Abstract
Data storage on DNA has emerged as a molecular approach to safeguarding digital information. Microarrays are an excellent source of complex DNA sequence libraries and are playing a central role in the development of this technology. However, the amount of DNA recovered from microarrays is often too small, and a PCR amplification step is usually required. Primer information can be conveyed alongside the DNA library itself in the form of readable barcodes made of DNA on the array surface. Here, we present a synthetic method to pattern QR and data matrix barcodes using DNA photolithography, phosphoramidite chemistry and fluorescent labeling. Patterning and DNA library synthesis occur simultaneously and on the same surface. We manipulate the chemical composition of the barcodes to make them indelible, erasable or hidden, and a simple chemical treatment under basic conditions can reveal or degrade the pattern. In doing so, information crucial to retrieval and amplification can be made available by the user at the appropriate stage. The code and its data contained within are intimately linked to the library as they are synthesized simultaneously and on the same surface. This process is, in principle, applicable to any in situ microarray synthesis method, for instance, inkjet or electrochemical DNA synthesis.
1. Introduction
Data storage on DNA is an attractive alternative to storing digital information on conventional physical storage media [1,2,3]. The driving forces behind the advent of molecular data storage are better understood from the perspective of the hard limitations of current storage approaches. First, the extreme stability of deoxyribonucleic acids, with a purported t½ half-life of 30 million years at 25 °C for a single phosphodiester bond [4], dwarfs that of any manufactured product for the storage of data. Second, reading data on DNA simply equates to sequencing, and any sequencing technology in the past, present or future will read data on DNA, which is in stark contrast to the often obsolete hardware necessary to retrieve data on older storage formats. Finally, the physical density of data on DNA is at the very least seven orders of magnitude greater than that of standard technologies [5,6]. Current research in the field focuses on increasing writing (synthesis) throughput, decreasing production costs and expanding storage capacity [7]. The production of DNA for the purpose of data storage relies on synthetic DNA oligomers, most commonly obtained using solid-phase phosphoramidite chemistry. DNA phosphoramidites are reactive nucleotide building blocks that are sequentially added onto a growing oligonucleotide strand [8].
Concomitant to being able to produce larger amounts of DNA and thus larger file sizes, the question of accessing only a fraction of the available data arises as it quickly becomes cumbersome to sequence a complete DNA pool [2]. Approaches to alleviate this issue have aimed at designing specific sets of primers that would be able to amplify only the desired subset of the DNA library [9,10,11,12,13]. In doing so, a fraction of the data can be accessed by knowing its address, i.e., the primer binding region. This method for random access to data assumes that the end-user has been given the keys to subpool amplification, that is, the set of primers necessary to retrieve the requested information. While this information can eventually be collected without any PCR enrichment via highly sensitive, single-molecule, third-generation sequencing methodologies, this defeats the purpose of partial data access. Primer sequence information may be, at the simplest level, available as cleartext to the user. Sensitive information should, on the other hand, ideally be retrievable under controlled conditions and on a need-to-know basis. Data security at the molecular stage has received little attention so far, possibly due to the limited accessibility of nucleic acid sequencers and the high level of required know-how necessary to operate and manipulate sequencing readouts. This situation is inevitably going to change with the development of affordable portable sequencers [9,14], with sequencing costs continuing to massively decrease and bioinformatics training becoming continuously more widespread. Attempts at providing secure information in DNA format have mostly focused on safeguarding data behind sequence or molecular locks [15,16,17] that need to be provided by the intended user. Messages hidden within DNA also constitute a relatively secure form of information transmission; an early example of such steganography approaches applied to biomolecules needed a known PCR primer to retrieve the concealed message [18]. Barcoding is another useful security measure as it provides a means of tracing and tracking the source of the material and therefore renders falsification more difficult. A DNA tag, i.e., the insertion of a known DNA sample within manufactured goods, is a simple way to create a molecular fingerprint that helps in controlling the production chain, makes any counterfeiting process cumbersome and expensive and, simultaneously, can add identity to the product [19,20,21,22]. Two-dimensional barcodes like the Universal Product Code (UPC), Quick Response (QR) and Radio-Frequency Identification (RFID) codes, ubiquitous in consumer products, offer a convenient solution to track, identify and authenticate products. Such 2D barcodes are certainly applicable to DNA samples by simply tagging the container, but this is equivalent to a permanent watermark. To create a chemical 2D signature with flexible usage requires access to equipment for both chemical synthesis and patterning. Microarray synthesis fulfills both criteria as it delivers synthetic DNA oligonucleotides and is therefore an important source of DNA material for data storage purposes, and the fabrication process takes place on a flat surface. In other words, this process operates on two-dimensional space and controls the assignment of DNA sequences. DNA patterning that produces visuals has been used in the context of watermarking, steganography and image reproduction [23,24,25,26,27,28,29]. Here, we show a DNA patterning method, producing barcodes that can be read with conventional scanning tools. The barcodes are composed of fluorescently marked DNA, and the marking occurs during the synthesis of the array and the DNA library by covalently attaching a fluorescent dye to the 5′ end of the sequence. Scanning reveals information about the primers necessary for library amplification. The chemical barcodes can be made permanent, erasable or to materialize at the right moment, adding a layer of control and security to the coded information.
