The Progression Related Gene RAB42 Affects the Prognosis of Glioblastoma Patients
Abstract
:1. Introduction
2. Materials and Methods
2.1. Data Resources
2.2. Clinical Samples Collection
2.3. Survival Analysis
2.4. Differentially Expressed Genes
2.5. GO and KEGG Enrichment Analysis
2.6. Gene Set Enrichment Analysis (GSEA)
2.7. Statistical Analysis
2.8. Cell Culture
2.9. qRT-PCR and Reagents
2.10. Western Blot
2.11. Immunohistochemistry (IHC)
3. Results
3.1. High Expression of RAB42 was Associated with the Development of GBM
3.2. Correlation of RAB42 Expression with the Grade, Gender, Age, and IDH Mutant Status of GBM Patients
3.3. Highly RAB42 Expressed GBM Patients Had Worse Prognosis
3.4. Functional Enrichment Results between High and Low RAB42 Expression GBM Samples
3.5. RAB42 Expression in GBM Cell Lines and Clinical Samples
3.6. GSEA Results Based on RAB42 Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Touat, M.; Idbaih, A.; Sanson, M.; Ligon, K.L. Glioblastoma targeted therapy: Updated approaches from recent biological insights. Ann. Oncol. 2017, 28, 1457–1472. [Google Scholar] [CrossRef] [PubMed]
- Le Rhun, E.; Preusser, M.; Roth, P.; Reardon, D.A.; van den Bent, M.; Wen, P.; Reifenberger, G.; Weller, M. Molecular targeted therapy of glioblastoma. Cancer Treat Rev. 2019, 80, 101896. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.W.; Wang, X.; Yang, Y.; Mao, Q. Role of micro-RNA (miRNA) in pathogenesis of glioblastoma. Eur. Rev. Med. Pharmacol. Sci. 2015, 19, 1630–1639. [Google Scholar] [PubMed]
- Stupp, R.; Mason, W.P.; van den Bent, M.J.; Weller, M.; Fisher, B.; Taphoorn, M.J.; Belanger, K.; Brandes, A.A.; Marosi, C.; Bogdahn, U.; et al. Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N. Engl. J. Med. 2005, 352, 987–996. [Google Scholar] [CrossRef]
- Ronning, P.A.; Helseth, E.; Meling, T.R.; Johannesen, T.B. A population-based study on the effect of temozolomide in the treatment of glioblastoma multiforme. Neuro Oncol. 2012, 14, 1178–1184. [Google Scholar] [CrossRef] [Green Version]
- Stupp, R.; Taillibert, S.; Kanner, A.A.; Kesari, S.; Steinberg, D.M.; Toms, S.A.; Taylor, L.P.; Lieberman, F.; Silvani, A.; Fink, K.L.; et al. Maintenance Therapy with Tumor-Treating Fields Plus Temozolomide vs Temozolomide Alone for Glioblastoma: A Randomized Clinical Trial. JAMA 2015, 314, 2535–2543. [Google Scholar] [CrossRef]
- Yap, T.A.; Gerlinger, M.; Futreal, P.A.; Pusztai, L.; Swanton, C. Intratumor heterogeneity: Seeing the wood for the trees. Sci. Transl. Med. 2012, 4, 127ps110. [Google Scholar] [CrossRef] [Green Version]
- Burrell, R.A.; McGranahan, N.; Bartek, J.; Swanton, C. The causes and consequences of genetic heterogeneity in cancer evolution. Nature 2013, 501, 338–345. [Google Scholar] [CrossRef]
- McGranahan, N.; Favero, F.; de Bruin, E.C.; Birkbak, N.J.; Szallasi, Z.; Swanton, C. Clonal status of actionable driver events and the timing of mutational processes in cancer evolution. Sci. Transl. Med. 2015, 7, 283ra254. [Google Scholar] [CrossRef] [Green Version]
