Protective Effect of Peptides from Pinctada Martensii Meat on the H2O2-Induced Oxidative Injured HepG2 Cells
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of HPM
2.3. Membrane Ultrafiltration
2.4. Peptide Purification by Sephadex G-25 Gel Chromatography
2.5. Identification of Antioxidant Peptide by UHPLC-MS/MS
2.6. Prediction of Potential Antioxidant Activity of Peptides in Silico Methods
2.7. Peptides Synthesis
2.8. In Vitro Antioxidant Activity Assay
2.8.1. DPPH Radical Scavenging Activity
2.8.2. ABTS Radical Scavenging Activity
2.8.3. Reducing Power
2.8.4. Oxygen Radical Absorption Capacity (ORAC) Assay
2.9. Cell Study
2.9.1. Cell Culture
2.9.2. Evaluation of HepG2 Cell Viability
2.9.3. Protective Effect of S4 against H2O2- Induced Oxidative Stress in HepG2 Cells
Determination of ROS Level in HepG2 Cells
Determination of LDH Level in HepG2 Cells
Determination of the Activities of SOD, CAT, and the Level of GSH in HepG2 Cells
RNA Extraction and Real-Time Quantitative PCR (RT-qPCR)
2.10. Statistical Analysis
3. Results
3.1. Preparation and Antioxidant Activity of Pinctada Martensii Meat Hydrolysate (HPM)
3.2. Purification of Antioxidant Peptides by Ultrafiltration
3.3. Purification of HPM-3 by Sephadex G-25 Gel Chromatography
3.4. Cytotoxicity of Peptide S4
3.5. Protective Effect of Peptide S4 on HepG2 Cells against H2O2-Induced Oxidative Stress
3.5.1. Effect of Peptide S4 on Survival Rate of HepG2 Cells against H2O2-Induced Oxidative Stress
3.5.2. Effect of Peptide S4 on ROS and LDH Levels in HepG2 Cells
3.5.3. Effects of Peptide S4 on the Activities of SOD and CAT, and the Level of GSH in HepG2 Cells
3.6. Gene Expression of Nrf2 Signaling Pathway
3.7. Identification of Sequences from S4
3.8. Prediction of Potential Antioxidant Activity of Peptides in Silico Methods
3.9. Cytotoxicity of the Synthetic Peptides
3.10. Protective Effect of the Synthetic Peptides of HepG2 Cells against H2O2-Induced Oxidative Stress
3.10.1. Effect of the Synthetic Peptides on Survival Rates of HepG2 Cells
3.10.2. Effects of the Synthetic Peptides on the Levels of LDH, GSH, and SOD of HepG2 Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Xing, L.; Wang, Z.; Hao, Y.; Zhang, W. Marine products as a promising resource of bioactive peptides: Update of extraction strategies and their physiological regulatory effects. J. Agr. Food Chem. 2022, 70, 3081–3095. [Google Scholar]
- Zou, T.; He, T.; Li, H.; Tang, H.; Xia, E. The structure-activity relationship of the antioxidant peptides from natural proteins. Molecules 2016, 21, 72. [Google Scholar]
- Dennery, P.A. Introduction to serial review on the role of oxidative stress in diabetes mellitus. Free Radical Bio. Med. 2006, 40, 1–2. [Google Scholar]
- Wu, J.; Huo, J.; Huang, M.; Zhao, M.; Luo, X.; Sun, B. Structural characterization of a tetrapeptide from sesame flavor-type baijiu and its preventive effects against AAPH-Induced oxidative stress in HepG2 cells. J. Agr. Food Chem. 2017, 65, 10495–10504. [Google Scholar]
- Han, R.; Ma, Y.; Xiao, J.; You, L.; Pedisić, S.; Liao, L. The possible mechanism of the protective effect of a sulfated polysaccharide from Gracilaria Lemaneiformis against colitis induced by dextran sulfate sodium in mice. Food Chem. Toxicol. 2021, 149, 112001. [Google Scholar]