2. Materials and Methods
2.1. Material, Reagents and Consumables
Phosphoramidite activators for DNA synthesis (0.25 M dicyanoimidazole in acetonitrile (L003080) and 0.25 M 5-(ethylthio)-1H-tetrazole) were purchased from Sigma Aldrich (St. Louis, MO, USA). The oxidizers used were 0.5 M CSO in ACN (Eurogentec 40-4632-52E, Seraing, Belgium) and 0.02 M I2 in tetrahydrofuran/pyridine/H2O 90:9:0.4 (Sigma L020000). Photosensitive DNA (5′-BzNPPOC) and RNA (5′-NPPOC 2′-O-ALE) phosphoramidites were obtained from Orgentis (Gatersleben, Germany) and ChemGenes (Wilmington, MA, USA), respectively. A base-labile dT phosphoramidite, either 5′-NPPOC or 5′-DMTr protected and employed for oligonucleotide cleavage from the surface, was purchased from ChemGenes. To remove the DMTr group, 3% trichloroacetic acid in dichloromethane (Sigma L020000) was used. In addition, 1% (w/v) imidazole in DMSO (Sigma, 56750 and 276855) was utilized as the exposure solvent to deprotect the 5′-BzNPPOC and 5′-NPPOC during illumination under 365 nm UV light emanating from a high-power UV-LED (Nichia NVSU333A, Anan, Japan). Nucleic acid microarray synthesis was conducted directly on glass microscope slides (Schott Nexterion D, Mainz, Germany), which were silane-functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide (Gelest SIT8189.5, Morrisville, PA, USA). For the deprotection and cleavage of oligonucleotide libraries, microarray slides were immersed in a 1:1 mixture of ethylenediamine (EDA, Sigma 03550) and toluene (Sigma 244511). Dry acetonitrile (<30 ppm of H2O) (L010000) and molecular trap packs (Z509000, Z509027) were purchased from Sigma-Aldrich. Cyanine 3 (Cy3) phosphoramidite was purchased from Biosearch Technologies (Hoddesdon, UK). Monarch PCR & DNA Cleanup Kit (5 μg) (T1030S), Q5 High-Fidelity 2X Master Mix (M0492S) and 50 bp DNA Ladder (N3236S) were purchased from New England Biolabs (Ipswitch, MA, USA). SYBR Gold Nucleic Acid Gel Stain (S11494) was obtained from Thermo Fisher Scientific (Waltham, MA, USA).
2.2. Barcode Design
Sequence information on the primer binding region, written in the form
- “5′p TATGGACTCCGAATGAAG
- 3′p GTATCAGAATAGATTGTA”
was fed into online barcode generators outputting QR or data matrix PNG files of 150 × 150 pixel resolution. QR codes were chosen with level Q data redundancy, allowing for 25% damage to the QR pattern before the information can no longer be recovered. The synthesis area of the microarray can accommodate up to 786 432 features, which corresponds to the resolution of the DMD (1024 × 768 or XGA resolution; see below). An area of 600 pixels wide × 150 pixels high was sectioned off on the addressable surface and reserved for watermarking with up to four adjacent barcodes. The remaining synthesizable region was used to synthesize the actual DNA library. To address four barcodes separately and populate each with a designated set of DNA sequences, the synthesis area was split into five subtemplates: Barcodes #1–4 and the library. Each subtemplate consisted of the barcode itself as black and white pixels, while the rest of the area was colored in gray. Conversely, the library subtemplate had white pixels for the synthesis of the actual DNA library and gray pixels for the barcoding zone. A custom script converted the subtemplate into a spreadsheet, where each x, y coordinate of the 1024 × 768 file was assigned a sequence to synthesize based on pixel intensity. Typically, white pixels in the barcode (255, 255, 255) corresponded to Cy3-labeled oligonucleotides, black pixels in the barcode (0, 0, 0) corresponded to non-labeled versions, and any gray color was understood as no synthesis and left blank. The converted spreadsheets for all five subtemplates were then concatenated into one, where every blank was populated with a sequence to synthesize. The concatenated list arranges all sequences to be synthesized as a function of x, y coordinates, starting from coordinates 0, 0 and ending with coordinates 1024, 768. A MATLAB (MathWorks R2023b) script then generates digital masks based on this list of synthesis instructions. At this conversion stage, the randomization of the sequence distribution across the array is turned off to preserve the barcoding pattern.