- Szopa, W.; Burley, T.A.; Kramer-Marek, G.; Kaspera, W. Diagnostic and Therapeutic Biomarkers in Glioblastoma: Current Status and Future Perspectives. Biomed. Res. Int. 2017, 2017, 8013575. [Google Scholar] [CrossRef] [Green Version]
- Stuplich, M.; Hadizadeh, D.R.; Kuchelmeister, K.; Scorzin, J.; Filss, C.; Langen, K.J.; Schafer, N.; Mack, F.; Schuller, H.; Simon, M.; et al. Late and prolonged pseudoprogression in glioblastoma after treatment with lomustine and temozolomide. J. Clin. Oncol. 2012, 30, e180–e183. [Google Scholar] [CrossRef] [PubMed]
- Hou, S.X.; Ding, B.J.; Li, H.Z.; Wang, L.; Xia, F.; Du, F.; Liu, L.J.; Liu, Y.H.; Liu, X.D.; Jia, J.F.; et al. Identification of microRNA-205 as a potential prognostic indicator for human glioma. J. Clin. Neurosci. 2013, 20, 933–937. [Google Scholar] [CrossRef] [PubMed]
- Colicelli, J. Human RAS superfamily proteins and related GTPases. Sci. STKE 2004, 2004, RE13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pereira-Leal, J.B.; Seabra, M.C. Evolution of the Rab family of small GTP-binding proteins. J. Mol. Biol. 2001, 313, 889–901. [Google Scholar] [CrossRef] [Green Version]
- Li, G. Rab GTPases, membrane trafficking and diseases. Curr. Drug Targets 2011, 12, 1188–1193. [Google Scholar] [CrossRef] [Green Version]
- Wasmeier, C.; Romao, M.; Plowright, L.; Bennett, D.C.; Raposo, G.; Seabra, M.C. Rab38 and Rab32 control post-Golgi trafficking of melanogenic enzymes. J. Cell Biol. 2006, 175, 271–281. [Google Scholar] [CrossRef] [Green Version]
- Giannandrea, M.; Bianchi, V.; Mignogna, M.L.; Sirri, A.; Carrabino, S.; D’Elia, E.; Vecellio, M.; Russo, S.; Cogliati, F.; Larizza, L.; et al. Mutations in the small GTPase gene RAB39B are responsible for X-linked mental retardation associated with autism, epilepsy, and macrocephaly. Am. J. Hum. Genet. 2010, 86, 185–195. [Google Scholar] [CrossRef] [Green Version]
- Ge, J.; Chen, Q.; Liu, B.; Wang, L.; Zhang, S.; Ji, B. Knockdown of Rab21 inhibits proliferation and induces apoptosis in human glioma cells. Cell Mol. Biol. Lett. 2017, 22, 30. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.J.; Gao, Y.; Chen, L.; Li, Y.L.; Jiang, C.L. RAB34 was a progression- and prognosis-associated biomarker in gliomas. Tumour. Biol. 2015, 36, 1573–1578. [Google Scholar] [CrossRef]
- Chen, T.W.; Yin, F.F.; Yuan, Y.M.; Guan, D.X.; Zhang, E.; Zhang, F.K.; Jiang, H.; Ma, N.; Wang, J.J.; Ni, Q.Z.; et al. CHML promotes liver cancer metastasis by facilitating Rab14 recycle. Nat. Commun. 2019, 10, 2510. [Google Scholar] [CrossRef] [Green Version]
- Wu, X.; Hu, A.; Zhang, M.; Chen, Z. Effects of Rab27a on proliferation, invasion, and anti-apoptosis in human glioma cell. Tumour. Biol. 2013, 34, 2195–2203. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.H.; Zhong, Q.Y.; Gou, X.X.; Fan, E.X.; Shuai, Y.; Wu, M.N.; Yue, G.J. Seven genes for the prognostic prediction in patients with glioma. Clin. Transl. Oncol. 2019, 21, 1327–1335. [Google Scholar] [CrossRef] [PubMed]