- Chen, X.Y.; Sun-Waterhouse, D.; Yao, W.Z.; Li, X.; Zhao, M.M.; You, L.J. Free radical-mediated degradation of polysaccharides: Mechanism of free radical formation and degradation, influence factors and product properties. Food Chem. 2021, 365, 130524. [Google Scholar]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of Nrf2/HO-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar]
- Hou, D.; Korenori, Y.; Tanigawa, S.; Yamada-Kato, T.; Nagai, M.; He, X.; He, J. Dynamics of Nrf2 and Keap1 in ARE-mediated NQO1 expression by wasabi 6-(Methylsulfinyl)hexyl isothiocyanate. J. Agr. Food Chem. 2011, 59, 11975–11982. [Google Scholar]
- Zhang, J.; Li, M.; Zhang, G.; Tian, Y.; Kong, F.; Xiong, S.; Zhao, S.; Jia, D.; Manyande, A.; Du, H. Identification of novel antioxidant peptides from snakehead (Channa argus) soup generated during gastrointestinal digestion and insights into the anti-oxidation mechanisms. Food Chem. 2021, 337, 127921. [Google Scholar]
- Hu, Y.; Lu, S.; Li, Y.; Wang, H.; Shi, Y.; Zhang, L.; Tu, Z. Protective effect of antioxidant peptides from grass carp scale gelatin on the H2O2-mediated oxidative injured HepG2 cells. Food Chem. 2022, 373, 131539. [Google Scholar]
- Liu, H.; Liang, J.; Xiao, G.; Vargas-De-La-Cruz, C.; Simal-Gandara, J.; Xiao, J.; Wang, Q. Active sites of peptides Asp-Asp-Asp-Tyr and Asp-Tyr-Asp-Asp protect against cellular oxidative stress. Food Chem. 2022, 366, 130626. [Google Scholar]
- Hamzeh, A.; Rezaei, M.; Khodabandeh, S.; Motamedzadegan, A.; Noruzinia, M.; Regenstein, J.M. Optimization of antioxidant peptides production from the mantle of cuttlefish (Sepia pharaonis) using RSM and fractionation. J. Aquat. Food Prod. T. 2019, 28, 392–401. [Google Scholar]
- Li, Z.R.; Wang, B.; Chi, C.F.; Gong, Y.D.; Luo, H.Y.; Ding, G.F. Influence of average molecular weight on antioxidant and functional properties of cartilage collagen hydrolysates from Sphyrna lewini, Dasyatis akjei and Raja porosa. Food Res. Int. 2013, 51, 283–293. [Google Scholar]
- Venkatesan, K.; Nazeer, R.A. Antioxidant activity of purified protein hydrolysates from northern whiting fish (Sillago sihama) Muscle. Int. J. Pept. Res. Ther. 2014, 20, 209–219. [Google Scholar]
- Han, J.; Huang, Z.; Tang, S.; Lu, C.; Wan, H.; Zhou, J.; Li, Y.; Ming, T.; Wang, Z.J.; Su, X. The novel peptides ICRD and LCGEC screened from tuna roe show antioxidative activity via Keap1/Nrf2-ARE pathway regulation and gut microbiota modulation. Food Chem. 2020, 327, 127094. [Google Scholar]
- Xiao, C.; Toldrá, F.; Zhao, M.; Zhou, F.; Luo, D.; Jia, R.; Mora, L. In vitro and in silico analysis of potential antioxidant peptides obtained from chicken hydrolysate produced using Alcalase. Food Res. Int. 2022, 157, 111253. [Google Scholar]
- Wang, Q.; Yang, C.; Du, X.; Liu, X.; Sun, R.; Deng, Y. Growth performance and biochemical composition of juvenile pearl oyster Pinctada martensii fed on artificial diets. Aquacult. Int. 2016, 24, 995–1005. [Google Scholar]
- Liu, X.; Huang, L.; Bai, Y.; Liu, X.; Li, S. Extracting bio-zinc and taurine from Pinctada martensii meat. J. Food Sci. 2020, 85, 1125–1131. [Google Scholar]
- Wei, M.; Qiu, H.; Zhou, J.; Yang, C.; Chen, Y.; You, L. The anti-photoaging activity of peptides from Pinctada martensii meat. Mar. Drugs 2022, 20, 770. [Google Scholar]
- Xia, G.; Zhang, X.; Dong, Z.; Shen, X. Comparative study on the antioxidant activity of peptides from pearl oyster (Pinctada martensii) mantle type V collagen and tilapia (Oreochromis niloticus) scale type I collagen. J. Ocean U. China 2017, 16, 1175–1182. [Google Scholar]
- GB/T 22492-2008; Soy peptides powder. Standards Press of China: Beijing, China, 2008.