2.3. Microarray Photolithography
From a chemical point of view, the principle of nucleic acid microarray photolithographic synthesis according to the maskless array synthesis (MAS) method closely follows traditional solid-phase synthesis. This is a cycle-based method, beginning with 5′-photodeprotection, followed by phosphoramidite coupling and phosphite triester oxidation. Unlike solid-phase synthesis, instead of using acid-labile protecting groups, MAS requires photosensitive groups (Bz-NPPOC or NPPOC) at the 5′-OH position. Photolithography employs patterned UV light from digitally controlled micromirrors (Digital Micromirror Device (DMD), 0.7″ XGA, Texas Instruments, Dallas, TX, USA) to control oligonucleotide growth at precise locations on the surface of the array. Depending on whether the micromirrors were chosen to tilt into an ON or OFF position, UV light produced by the LED and reflecting off ON mirrors exposed the corresponding area of the synthesis surface. The ON/OFF positions of the micromirrors were determined by feeding the DMD 1-bit bitmap files (“digital masks”) composed of white and black pixels, which were generated using a custom-built script on MATLAB. The MAS setup has a diffraction-limited resolution of 2.4 μm at 365 nm. A fully automated DNA synthesizer (Expedite 8909, PerSeptive Biosystems, Waltham, MA, USA) was used to deliver solvents and reagents to the reaction cell, which consisted of two superimposed microscope glass slides precisely positioned over a quartz block at the focal plane of UV illumination. During the photodeprotection stage, the reaction cell was immersed in the exposure solvent, and an appropriate amount of radiant exposure was directly reflected onto the surface, ensuring that both slides were exposed to UV simultaneously. For Bz-NPPOC groups, this corresponded to a radiant power of 3 J/cm2 and 6 J/cm2 for standard NPPOC groups [30]. The subsequent coupling reaction proceeded with the phosphoramidites that had undergone photodeprotection of their 5′ OH groups. Coupling is routinely performed for 15 s using a 30 mM solution of phosphoramidite in ACN. Exceptions were made for the base-cleavable phosphoramidite [120 s + 50 mM] and the Cy3 label [300 s + 50 mM]. Although limited overall, most synthetic errors introduced during the photolithography process are due to incomplete coupling or incomplete photodeprotection. Terminal 5′ labeling was carried out at the end of synthesis with the fluorescent Cy3 phosphoramidite. Fluorescently labeled microarrays were thoroughly washed in ACN immediately after synthesis to remove unbound Cy3 before proceeding with deprotection.
2.4. Microarray Deprotection, Scanning and Data Analysis
The slides were immersed in a 1:1 dry EDA/toluene solution for 2 h or overnight at room temperature in a shaker to remove all protecting groups on the nucleobase and phosphodiester bonds, as well as to cleave all cleavable features from the surface. Afterwards, the arrays were washed twice with dry ACN, dried in a microarray centrifuge (VWR, Radnor, PA, USA) and finally washed with final wash buffer (0.1× sodium saline citrate) for 10 s and dried again. Microarrays were then scanned on a GenePix 4100A microarray scanner (Molecular Devices, San Jose, CA, USA) at 5 μm resolution with 532 nm laser excitation. Data extraction from scanned TIF images was carried out using NimbleScan 2.1 (NimbleGen, Pleasanton, CA, USA).
2.5. Library Recovery and PCR Amplification
To cleave the DNA from the surface, a custom-made NPPOC-protected dT phosphoramidite with a succinyl group separating the 3′O from the amidite function was attached to the 3′ end of the sequence. After deprotection in EDA/toluene, the array was washed twice with 2 × 30 mL dry ACN. The DNA was then recovered using 100 μL of nuclease-free water. To concentrate the retrieved library, the sample was dried at 45 °C using a SpeedVac concentrator (Eppendorf, Hamburg, Germany). Once completely dried, the DNA was resuspended in 10 μL of nuclease-free water. The concentration of the nucleic acid libraries was determined using a NanoDrop UV-Vis Spectrophotometer (Thermo Scientific, Waltham, MA, USA).
