Trichoderma longibrachiatum (T6) Peptaibols Inhibiting the Monilia yunnanensis Growth and Inducing Pear Fruit Resistance in Its Infection
Abstract
1. Introduction
2. Materials and Methods
2.1. Fungal Inoculum Preparation
2.2. Peptaibols from T6 Preparation
2.3. The Inhibitory Effect of T6 Peptaibols on M. yunnanensis and Disease Control
2.4. Control Efficacy of T6 Peptaibols on Brown Rot Disease in Pear Fruit
2.5. Treatment of Test Samples
2.6. Assessment of Physiological and Biochemical Parameters
2.7. Measurement of Electrolyte Leakage in Pear fruit
2.8. Analysis of Defense-Related Enzyme Genes Expression by Quantitative Reverse Transcriptase–PCR (qRT–PCR)
2.9. Data Analysis
3. Results
3.1. Antifungal Activity of T6 Peptaibols on M. yunnanensis and Disease Control
3.2. Controlling Effect of T6 Peptaibols on Brown Rot Disease in Pear Fruit
3.3. Effects of T6 Peptaibols on Oxidative Alleviation and Electrolyte Leakage for Pear Fruit
3.4. Effect of T6 Peptaibols on Defense Enzyme Activity
3.5. Effect of T6 Peptaibols on Enzyme Activities in Metabolic Pathway
3.6. Effect of T6 Peptaibols on the Expression Levels of Defense-Related Genes in Pear Fruit
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ghazouani, T.; Talbi, W.; Sassi, C.B.; Fattouch, S. Pears. In Nutritional Composition and Antioxidant Properties of Fruits and Vegetables; Elsevier: Amsterdam, The Netherlands, 2020; pp. 671–680. [Google Scholar]
- Wang, Y.; Zhang, X.; Wang, Y.; Yang, S.; Qu, H. The changes of intracellular calcium concentration and distribution in the hard end pear (Pyrus pyrifolia cv. ‘whangkeumbae’) fruit. Cell Calcium 2018, 71, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Teng, Y. The pear industry and research in China. Acta Hortic. 2011, 909, 161–170. [Google Scholar] [CrossRef]
- Li, X.; Li, X.; Wang, T.; Gao, W. Nutritional composition of pear cultivars (Pyrus spp.). In Nutritional Composition of Fruit Cultivars; Elsevier: Amsterdam, The Netherlands, 2016; pp. 573–608. [Google Scholar]
- Zambounis, A.; Ganopoulos, I.; Tsaftaris, A. Metagenomics analysis of fungal communities associated with postharvest diseases in pear fruits under the effect of management practices. Arch. Microbiol. 2020, 202, 2391–2400. [Google Scholar] [CrossRef] [PubMed]
- Byrde, R.J.W.; Willetts, H.J. The Brown Rot Fungi of Fruit: Their Biology and Control; Elsevier: Amsterdam, The Netherlands, 2013. [Google Scholar]
- Sardella, D.; Muscat, A.; Brincat, J.P. A comprehensive review of the pear fungal diseases. Int. J. Fruit Sci. 2016, 16, 351–377. [Google Scholar] [CrossRef]
- Zhu, X.Q.; Niu, C.W.; Chen, X.Y. Monilinia species associated with brown rot of cultivated apple and pear fruit in China. Plant Dis. 2016, 100, 2240–2250. [Google Scholar] [CrossRef]
- Mari, M.; Bertolini, P.; Pratella, G.C. Non-conventional methods for the control of post-harvest pear diseases. J. Appl. Microbiol. 2003, 94, 761–766. [Google Scholar] [CrossRef]
- Haq, I.U.; Ijaz, S. Plant Disease Management Strategies for Sustainable Agriculture Through Traditional and Modern Approaches; Springer Nature: Berlin/Heidelberg, Germany, 2020; Volume 13. [Google Scholar]
- Madbouly, A.K.; Elyousr, K.A.A.; Ismail, I.M. Biocontrol of Monilinia fructigena, causal agent of brown rot of apple fruit, by using endophytic yeasts. Biol. Control 2020, 144, 104239. [Google Scholar] [CrossRef]
- Altindag, M.; Sahin, M.; Esitken, A. Biological control of brown rot (Moniliana laxa Ehr.) on apricot (Prunus armeniaca L. cv. hacıhaliloğlu) by Bacillus, Burkholdria, and Pseudomonas application under in vitro and in vivo conditions. Biol. Control 2006, 38, 369–372. [Google Scholar] [CrossRef]
- Zhou, T.; Schneider, K.E.; Li, X.Z. Development of biocontrol agents from food microbial isolates for controlling post-harvest peach brown rot caused by Monilinia fructicola. Int. J. Food Microbiol. 2008, 126, 180–185. [Google Scholar] [CrossRef]