- Association of Official Analytical Chemists. Official Methods of Analysis, 14th ed.; Oxford University Press: Washington, DC, USA, 1984. [Google Scholar]
- Gong, P.; Wang, B.; Wu, Y.; Li, Q.; Qin, B.; Li, H. Release of antidiabetic peptides from Stichopus japonicas by simulated gastrointestinal digestion. Food Chem. 2020, 315, 126273. [Google Scholar]
- Ghassem, M.; Arihara, K.; Mohammadi, S.; Sani, N.A.; Babji, A.S. Identification of two novel antioxidant peptides from edible bird’s nest (Aerodramus fuciphagus) protein hydrolysates. Food Funct. 2017, 8, 246–252. [Google Scholar]
- Holton, T.A.; Pollastri, G.; Shields, D.C.; Mooney, C. CPPpred: Prediction of cell penetrating peptides. Bioinformatics 2013, 29, 3094–3096. [Google Scholar]
- Tu, M.L.; Liu, H.X.; Cheng, S.Z.; Mao, F.J.; Chen, H.; Fan, F.J.; Lu, W.H.; Du, M. Identification and characterization of a novel casein anticoagulant peptide derived from in vivo digestion. Food Funct. 2019, 10, 2552–2559. [Google Scholar]
- Wu, H.C.; Chen, H.M.; Shiau, C.Y. Free amino acids and peptides as related to antioxidant properties in protein hydrolysates of mackerel (Scomber austriasicus). Food Res. Int. 2003, 36, 949–957. [Google Scholar]
- Ahmadi, F.; Kadivar, M.; Shahedi, M. Antioxidant activity of Kelussia odoratissima Mozaff. In model and food systems. Food Chem. 2007, 105, 57–64. [Google Scholar]
- Huang, D.J.; Ou, B.X.; Hampsch-Woodill, M.; Flanagan, J.A.; Prior, R.L. High-throughput assay of oxygen radical absorbance capacity (ORAC) using a multichannel liquid handling system coupled with a microplate flourescence reader in 96-well format. J. Agr. Food Chem. 2002, 50, 4437–4444. [Google Scholar]
- Wang, H.; Joseph, J.A. Quantifying cellular oxidative stress by dichlorofluorescein assay using microplate reader. Free Radical Bio. Med. 1999, 27, 612–616. [Google Scholar]
- Zou, B.; Xiao, G.; Xu, Y.; Wu, J.; Yu, Y.; Fu, M. Persimmon vinegar polyphenols protect against hydrogen peroxide-induced cellular oxidative stress via Nrf2 signalling pathway. Food Chem. 2018, 255, 23–30. [Google Scholar]
- Sridhar, K.; Inbaraj, B.S.; Chen, B. Recent developments on production, purification and biological activity of marine peptides. Food Res. Int. 2021, 147, 110468. [Google Scholar]
- Xia, E.; Zhai, L.; Huang, Z.; Liang, H.; Yang, H.; Song, G.; Li, W.; Tang, H. Optimization and identification of antioxidant peptide from underutilized dunaliella salina protein: Extraction, in vitro gastrointestinal digestion, and fractionation. Biomed. Res. Int. 2019, 2019, 6424651. [Google Scholar]
- Parrot, S.; Degraeve, P.; Curia, C.; Martial-Gros, A. In vitro study on digestion of peptides in emmental cheese: Analytical evaluation and influence on angiotensin I converting enzyme inhibitory peptides. Die Nahr. 2003, 47, 87–94. [Google Scholar]
- Wang, Y.; Zhao, Y.; Wang, Y.; Zhao, W.; Wang, P.; Chi, C.; Wang, B. Antioxidant peptides from Antarctic Krill (Euphausia superba) hydrolysate: Preparation, identification and cytoprotection on H2O2-induced oxidative stress. J. Funct. Foods. 2021, 86, 104701. [Google Scholar]
- Lu, X.; Zhang, L.; Sun, Q.; Song, G.; Huang, J. Extraction, identification and structure-activity relationship of antioxidant peptides from sesame (Sesamum indicum L.) protein hydrolysate. Food Res. Int. 2019, 116, 707–716. [Google Scholar]
- Centenaro, G.S.; Salas-Mellado, M.; Pires, C.; Batista, I.; Nunes, M.L.; Prentice, C. Fractionation of protein hydrolysates of fish and chicken using membrane ultrafiltration: Investigation of antioxidant activity. Appl. Biochem. Biotech. 2014, 172, 2877–2893. [Google Scholar]