2.6. PCR Amplification and Agarose Gel Electrophoresis
To prepare the amplified extended DNA library, 3 pmol of the cleaved DNA was mixed with primer P1 (5′p AAGGGCGTATTGTATGGACTCCGAATGAAG, 10 μM, 2.5 μL), primer P2 (3′p CAAATCGAGTAGGTATCAGAATAGATTGTA, 10 μM, 2.5 μL), Q5 Master Mix (2×, 25 μL), and nuclease-free water (19.5 μL). The mixture was initially heated at 98 °C for 30 s, followed by 30 cycles of 98 °C for 10 s, 60 °C for 30 s, and 72 °C for 30 s. The final extension step was carried out at 72 °C for 5 min. The resulting PCR product was purified using the Monarch PCR & DNA Cleanup Kit (5 μg). To analyze the length of the DNA, agarose gel electrophoresis was performed. A 2% (w/v) agarose gel was prepared in 1× TBE buffer (0.13 M Tris, pH 7.6, 45 mM boric acid, 2.5 mM EDTA) and heated in a microwave until fully dissolved. The gel solution was cooled to approximately 60 °C and poured into a casting tray with a comb. After solidification at room temperature, the DNA Ladder (50 bp, NEB) and DNA samples, pre-mixed with 6× loading dye, were loaded into the gel. Electrophoresis was run at 35 V for 10 min, 70 V for 1 h, and 90 V for 30 min. Post-electrophoresis, the gel was stained in 1× SYBR Gold solution in TBE buffer for 30 min and visualized using a Fusion-FX7 scanner (Vilber, Marne-la-Vallée, France).
3. Results
3.1. Array Design, Principles and Synthesis
The basic principle behind the design of a barcoded array is shown in Figure 1. The synthesizable area of a glass slide is first divided into two sections, one for the barcodes and one for the actual sequence library. The barcode area was a strip of ~150 × 768 pixels within a total area of 1024 × 768 pixels, representing ~15% of the synthesizable surface. The strip was chosen to host up to four different barcodes and test various barcoding strategies simultaneously while retaining sufficient space to synthesize a DNA library (Figure 1A). In reality, only a single barcode per array is necessary, which takes up a maximum of 150 × 150 pixels, or <3% of the total synthesis area. The DNA library consists of a 97mer sequence terminated with a 5′ Cy3 dye and contains both forward and reverse primer binding regions embedded in the sequence (Figure 1B). Scanning the barcode in the barcode area reveals information on the primers to use and, therefore, on how to retrieve and amplify the DNA material recovered from the array (Figure 1C).
Figure 1.
(A) Microarray subdivision of the addressable area into areas for library synthesis and for barcode synthesis. The barcode area is a strip of ~150 × 768 pixels, or ~2.1 × 10.7 mm2 given the size of a single addressable unit (14 × 14 μm2), and contains up to four DNA barcodes (QR codes or data matrix). (B) The DNA library synthesized in the library area is a 97mer with both forward and reverse primers (in italic) synthesized along with the insert. A Cy3 dye terminates the strand at the 5′ end. (C) An example of a minimal, digitally created QR code delivering primer sequence information upon scanning and thus allowing for the amplification of the synthesized DNA.
The design and synthesis process of such a barcoded microarray is schematized in Figure 2. Two lists of DNA sequences, one for the DNA pool and one for the barcode strip, are used to populate the synthesis area (Figure 2A). A computer script assigns a position to each sequence and aims to recreate the digital barcode in scannable DNA format. Another script then transforms the sequence and location information into a series of instructions that allows for DNA synthesis in parallel using photolithography. The principle of DNA array photolithography has been described elsewhere [31], but briefly, for parallel DNA synthesis to occur, a photochemical reaction takes places only on the positions that are intended to receive the next nucleotide. This photochemical reaction removes a 5′ photoprotecting group, releasing 5′-OH that can react with the next base in the form of DNA phosphoramidite. The selective illumination of the desired locations on the surface of the array employs micromirrors that can reflect light (here, 365 nm UV light) onto or away from the surface. Our current photolithography setup is equipped with an array of 1024 × 768 such micromirrors, 14 μm in size, making a single micromirror the equivalent of a synthesizable pixel. DNA photolithography was carried out in order to prepare the DNA library and the DNA barcodes at the same time. Standard photoprotected DNA phosphoramidites (Figure 2B) were used to grow DNA oligonucleotides. To cleave the DNA library and to effect a loss of Cy3 fluorescence in the barcode area, cleavable oligonucleotides were synthesized atop a succinyl-dT unit, while fluorescent tagging employed a Cy3 phosphoramidite as the last coupling step.