- Contreras-Cornejo, H.A.; Macías-Rodríguez, L.; Cortés-Penagos, C. Trichoderma virens, a plant beneficial fungus, enhances biomass production and promotes lateral root growth through an auxin-dependent mechanism in Arabidopsis. Plant Physiol. 2009, 149, 1579–1592. [Google Scholar] [CrossRef]
- Verma, M.; Brar, S.K.; Tyagi, R.D. Antagonistic fungi, Trichoderma spp.: Panoply of biological control. Biochem. Eng. J. 2007, 37, 1–20. [Google Scholar] [CrossRef]
- Marik, T.; Tyagi, C.; Balázs, D. Structural diversity and bioactivities of peptaibol compounds from the Longibrachiatum clade of the filamentous fungal genus Trichoderma. Front. Microbiol. 2019, 10, 1434. [Google Scholar] [CrossRef] [PubMed]
- Marik, T.; Tyagi, C.; Racić, G. New 19-residue peptaibols from Trichoderma clade Viride. Microorganisms 2018, 6, 85. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Zhang, D.D.; Dong, X.W. Antimicrobial peptaibols induce defense responses and systemic resistance in tobacco against Tobacco mosaic virus. FEMS Microbiol. Lett. 2010, 313, 120–126. [Google Scholar] [CrossRef][Green Version]
- Zhao, P.; Ren, A.; Dong, P. The antimicrobial peptaibol trichokonin IV promotes plant growth and induces systemic resistance against Botrytis cinerea infection in moth orchid. J. Phytopathol. 2018, 166, 346–354. [Google Scholar] [CrossRef]
- Zhang, S.; Xiang, D.; Sun, C. Morphological and molecular identification of peach brown rot disease in Tibet and exploration of the biocontrol efficiency of Trichoderma. J. Fungi 2022, 8, 1174. [Google Scholar] [CrossRef]
- Zhang, S.; Gan, Y.; Xu, B. Application of plant-growth-promoting fungi Trichoderma longibrachiatum T6 enhances tolerance of wheat to salt stress through improvement of antioxidative defense system and gene expression. Front. Plant Sci. 2016, 7, 1405. [Google Scholar] [CrossRef]
- Cao, Y.; Zhang, Z.W.; Xue, L.W. Lack of salicylic acid in Arabidopsis protects plants against moderate salt stress. Z. Naturforschung 2009, 64, 231–238. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhao, P.; Ren, A.; Dong, P. Antimicrobial peptaibols, trichokonins, inhibit mycelial growth and sporulation and induce cell apoptosis in the pathogenic fungus Botrytis cinerea. Appl. Biochem. Microbiol. 2018, 54, 396–403. [Google Scholar] [CrossRef]
- Alfaro-Vargas, P.; Bastos-Salas, A.; Muñoz-Arrieta, R. Peptaibol production and characterization from Trichoderma asperellum and their action as biofungicide. J. Fungi 2022, 8, 1037. [Google Scholar] [CrossRef] [PubMed]
- Dey, N.; Roy, U.K.; Aditya, M.; Bhattacharjee, S. Defensive strategies of ROS in programmed cell death associated with hypertensive response in plant pathogenesis. Ann. Syst. Biol. 2020, 3, 1–9. [Google Scholar]
- Mohammadi, M.A.; Cheng, Y.; Aslam, M.; Jakada, B.H.; Wai, M.H.; Ye, K.; He, X.; Luo, T.; Ye, L.; Dong, C. ROS and oxidative response systems in plants under biotic and abiotic stresses: Revisiting the crucial role of phosphite triggered plants defense response. Front. Microbiol. 2021, 12, 631318. [Google Scholar] [CrossRef] [PubMed]
- Boamah, S.; Zhang, S.; Xu, B.; Li, T.; Calderón-Urrea, A.; Tiika, R.J. Trichoderma longibrachiatum TG1 increases endogenous salicylic acid content and antioxidants activity in wheat seedlings under salinity stress. Peer J. 2022, 10, e12923. [Google Scholar] [CrossRef]
- Saharan, G.S.; Mehta, N.K.; Meena, P.D.; Saharan, G.S.; Mehta, N.K.; Meena, P.D. Biometabolomics of host resistance to hemi-biotrophs and necrotrophs. In Molecular Mechanism of Crucifer’s Host-Resistance; Springer: Singapore, 2021; pp. 495–584. [Google Scholar]
- Shetty, N.P.; Jørgensen, H.J.L.; Jensen, J.D.; Collinge, D.B.; Shetty, H.S. Roles of reactive oxygen species in interactions between plants and pathogens. Eur. J. Plant Pathol. 2008, 121, 267–280. [Google Scholar] [CrossRef]
