73, 201–212. [Google Scholar]
- Wang, H. Biologically Active Components and Skincare Benefits of Rice Fermentation Products: A Review. Cosmetics 2025, 12, 29. [Google Scholar] [CrossRef]
- Zhou, Z.; Guo, M.; Zhou, Z.; Yang, F. The Study of Skin Hydration, Anti-Wrinkle Function Improvement of Anti-Aging Cream with α-Ketoglutarate. J. Cosmet. Dermatol. 2022, 21, 1736–1743. [Google Scholar]
- Kriegel, A.; Schlosser, C.; Habeck, T.; Dahmen, C.; Götz, H.; Clauder, F.; Armbruster, F.P.; Baranowski, A.; Drees, P.; Rommens, P.M.; et al. Bone Sialoprotein Immobilized in Collagen Type I Enhances Bone Regeneration In Vitro and In Vivo. Int. J. Bioprint. 2022, 8, 591. [Google Scholar]
- De Meo, C.; Jones, B.T. Chemical Synthesis of Glycosides of N-Acetylneuraminic Acid. Adv. Carbohydr. Chem. Biochem. 2018, 75, 215–316. [Google Scholar]
- Wang, Z.; Nie, X.; Gao, F.; Tang, Y.; Ma, Y.; Zhang, Y.; Gao, Y.; Yang, C.; Ding, J.; Wang, X. Increasing Brain N-Acetylneuraminic Acid Alleviates Hydrocephalus-Induced Neurological Deficits. CNS Neurosci. Ther. 2023, 29, 3183–3198. [Google Scholar] [PubMed]
- Zhao, M.; Zhu, Y.; Wang, H.; Zhang, W.; Mu, W. Recent Advances on N-Acetylneuraminic Acid: Physiological Roles, Applications, and Biosynthesis. Synth. Syst. Biotechnol. 2023, 8, 509–519. [Google Scholar] [CrossRef] [PubMed]
- Yang, F.; Zhang, X.; Wang, H.; Guo, M.; Zhang, J.; Feng, X.; Yu, J.; Yang, J.; Zhu, J.; Wang, Y. Comprehensive Evaluation of the Efficacy and Safety of a New Multi-Component Anti-Aging Topical Eye Cream. Skin Res. Technol. 2024, 30, e13790. [Google Scholar] [CrossRef]
- Asp, P. How to Combine ChIP with qPCR. Methods Mol. Biol. 2018, 1689, 29–42. [Google Scholar]
- Graveley, B.R.; Hertel, K.J.; Maniatis, T. A Systematic Analysis of the Factors That Determine the Strength of Pre-mRNA Splicing Enhancers. EMBO J. 1998, 17, 6747–6756. [Google Scholar] [PubMed]
- Zhang, T.; Wang, X.-F.; Wang, Z.-C.; Lou, D.; Fang, Q.-Q.; Hu, Y.-Y.; Zhao, W.-Y.; Zhang, L.-Y.; Wu, L.-H.; Tan, W.-Q. Current Potential Therapeutic Strategies Targeting the TGF-β/Smad Signaling Pathway to Attenuate Keloid and Hypertrophic Scar Formation. Biomed. Pharmacother. 2020, 129, 110287. [Google Scholar]
- Chen, C.; Chen, J.; Wang, Y.; Fang, L.; Guo, C.; Sang, T.; Peng, H.; Zhao, Q.; Chen, S.; Lin, X.; et al. Ganoderma lucidum Polysaccharide Inhibits HSC Activation and Liver Fibrosis via Targeting Inflammation, Apoptosis, Cell Cycle, and ECM-Receptor Interaction Mediated by TGF-β/Smad Signaling. Phytomedicine 2023, 110, 154626. [Google Scholar] [CrossRef]