- Olagunju, A.I.; Omoba, O.S.; Enujiugha, V.N.; Alashi, A.M.; Aluko, R.E. Pigeon pea enzymatic protein hydrolysates and ultrafiltration peptide fractions as potential sources of antioxidant peptides: An in vitro study. LWT 2018, 97, 269–278. [Google Scholar]
- Sierra, L.; Fan, H.; Zapata, J.; Wu, J. Antioxidant peptides derived from hydrolysates of red tilapia (Oreochromis sp.) scale. LWT 2021, 146, 111631. [Google Scholar]
- Akinyede, A.I.; Fagbemi, T.N.; Osundahunsi, O.F.; Aluko, R.E. Amino acid composition and antioxidant properties of the enzymatic hydrolysate of calabash nutmeg (Monodora myristica) and its membrane ultrafiltration peptide fractions. J. Food Biochem. 2020, 45, e13437. [Google Scholar]
- Shoji, H.; Oguchi, S.; Shinohara, K.; Shimizu, T.; Yamashiro, Y. Effects of iron-unsaturated human lactoferrin on hydrogen peroxide-induced oxidative damage in intestinal epithelial cells. Pediatr. Res. 2007, 61, 89–92. [Google Scholar]
- Ou, J.; Wang, Z.; Liu, X.; Song, B.; Chen, J.; Li, R.; Jia, X.; Huang, R.; Xiang, W.; Zhong, S. Regulatory effects of marine polysaccharides on gut microbiota dysbiosis: A review. Food Chem. X 2022, 15, 100444. [Google Scholar]
- Liang, R.; Cheng, S.; Dong, Y.; Ju, H. Intracellular antioxidant activity and apoptosis inhibition capacity of PEF-treated KDHCH in HepG2 cells. Food Res. Int. 2019, 121, 336–347. [Google Scholar]
- Bo, P.; Bingna, C.; Jianyu, P. Octopus-derived antioxidant peptide protects against hydrogen peroxide-induced oxidative stress in IEC-6 cells. Food Sci. Nutr. 2022, 10, 4049–4058. [Google Scholar]
- Yao, W.; Gong, Y.; Li, L.; Hu, X.; You, L. The effects of dietary fibers from rice bran and wheat bran on gut microbiota: An overview. Food Chem. X 2022, 13, 100252. [Google Scholar]
- Wang, L.; Ding, L.; Yu, Z.; Zhang, T.; Ma, S.; Liu, J. Intracellular ROS scavenging and antioxidant enzyme regulating capacities of corn gluten meal-derived antioxidant peptides in HepG2 cells. Food Res. Int. 2016, 90, 33–41. [Google Scholar]
- Chen, M.; Ye, Y.; Ji, G.; Liu, J. Hesperidin upregulates heme oxygenase-1 to attenuate hydrogen peroxide-induced cell damage in hepatic l02 cells. J. Agr. Food Chem. 2010, 58, 3330–3335. [Google Scholar]
- Vasiliou, V.; Ross, D.; Nebert, D.W. Update of the NAD(P)H:quinone oxidoreductase (NQO) gene family. Hum. Genom. 2006, 2, 329–335. [Google Scholar]
- Liu, C.; Hua, K.; Li, K.; Kao, H.; Hong, R.; Ko, J.; Hsiao, M.; Kuo, M.; Tan, C. Histone methyltransferase G9a drives chemotherapy resistance by regulating the Glutamate-Cysteine ligase catalytic subunit in head and neck squamous cell carcinoma. Mol. Cancer Ther. 2017, 16, 1421–1434. [Google Scholar]
- Fitzgerald, R.J.; Cermeño, M.; Khalesi, M.; Kleekayai, T.; Amigo-Benavent, M. Application of in silico approaches for the generation of milk protein-derived bioactive peptides. J. Funct. Foods. 2020, 64, 103636. [Google Scholar]
- Aguilar Toalá, J.E.; Liceaga, A.M. Cellular antioxidant effect of bioactive peptides and molecular mechanisms underlying: Beyond chemical properties. Int. J. Food Sci. Technol. 2021, 56, 2193–2204. [Google Scholar]
- Ali, H.M.; El-Gizawy, A.M.; El-Bassiouny, R.E.; Saleh, M.A. The role of various amino acids in enzymatic browning process in potato tubers, and identifying the browning products. Food Chem. 2016, 192, 879–885. [Google Scholar]