- Noctor, G.; Reichheld, J.P.; Foyer, C.H. ROS-related redox regulation and signaling in plants. Semin. Cell Dev. Biol. 2018, 80, 3–12. [Google Scholar] [CrossRef]
- Khan, M.; Ali, S.; Al Azzawi, T.; Saqib, S.; Ullah, F.; Ayaz, A.; Zaman, W. The key roles of ROS and RNS as a signaling molecule in plant–microbe interactions. Antioxidants 2023, 12, 268. [Google Scholar] [CrossRef]
- Baştaş, K. Importance of reactive oxygen species in plants-pathogens interactions. J. Agric. Food Sci. 2015, 28, 11–21. [Google Scholar]
- Sezhiyan, A.; Subiramaniyan, A.; Perumal, C.; Natarajan, A.; Arumugam, R.; Ramalingam, K.; Chinnaraju, N.K. Salt stress and its impact on rice physiology with special reference to India-A review. J. Appl. Nat. Sci. 2023, 15, 1137–1146. [Google Scholar] [CrossRef]
- Engelberth, J.; Koch, T.; Schüler, G.D.; Bachmann, N.; Rechtenbach, J.; Boland, W. Ion channel-forming alamethicin is a potent elicitor of volatile biosynthesis and tendril coiling. Cross talk between jasmonate and salicylate signaling in lima bean. Plant Physiol. 2001, 125, 369–377. [Google Scholar] [CrossRef]
- Chen, F.; D’Auria, J.C.; Tholl, D.; Ross, J.R.; Gershenzon, J.; Noel, J.P.; Pichersky, E. An Arabidopsis thaliana gene for methylsalicylate biosynthesis, identified by a biochemical genomics approach, has a role in defense. Plant J. 2003, 36, 577–588. [Google Scholar] [CrossRef]
- Foyer, C.H.; Noctor, G. Redox homeostasis and signaling in a higher-CO2 world. Annu. Rev. Plant Biol. 2020, 71, 157–182. [Google Scholar] [CrossRef]
Fractions Volume (mL) | Elution Gradients | Flow Rate (mL/min) |
---|---|---|
700 | V(Water):V(Methanol) = 100:0 | 1 |
700 | V(Water):V(Methanol) = 40:60 | 1 |
700 | V(Water):V(Methanol) = 0:100 | 1 |
Genes Name | Primers Sequence (5′-3′) | Genes ID |
---|---|---|
CAT | CGTGGCAGCCCTGAAAC | XR_007254874.1 |
ATTCTCTTGGATGTGGGACTTA | ||
SOD | TTCTTGGGCGAGCAGTTG | XM_009354853.3 |
TCCTGCGTTCCCAGTAGTCT | ||
POD | TCAGGCAGAAGTTTGAGCAG | XM_009369735 |
CGCTCTCAAGACCAAGGACA | ||
PPO | CTCAGCAGGCTACAAGGCA | XM_048591029.1 |
GACATTTACAACCGCATCACT | ||
PAL | ACGCAAAATGGTCAAAACG | XM_009375248.3 |
AGACTCTCTCCGCCGAGC | ||
LOX | ATCCATTCCGAACGACCA | XM_048566477 |
TCTCCCCAGTTCCATCTCC | ||
CHI | CCCTCTTCACTCATCTTTTCTG | XM_009360218.3 |
CAAGGATAGCACCGCCAC | ||
β-Glu | GAAGATAAGGACATTTTCGGG | XM_009355010.3 |
CTGATAAAGGAGAGCCACTACG | ||
Actin | TGCTGAGCGGGAAATTGTG | AF386514.1 |
TCCGATAGTGATTACCTGTCCATC |
Concentrations (µg/mL) | Colony Diameters (mm) | Inhibitory Rates (%) |
---|---|---|
250 | 45.94 ± 0.61 c | 35.79 ± 0.96 e |
500 | 29.97 ± 0.22 d | 60.83 ± 0.34 d |
750 | 22.07 ± 0.35 e | 73.23 ± 0.54 c |
1000 | 17.17 ± 0.38 f | 80.91 ± 0.59 b |
1250 | 13.94 ± 0.14 g | 85.99 ± 0.22 a |
Positive control | 63.20 ± 0.28 b | 8.72 ± 0.44 f |
Negative control | 68.76 ± 0.82 a | _ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lv, H.; Zhang, S.; Ma, N.; Boamah, S.; Xu, B. Trichoderma longibrachiatum (T6) Peptaibols Inhibiting the Monilia yunnanensis Growth and Inducing Pear Fruit Resistance in Its Infection. Antioxidants 2024, 13, 1517. https://doi.org/10.3390/antiox13121517
Lv H, Zhang S, Ma N, Boamah S, Xu B. Trichoderma longibrachiatum (T6) Peptaibols Inhibiting the Monilia yunnanensis Growth and Inducing Pear Fruit Resistance in Its Infection. Antioxidants. 2024; 13(12):1517. https://doi.org/10.3390/antiox13121517
Chicago/Turabian StyleLv, Hang, Shuwu Zhang, Nan Ma, Solomon Boamah, and Bingliang Xu. 2024. "Trichoderma longibrachiatum (T6) Peptaibols Inhibiting the Monilia yunnanensis Growth and Inducing Pear Fruit Resistance in Its Infection" Antioxidants 13, no. 12: 1517. https://doi.org/10.3390/antiox13121517
APA StyleLv, H., Zhang, S., Ma, N., Boamah, S., & Xu, B. (2024). Trichoderma longibrachiatum (T6) Peptaibols Inhibiting the Monilia yunnanensis Growth and Inducing Pear Fruit Resistance in Its Infection. Antioxidants, 13(12), 1517. https://doi.org/10.3390/antiox13121517