Figure 2.
Photolithographic process of barcoded microarray synthesis. (A) Two separate lists of DNA sequences are used to populate the two specified areas of microarray synthesis, one for the DNA pool and one for the barcode strip. The DNA sequences and their Cartesian coordinates serve to create a series of instructions for parallel DNA synthesis using photolithography, yielding a fluorescently labeled DNA microarray. (B) Toolbox of phosphoramidites employed in the synthesis of barcoded DNA arrays: standard photoprotected (benzyl-nitrophenylpropyloxycarbonyl, Bz-NPPOC) DNA phosphoramidites (top) and base-cleavable succinyl-dT and Cy3 phosphoramidites (bottom).
3.2. Barcode Design and Manipulation
We designed three types of DNA-based QR codes that respond differently based on the chemical input (Figure 3). These are labeled “persist”, “appear” and “fade” (Figure 3A). The chemical compositions of the black and white pixels of the barcode are shown below for each of the three QR types. The “persist” QR is a permanent barcode whose black and white pixels are composed of non-cleavable DNA, i.e., a sequence synthesized over a standard dT5 linker. White pixels receive an additional Cy3 tag at the 5′ end (Figure 3C). Such a persisting QR code is visible immediately after microarray synthesis and remains visible during and after the chemical treatment. The “appear” QR is a fully Cy3-labeled code, but the black pixel DNA is synthesized over a base-cleavable dT monomer. After microarray synthesis, the DNA is deprotected under basic conditions, typically using ethylenediamine (EDA). This EDA treatment reacts with the 3′-O ester functionality of the cleavable unit, detaching the DNA from the surface (Figure 3B). This process leads to fluorescence loss on the “appear” black pixels but also serves to retrieve the DNA library from the surface of the array [32]. This QR code is therefore expected to produce a large, fluorescent, featureless square after synthesis and to only reveal itself after EDA treatment. The “fade” QR is an evanescent code, visible after synthesis but disappearing after deprotection. To achieve this, white pixels are Cy3-labeled and black pixels are left unlabeled. Additionally, DNA synthesized on the white pixels of the code contains the base-cleavable dT, leading to the detachment of the DNA and therefore a loss of fluorescence after EDA treatment.
Figure 3.
Chemical design of the “persist”, “appear” and “fade” QR codes. (A) Expected behavior of the three barcode types after synthesis (top) and after DNA deprotection (bottom). (B) The outcome of the EDA treatment, besides the removal of all protecting groups, was the hydrolysis of the ester functionality, which released all cleavable DNA from the surface. This allowed for the library to be retrieved as well as for fluorescence to massively decrease on all cleavable spots. (C) Schematic representation of the chemical composition of black and white pixels for all three QR types. The hollow black square represents the cleavable dT unit, and the tag is the fluorescent Cy3 marker.
We also designed a data matrix barcode as an example of a non-QR 2D pattern. Primer information was encoded in a small 142 × 142 pixel data matrix (Figure S1), and a “persist” formula was chosen for this alternative barcode.
We then synthesized the corresponding DNA microarray, containing an amplifiable, cleavable 97mer, and a barcode strip, including all three QR types and a data matrix. Immediately after synthesis (pre-treatment), the array was scanned for Cy3 fluorescence. In the pre-treatment stage, with every DNA molecule attached to the surface and still carrying protecting groups, the QR codes behave as expected (Figure 4A). The “persist” QR is already visible and scannable, and so is the “fade” QR. The “appear” QR is invisible at this stage and instead shows up as a large fluorescent square with homogenous signal distribution. The contrast between labeled and non-labeled areas is only 3:1, which is far below that of hybridization assays with labeled complementary strands (1000:1), but this is due to the non-specific binding of the Cy3 molecule to the surface of the array as well as to the DNA and DNA-linker itself [33,34,35]. After treatment with EDA, the DNA library was retrieved, and the barcode strip was scanned again for Cy3 fluorescence (Figure 4B). The “persist” barcode was left untouched and remained scannable. The “appear” barcode materialized upon cleaving the labeled DNA in the black pixels and could then return primer information. Conversely, the “fade” barcode disappeared due to fluorescence loss at the level of the white pixels. The persistent data matrix also functioned properly, returning a usable 2D pattern before and after DNA deprotection (Figure S2).
Figure 4.