- Wills, R.B.H.; Li, Y. Use of arginine to inhibit browning on fresh cut apple and lettuce. Postharvest Biol. Tec. 2016, 113, 66–68. [Google Scholar]
- Sohail, M.; Wills, R.; Bowyer, M.C.; Pristijono, P. Beneficial impact of exogenous arginine, cysteine and methionine on postharvest senescence of broccoli. Food Chem. 2021, 338, 128055. [Google Scholar]
- Hwang, H.S.; Winkler-Moser, J.K. Antioxidant activity of amino acids in soybean oil at frying temperature: Structural effects and synergism with tocopherols. Food Chem. 2017, 221, 1168–1177. [Google Scholar]
- Marcuse, R. Antioxidative effect of amino-acids. Nature 1960, 186, 886–887. [Google Scholar]
- Liu, W.Y.; Gu, R.Z.; Lin, F.; Lu, J.; Yi, W.X.; Ma, Y.; Dong, Z.; Cai, M.Y. Isolation and identification of antioxidative peptides from pilot-scale black-bone silky fowl (Gallus gallus domesticus Brisson) muscle oligopeptides. J. Sci. Food Agr. 2013, 93, 2782–2788. [Google Scholar]
- Kawashima, K.; Itoh, H.; Miyoshi, M.; Chibata, I. Antioxidant properties of branched-chain amino acid derivatives. Chem. Pharm. Bull. 1979, 27, 1912–1916. [Google Scholar]
- Yan, Q.; Huang, L.; Sun, Q.; Jiang, Z.; Wu, X. Isolation, identification and synthesis of four novel antioxidant peptides from rice residue protein hydrolyzed by multiple proteases. Food Chem. 2015, 179, 290–295. [Google Scholar]
Gene | Gene ID | Primer | Sequences (5′-3′) |
---|---|---|---|
GAPDH | 2597 | Forward | TCCACTGGCGTCTTCACCACCAT |
Reverse | GGAGGCATTGCTGATGATCTTGAGG | ||
Nrf2 | 4780 | Forward | GCTGATGGTACCCTGAGGCTAT |
Reverse | ATGTCCGCAATGGAGGAGAAGTCT | ||
HO-1 | 3162 | Forward | TGCCAGTGCCACCAAGTTCAAG |
Reverse | TGTTGAGCAGGAACGCAGTCTTG | ||
NQO1 | 1728 | Forward | GGAGACAGCCTCTTACTTGCCAAG |
Reverse | CCAGCCGTCAGCTATTGTGGATAC | ||
SOD | 6647 | Forward | TGCAGGTCCTCACTTTAATCCTC |
Reverse | GCCACACCATCTTTGTCAGCA | ||
CAT | 847 | Forward | ACCGTCATGGCTTAATGTTT |
Reverse | GATCTGTTGTGAAATCAGTGC | ||
GCLC | 2729 | Forward | ACAAGAAATATCCGACATAGGAGA |
Reverse | CCATGTAAATATGATCCGGCTT |
Antioxidation Activities | HPM | GSH |
---|---|---|
IC50 of ABTS+ (mg/mL) | 1.09 ± 0.02 | 0.04 ± 0.01 |
IC50 of DPPH (mg/mL) | 3.52 ± 0.13 | 0.08 ± 0.02 |
ORAC (μmol TE /g DW) | 463.91 ± 4.58 | 1118.56 ± 13.72 |
Sequences | PeptideRanker Score | CPPpred Score | Length | Mass (Da) |
---|---|---|---|---|
Arginine–Leucine (RL) | 0.63 | 0.91 | 2 | 287.35 |
Arginine–Glycine–Leucine (RGL) | 0.68 | 0.77 | 3 | 344.40 |
Proline–Arginine (PR) | 0.79 | 0.81 | 2 | 271.31 |
Phenylalanine–Leucine–Lysine–Proline (FLKP) | 0.79 | 0.28 | 4 | 503.63 |
Leucine–Leucine–Arginine (LLR) | 0.52 | 0.88 | 3 | 400.50 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, J.; Wei, M.; You, L. Protective Effect of Peptides from Pinctada Martensii Meat on the H2O2-Induced Oxidative Injured HepG2 Cells. Antioxidants 2023, 12, 535. https://doi.org/10.3390/antiox12020535
Zhou J, Wei M, You L. Protective Effect of Peptides from Pinctada Martensii Meat on the H2O2-Induced Oxidative Injured HepG2 Cells. Antioxidants. 2023; 12(2):535. https://doi.org/10.3390/antiox12020535
Chicago/Turabian StyleZhou, Jie, Mengfen Wei, and Lijun You. 2023. "Protective Effect of Peptides from Pinctada Martensii Meat on the H2O2-Induced Oxidative Injured HepG2 Cells" Antioxidants 12, no. 2: 535. https://doi.org/10.3390/antiox12020535
APA StyleZhou, J., Wei, M., & You, L. (2023). Protective Effect of Peptides from Pinctada Martensii Meat on the H2O2-Induced Oxidative Injured HepG2 Cells. Antioxidants, 12(2), 535. https://doi.org/10.3390/antiox12020535