- Kohnke, M.; Delon, C.; Hastie, M.L.; Nguyen, U.T.; Wu, Y.W.; Waldmann, H.; Goody, R.S.; Gorman, J.J.; Alexandrov, K. Rab GTPase prenylation hierarchy and its potential role in choroideremia disease. PLoS ONE 2013, 8, e81758. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Marubashi, S.; Fukuda, M. Rab7B/42 Is Functionally Involved in Protein Degradation on Melanosomes in Keratinocytes. Cell Struct. Funct. 2020, 45, 45–55. [Google Scholar] [CrossRef] [Green Version]
- Ritchie, M.E.; Phipson, B.; Wu, D.; Hu, Y.; Law, C.W.; Shi, W.; Smyth, G.K. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015, 43, e47. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. clusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Tao, W.; Zhang, A.; Zhai, K.; Huang, Z.; Huang, H.; Zhou, W.; Huang, Q.; Fang, X.; Prager, B.C.; Wang, X.; et al. SATB2 drives glioblastoma growth by recruiting CBP to promote FOXM1 expression in glioma stem cells. EMBO Mol. Med. 2020, 12, e12291. [Google Scholar] [CrossRef]
- Xu, L.; Liu, X.; Peng, F.; Zhang, W.; Zheng, L.; Ding, Y.; Gu, T.; Lv, K.; Wang, J.; Ortinau, L.; et al. Protein quality control through endoplasmic reticulum-associated degradation maintains haematopoietic stem cell identity and niche interactions. Nat. Cell Biol. 2020, 22, 1162–1169. [Google Scholar] [CrossRef]
- Uhlen, M.; Bandrowski, A.; Carr, S.; Edwards, A.; Ellenberg, J.; Lundberg, E.; Rimm, D.L.; Rodriguez, H.; Hiltke, T.; Snyder, M.; et al. A proposal for validation of antibodies. Nat. Methods 2016, 13, 823–827. [Google Scholar] [CrossRef]
- Liu, C.; Gao, H.; Cao, L.; Gui, S.; Liu, Q.; Li, C.; Li, D.; Gong, L.; Zhang, Y. The role of FSCN1 in migration and invasion of pituitary adenomas. Mol Cell Endocrinol 2016, 419, 217–224. [Google Scholar] [CrossRef]
- Li, G.; Marlin, M.C. Rab family of GTPases. Methods Mol Biol 2015, 1298, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kiral, F.R.; Kohrs, F.E.; Jin, E.J.; Hiesinger, P.R. Rab GTPases and Membrane Trafficking in Neurodegeneration. Curr. Biol. 2018, 28, R471–R486. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ding, B.; Cui, B.; Gao, M.; Li, Z.; Xu, C.; Fan, S.; He, W. Knockdown of Ras-Related Protein 25 (Rab25) Inhibits the In Vitro Cytotoxicity and In Vivo Antitumor Activity of Human Glioblastoma Multiforme Cells. Oncol. Res. 2017, 25, 331–340. [Google Scholar] [CrossRef] [PubMed]
- Han, M.Z.; Huang, B.; Chen, A.J.; Zhang, X.; Xu, R.; Wang, J.; Li, X.G. High expression of RAB43 predicts poor prognosis and is associated with epithelial-mesenchymal transition in gliomas. Oncol. Rep. 2017, 37, 903–912. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wirsching, H.G.; Galanis, E.; Weller, M. Glioblastoma. Handb. Clin. Neurol. 2016, 134, 381–397. [Google Scholar] [CrossRef] [PubMed]
- Pasquini, L.; Napolitano, A.; Tagliente, E.; Dellepiane, F.; Lucignani, M.; Vidiri, A.; Ranazzi, G.; Stoppacciaro, A.; Moltoni, G.; Nicolai, M.; et al. Deep Learning Can Differentiate IDH-Mutant from IDH-Wild GBM. J. Pers Med. 2021, 11. [Google Scholar] [CrossRef] [PubMed]
- Han, S.; Liu, Y.; Cai, S.J.; Qian, M.; Ding, J.; Larion, M.; Gilbert, M.R.; Yang, C. IDH mutation in glioma: Molecular mechanisms and potential therapeutic targets. Br. J. Cancer 2020, 122, 1580–1589. [Google Scholar] [CrossRef]