Scanned fluorescent DNA QR codes before (A) and after (B) EDA treatment. The EDA step removes the protecting groups on DNA and cleaves the oligonucleotides wherever a succinyl-dT was inserted. The “persist” code only contains non-cleavable DNA, the “appear” code contains cleavable DNA in the black pixels of the QR code and the “fade” code is cleavable at the labeled pixels only. Scanning was performed in a microarray scanner at a 532 nm excitation wavelength and 2.5 μm resolution. The scale bar is ~100 μm.
However, upon closer inspection and by slightly increasing the brightness and contrast settings of the scanned image, the “fade” barcode re-emerges. We find that the white cleavable pixels are still about twice as bright as the black non-labeled pixels (Figure 5). Actually, the leftover signal on the white pixels of the “fade” code matches that of the leftover background signal in the DNA library section. Because the black pixels in the “fade” QR are non-labeled (Figure 3C) and appear to provide an even lower signal, we estimate that the remaining Cy3 dye on the labeled areas is not due to non-specific binding to the surface but, rather, is covalently attached to the DNA. We first investigated whether the cleavage time in EDA was too short, and a small amount of cleavable material was left over the surface of the array. Increasing the cleavage in EDA from the usual 2 h to 16 h did decrease the signal/noise ratio from 2:1 to 1.3:1, indicating further cleavage taking place wherever the succinyl-dT was inserted, but it still left behind a recognizable QR code. Further EDA treatment for a total of 72 h did not shift the signal/noise towards an ideal 1:1. The recorded fluorescence signal in the labeled areas decreased homogenously across the surface, from an average of ~1500 (arbitrary units) after 2 h of EDA down to an average of ~450 a.u., suggesting global degradation of the surface rather than an increase in cleavage efficiency. This leftover fluorescence implies that a certain number of labeled strands are non-cleavable. This could be due to either incomplete coupling of the succinyl-dT or oligonucleotide growth outside of the succinyl dT-dT5 linker chain (Figure 3B). Whatever the cause, this initial “fade” design fails to properly disappear.
Figure 5.
Fading barcode visibility after an initial cleavage in EDA for 2 h and under increased brightness and contrast settings (left). Further treatment in EDA to induce additional cleavage in the labeled areas (16 h, then 72 h total) leads to minimal additional cleavage but retains the barcoding pattern. Signal/noise is understood as the ratio between fluorescence in the labeled areas (white pixels of the QR image) and background fluorescence in the non-labeled black pixels. Signal range refers to the range of Cy3 fluorescence in the labeled areas, in arbitrary units. Scale bar is ~100 μm.
3.3. Improved Fading Barcode
To ensure the complete disappearance of a pattern during EDA treatment, and assuming that the incomplete fade was due to the presence of non-cleavable strands remaining covalently bound to the surface, we proposed an alternative strategy using multiple cleavable points. The strategy is outlined in Figure 6. Instead of having a single cleavable site at the 3′ end of the DNA oligonucleotide, we tested the possibility of replacing each dT in the sequence with its succinyl-dT counterpart. For the sequence used to grow the DNA barcodes, this amounts to up to seven cleavable positions in total. In the same barcode strip of the synthesizable area, we envisaged three new fading strategies. In the single-cut approach, the design resembles that of the first “fade” design but now includes a cleavable point on the non-labeled black pixels as well. In the mixed-cut approach, white disappearing pixels are now charged with multiple cleavage sites. The final multi-cut approach includes multiple succinyl-dT units on both white and black pixels, labeled or not.
Figure 6.
Design concept of the improved fading QR code. Three new strategies are investigated, and the corresponding DNA QR codes are synthesized next to each other on the same microarray. The single cut approach includes a single succinyl-dT unit on both black and white pixels; the mixed-cut approach contains multiple cleavage sites in the DNA (squared dTs in the sequence) at the level of the white pixels; and the multi-cuts approach replaces all dTs with succinyl-dT on both white and black pixels. The green tag corresponds to a 5′-Cy3 fluorescent marker.