- Al-Habeeb, F.; Aloufi, N.; Traboulsi, H.; Liu, X.; Nair, P.; Haston, C.; Azuelos, I.; Huang, S.K.; White, E.S.; Gallouzi, I.E.; et al. Human Antigen R Promotes Lung Fibroblast Differentiation to Myofibroblasts and Increases Extracellular Matrix Production. J. Cell. Physiol. 2021, 236, 6836–6851. [Google Scholar] [CrossRef]
- Mukherjee, N.; Corcoran, D.L.; Nusbaum, J.D.; Reid, D.W.; Georgiev, S.; Hafner, M.; Ascano, M., Jr.; Tuschl, T.; Ohler, U.; Keene, J.D. Integrative Regulatory Mapping Indicates that the RNA-Binding Protein HuR Couples Pre-mRNA Processing and mRNA Stability. Mol. Cell 2011, 43, 327–339. [Google Scholar] [CrossRef]
- Deka, K.; Saha, S. Heat-Stress-Induced Arginylation of HuR Promotes Alternative Polyadenylation of Hsp70.3 by Regulating HuR Stability and RNA Binding. Cell Death Differ. 2021, 28, 730–747. [Google Scholar] [CrossRef]
- Wu, Z.; Fan, Q.; Miao, Y.; Tian, E.; Ishfaq, M.; Li, J. Baicalin Inhibits Inflammation Caused by Coinfection of Mycoplasma gallisepticum and Escherichia coli Involving IL-17 Signaling Pathway. Poult. Sci. 2020, 99, 5472–5480. [Google Scholar] [CrossRef] [PubMed]
- Fernandes, A.; Rodrigues, P.M.; Pintado, M.; Tavaria, F.K. A Systematic Review of Natural Products for Skin Applications: Targeting Inflammation, Wound Healing, and Photo-Aging. Phytomedicine 2023, 115, 154824. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.J.; Iwasaki, A.; Chien, A.L.; Kang, S. UVB-Mediated DNA Damage Induces Matrix Metalloproteinases to Promote Photoaging in an AhR- and SP1-Dependent Manner. JCI Insight 2022, 7, e154998. [Google Scholar] [CrossRef]
- Lu, L.; Qin, T.; Chen, K.; Xie, J.; Pan, L.; Xi, B. Enhancing the Antioxidant Activity by the Combination use of Resveratrol and Emodin. Russ. J. Bioorg. Chem. 2024, 50, 1466–1475. [Google Scholar] [CrossRef]
- Gueniche, A.; Valois, A.; Kerob, D.; Rasmont, V.; Nielsen, M. A combination of Vitreoscilla filiformis extract and Vichy volcanic mineralizing water strengthens the skin defenses and skin barrier. J. Eur. Acad. Dermatol. Venereol. 2022, 36, 16–25. [Google Scholar] [CrossRef]
- Wang, J.; Jarrold, B.; Zhao, W.; Deng, G.; Moulton, L.; Laughlin, T.; Hakozaki, T. The combination of sucrose dilaurate and sucrose laurate suppresses HMGB1: An enhancer of melanocyte dendricity and melanosome transfer to keratinocytes. J. Eur. Acad. Dermatol. Venereol. 2022, 36, 3–11. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.S.; Cui, W. Proliferation, Survival and Metabolism: The Role of PI3K/AKT/mTOR Signalling in Pluripotency and Cell Fate Determination. Development 2016, 143, 3050–3060. [Google Scholar] [CrossRef]
- Mitchell, S.; Vargas, J.; Hoffmann, A. Signaling via the NFκB System. WIREs Syst. Biol. Med. 2016, 8, 227–241. [Google Scholar] [CrossRef]