- Louis, D.N.; Perry, A.; Reifenberger, G.; von Deimling, A.; Figarella-Branger, D.; Cavenee, W.K.; Ohgaki, H.; Wiestler, O.D.; Kleihues, P.; Ellison, D.W. The 2016 World Health Organization Classification of Tumors of the Central Nervous System: A summary. Acta Neuropathol. 2016, 131, 803–820. [Google Scholar] [CrossRef] [Green Version]
- Wang, H.; Jiang, C. RAB38 confers a poor prognosis, associated with malignant progression and subtype preference in glioma. Oncol. Rep. 2013, 30, 2350–2356. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Dube, C.; Gibert, M., Jr.; Cruickshanks, N.; Wang, B.; Coughlan, M.; Yang, Y.; Setiady, I.; Deveau, C.; Saoud, K.; et al. The p53 Pathway in Glioblastoma. Cancers 2018, 10, 297. [Google Scholar] [CrossRef] [Green Version]
- Cancer Genome Atlas Research, N. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 2008, 455, 1061–1068. [Google Scholar] [CrossRef] [PubMed]
- Brennan, C.W.; Verhaak, R.G.; McKenna, A.; Campos, B.; Noushmehr, H.; Salama, S.R.; Zheng, S.; Chakravarty, D.; Sanborn, J.Z.; Berman, S.H.; et al. The somatic genomic landscape of glioblastoma. Cell 2013, 155, 462–477. [Google Scholar] [CrossRef] [PubMed]
Characteristics | Patients (n = 160) | ||
---|---|---|---|
NO. | % | ||
Sex | Female | 56 | 35.00% |
Male | 104 | 65.00% | |
Age | ≤60 (Median) | 82 | 51.25% |
>60 (Median) | 78 | 48.75% | |
Race | White | 143 | 89.38% |
Black or African American | 11 | 6.88% | |
Asian | 5 | 3.13% | |
Unknown | 1 | 0.63% | |
Survival Time | Long (>5 years) | 2 | 1.25% |
Short (<5 years) | 158 | 98.75% | |
OS status | Dead | 131 | 81.88% |
Alive | 29 | 18.13% |
Characteristics | RAB42 | X-Squared | p-Value | ||
---|---|---|---|---|---|
High | Low | ||||
Age | / | 45.7 ± 12.5 | 39.6 ± 10.2 | 0.43623 | 0.509 |
Sex | Female | 50 | 67 | 3.1994 | 0.07367 |
Male | 88 | 74 | |||
Grade | II | 23 | 82 | 56.14 | 6.45 × 10 −13 |
III | 27 | 24 | |||
IV | 88 | 35 | |||
IDH | Wild | 99 | 53 | 31.435 | 2.06 × 10 −8 |
Mutation | 39 | 88 |
Genes | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Product Length (bp) | Tm (℃) |
---|---|---|---|---|
β-actin | CCTGGCACCCAGCACAAT | GGGCCGGACTCGTCATAC | 144 | 60 |
RAB42 | GGGTCATCATTAGCCCCCTT | GACCGAGTGGAAACTCCTGG | 82 | 60 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, L.; Yan, T.; Yang, B. The Progression Related Gene RAB42 Affects the Prognosis of Glioblastoma Patients. Brain Sci. 2022, 12, 767. https://doi.org/10.3390/brainsci12060767
Sun L, Yan T, Yang B. The Progression Related Gene RAB42 Affects the Prognosis of Glioblastoma Patients. Brain Sciences. 2022; 12(6):767. https://doi.org/10.3390/brainsci12060767
Chicago/Turabian StyleSun, Liwei, Tao Yan, and Bing Yang. 2022. "The Progression Related Gene RAB42 Affects the Prognosis of Glioblastoma Patients" Brain Sciences 12, no. 6: 767. https://doi.org/10.3390/brainsci12060767
APA StyleSun, L., Yan, T., & Yang, B. (2022). The Progression Related Gene RAB42 Affects the Prognosis of Glioblastoma Patients. Brain Sciences, 12(6), 767. https://doi.org/10.3390/brainsci12060767