We synthesized the corresponding DNA microarray and scanned it after synthesis (pre-treatment stage). With the DNA array still protected, all three fading designs correctly showed the QR code (Figure 7A), indicating efficient DNA synthesis even with the incorporation of several succinyl-dT monomers. The single, 2 h long EDA treatment to effect the cleavage of the ester function appears to have largely cleaved at all the intended sites and left behind featureless black squares where the barcodes used to be located (Figure 7B), giving the impression of a now adequate vanishing function. Once again, increasing the brightness level on a graphics editor reveals that the single-cut design retains most of the pattern, and it has therefore not completely faded away (Figure 7C). This again is likely due to Cy3 labeling taking place on the fraction of non-cleavable strands within the cleavable area. The mixed-cut approach already fares better, with a QR pattern barely emerging above the background fluorescence. This suggests that the presence of multiple cleavage sites maximized the likelihood of Cy3 labeling occurring on base-sensitive, cleavable DNA. Despite its mostly faded features, the characteristic positioning corners are discernible, and information can still realistically be retrieved. The QR synthesized according to the multi-cut design, where cleavage can occur at multiple sites along the DNA on both white and black pixels, fully vanished. This barcode is completely invisible under high brightness settings. It takes an extreme increase in both the brightness and contrast parameters to notice the presence of a small number of spots reminiscent of the original QR code (Figure 7D). Such settings lead to the saturation of the fluorescence signals in the other barcodes. Further increasing and adjusting these settings does not improve the legibility of the code. Under these circumstances, the barcode is beyond recognizable and cannot be scanned. While the presence of a QR pattern can be inferred, the information contained within it cannot be recovered due to most of the pattern being missing entirely, either vanished chemically or hidden behind micro-scratches on the glass surface, impurities or traces of dried material. The multi-cut design is therefore the only barcoding strategy that has a true fading characteristic.
Figure 7.
Fluorescence scans of the barcode strip of a DNA microarray made with the second design for fading QR codes. The array was scanned on a microarray scanner, GenePix 4100A, at a 5 μm resolution with 532 nm wavelength excitation. (A) Scan post-synthesis and pre-treatment with EDA. (B) Scan post-treatment with EDA for 2 h and under similar brightness and contrast settings as for the pre-treatment scan. (C) EDA-treated array and its corresponding scan under high brightness levels. (D) Extreme brightness and contrast adjustments in a graphics editor are necessary to partially reveal a pattern of labeled/non-labeled features in the multi-cut design, with the barcode being largely non-functional.
The 97mer DNA sequence retrieved from the library area, despite being terminally labeled with a 5′-Cy3 dye, was correctly amplified by PCR with a set of primers binding to the regions identified with the barcode (Figure S3). This amplified double-stranded pool was then further equipped with standard sequencing adapters, making it ready and compatible with high-throughput sequencing techniques.
4. Discussion
The purpose of this study was to propose an experimental strategy for delivering primer information to the user after the recovery of a DNA library. PCR amplification of DNA microarray eluates is often a necessary step due to the minute amounts of DNA recovered from synthesis on surfaces [36,37]. We wanted to explore several options regarding the availability of this information. First, we wanted to have the sequence of primer binding regions available to the user in the form of cleartext at any time upon scanning. To achieve this, a simple, persistent, DNA-printed QR code is sufficient, and the difference between black and white in the input image boils down to the presence or absence of a 5′-terminal label.
Primer information that is only available at a specific stage of the process requires more subtle chemical construction. An appearing barcode is made possible if both the black and white pixels are labeled DNA, but the DNA synthesized where black is intended contains a base-sensitive ester function that detaches DNA during deprotection. There is a security advantage to this “appear” barcode in that the message is concealed within an inconspicuously labeled DNA microarray where, at this stage, both the library area and the “appear” barcode area are homogenously fluorescent and show no discernable trace of a printed code. This code only materializes upon chemical treatment.
The “fade” QR code is another example for securely transmitting information in that the barcode is evanescent and the burn-after-reading effect occurs with the same chemical treatment needed to deprotect and release the DNA library from the surface. Curiously, the initial design of the fading QR code did not perform as expected; namely, some leftover fluorescence made it impossible for the barcode to completely vanish. If the coupling efficiency of the succinyl-dT is “only” 99%, the remaining 1% of the linker strands can be extended with the DNA sequence and its terminal 5′ dye. A small amount of dye may be sufficient to be excited at 532 nm and fluoresce far above the surface background signal. Another possibility for the presence of non-cleavable, labeled DNA on cleavable areas is if DNA synthesis occurs outside of the intended dT5 linker. For this to occur, new hydroxyl groups on the surface would need to appear to be used as new synthesis sites, bypassing the linker and the succinyl-dT. It is possible, though highly hypothetical, that new hydroxyl groups at the surface of borosilicate glass are being formed due to the hydrolysis of the siloxane bonds that make up the functional silane layer between glass and linker chemistry [38]. At which stage in the synthesis process could the siloxane be hydrolyzed is unclear, but the oxidation solution containing iodine and water would certainly be a primary suspect. Another reagent would be the acidic detritylation solution needed to remove the acid-sensitive DMTr group on the succinyl-dT monomer, as siloxane bonds are susceptible and can be hydrolyzed by acids [39].