| Gene Symbol (Accession Number) | Sense Primer (5′–3′) | Antisense Primer (5′–3′) |
|---|---|---|
| COL1A1 (NM_000088.4) | AAGGTGTTGTGCGATGACG | TGGTCGGTGGGTGACTCTG |
| COL3A1 (NM_000090.4) | CCCGTATTATGGAGATGAAC | TCAGGACTAATGAGGCTTTCT |
| COL4A1 (NM_001845.6) | GCTGTGGATCGGCTACTCTT | GGACGGCGTAGGCTTCTT |
| COL7A1 (NM_000094.4) | CCCACATCCATCCTCCTTT | CCCATCCAACTGGTAGCG |
| COL17A1 (NM_000494.4) | GAGGACGGAGTCAAACACG | CTTGAGCAAACGCTTAACAT |
| COL24A1 (NM_152890.7) | AATCTCAAGAAGGCTATCAC | ATGGCTCATTTGTCACTC |
| FN1 (NM_212482.4) | TGTTATGGAGGAAGCCGAGGTT | GCAGCGGTTTGCGATGGT |
| ELN (NM_000501.4) | CCCGCAGTTACCTTTCCG | GGCACTTTCCCAGGCTTCA |
| CXCL1 (NM_001511.4) | CCCCAAGAACATCCAAAGTG | GATGCAGGATTGAGGCAAG |
| CXCL5 (NM_002994.5) | TACAGACCACGCAAGGAGTT | TCTTCAGGGAGGCTACCAC |
| CXCL7 (NM_002704.3) | AGTGCGAGACCACTTCAT | ACTTTCCTCTTTGCCTTT |
| CXCL8 (NM_001354840.3) | TGGCAGCCTTCCTGATTT | ACTTCTCCACAACCCTCT |
| CXCL17 (NM_198477.3) | TGCTGCCACTAATGCTGA | TGGTGCCTTTGGTGTCTT |
| MMP1 (NM_002421.4) | GGCTGAAAGTGACTGGGAAAC | GGCAAATCTGGCGTGTAA |
| IL-1β (NM_000576.3) | ATGGCTTATTACAGTGGC | TAGTGGTGGTCGGAGATT |
| PGE2 (U19487.1) | CGAGGTGTATGTATGAGTGT | AGTGGGTAAGTATGTAGTGC |
| GAPDH (NM_001289746.2) | CTCATGCGCTGTGTGGAA | GAAAATGGGAAACTGGCT |
| TGFB1-3′UTR (NM_000660.7) | GGACTCTGATAACACCCATTT | ATTACAGGCGTGAGCCAC |
| COL1A1-3′UTR (NM_000088.4) | CTCAGACTGCCAAAGAAGC | GCACAAGGGATTGACACG |
| CXCL8-3′UTR (NM_001354840.3) | TGGGTTTGCTAGAATGTG | GTGAGGTAAGATGGTGGC |
| COL4A1-3′UTR (NM_001845.6) | TCTGCATCCTGGCTTGAA | TCCGAATCTGCCCTCCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, F.; Li, M.; Zuo, Y.; Zhang, L.; Wu, J.; Liu, Z.; Wang, H. In Vitro Anti-Aging Effects of Yeast/Rice Fermentation Filtrate Combined with Sialic Acid in Cosmetic Applications. Antioxidants 2025, 14, 1184. https://doi.org/10.3390/antiox14101184
Yang F, Li M, Zuo Y, Zhang L, Wu J, Liu Z, Wang H. In Vitro Anti-Aging Effects of Yeast/Rice Fermentation Filtrate Combined with Sialic Acid in Cosmetic Applications. Antioxidants. 2025; 14(10):1184. https://doi.org/10.3390/antiox14101184
Chicago/Turabian StyleYang, Fan, Mingxuan Li, Yao Zuo, Lei Zhang, Jinyong Wu, Zhi Liu, and Hua Wang. 2025. "In Vitro Anti-Aging Effects of Yeast/Rice Fermentation Filtrate Combined with Sialic Acid in Cosmetic Applications" Antioxidants 14, no. 10: 1184. https://doi.org/10.3390/antiox14101184
APA StyleYang, F., Li, M., Zuo, Y., Zhang, L., Wu, J., Liu, Z., & Wang, H. (2025). In Vitro Anti-Aging Effects of Yeast/Rice Fermentation Filtrate Combined with Sialic Acid in Cosmetic Applications. Antioxidants, 14(10), 1184. https://doi.org/10.3390/antiox14101184