The initial fading design was improved by promoting base-mediated cleavage at multiple sites. This design allowed for a barcode to truly disappear and to only show traces of the pattern under highly exaggerated brightness and contrast settings. Despite the limited visibility of a positioning corner, which would immediately suggest the initial presence of a QR code, we believe that this faded QR code is too corrupt to be salvaged.
Though the QR codes were designed with level Q data redundancy allowing for 25% error, the glass-printed DNA codes are fragile and prone to scanning failure due to scratches or glass imperfections. In such a case, the presence of multiple copies of the barcode, for instance, one at each corner of the synthesis area, should alleviate this issue and retain >85% of the synthesis area for the actual DNA library.
5. Conclusions
In this paper, we explored, designed and synthesized two-dimensional barcodes made of DNA using microarray photolithography. Not only do these barcodes contain crucial information for the retrieval and amplification of microarray-synthesized DNA, but they can be chemically manipulated during post-synthesis handling so as to either stay, appear or disappear. This sensitivity to a simple chemical treatment with ethylenediamine adds a layer of information security since primer information can be willingly destroyed or kept confidential. Signal manipulation on surface-bound DNA should have a broad range of applications beyond data storage and towards biomarker sensing and molecular logics.
Supplementary Materials
The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/app142411663/s1: Figure S1: Data matrix barcode as digital input. Figure S2: Fluorescence scans of the data matrix barcode before and after EDA treatment. Figure S3: Agarose gel electrophoresis of the labeled 97mer DNA sequence before and after PCR amplification.
Author Contributions
Conceptualization, J.L.; methodology, E.P. and J.L.; validation, E.P.; formal analysis, E.P.; investigation, E.P.; resources, J.L.; data curation, E.P. and J.L.; writing—original draft preparation, J.L.; writing—review and editing, J.L.; visualization, J.L.; supervision, J.L.; project administration, J.L.; funding acquisition, J.L. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Austrian Science Fund (FWF), grant numbers I4923 and P34284. Open Access Funding by the University of Vienna. For open access purposes, the author has applied a CC BY public copyright license to any author-accepted manuscript version arising from this submission. Financial support from the Faculty of Chemistry is gratefully acknowledged.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The data for this study are available in the Supplementary Materials or accessible through the authors upon reasonable request.
Acknowledgments
The authors thank the Institute of Inorganic Chemistry for administrative, financial and technical support. Orgentis GmbH and ChemGenes are gratefully acknowledged for the custom synthesis of DNA and RNA phosphoramidites, respectively. The authors also thank Mark Somoza, Erika Schaudy and Tadija Kekić for their fruitful discussions.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Doricchi, A.; Platnich, C.M.; Gimpel, A.; Horn, F.; Earle, M.; Lanzavecchia, G.; Cortajarena, A.L.; Liz-Marzan, L.M.; Liu, N.; Heckel, R.; et al. Emerging Approaches to DNA Data Storage: Challenges and Prospects. ACS Nano 2022, 16, 17552–17571. [Google Scholar] [CrossRef] [PubMed]
- Meiser, L.C.; Nguyen, B.H.; Chen, Y.J.; Nivala, J.; Strauss, K.; Ceze, L.; Grass, R.N. Synthetic DNA applications in information technology. Nat. Commun. 2022, 13, 352. [Google Scholar] [CrossRef] [PubMed]
- Ceze, L.; Nivala, J.; Strauss, K. Molecular digital data storage using DNA. Nat. Rev. Genet. 2019, 20, 456–466. [Google Scholar] [CrossRef] [PubMed]
- Schroeder, G.K.; Lad, C.; Wyman, P.; Williams, N.H.; Wolfenden, R. The time required for water attack at the phosphorus atom of simple phosphodiesters and of DNA. Proc. Natl. Acad. Sci. USA 2006, 103, 4052–4055. [Google Scholar] [CrossRef]
- Anavy, L.; Vaknin, I.; Atar, O.; Amit, R.; Yakhini, Z. Data storage in DNA with fewer synthesis cycles using composite DNA letters. Nat. Biotechnol. 2019, 37, 1229–1236. [Google Scholar] [CrossRef]
- Erlich, Y.; Zielinski, D. DNA Fountain enables a robust and efficient storage architecture. Science 2017, 355, 950–953. [Google Scholar] [CrossRef]
- Meiser, L.C.; Antkowiak, P.L.; Koch, J.; Chen, W.D.; Kohll, A.X.; Stark, W.J.; Heckel, R.; Grass, R.N. Reading and writing digital data in DNA. Nat. Protoc. 2020, 15, 86–101. [Google Scholar] [CrossRef]
- Caruthers, M.H. A brief review of DNA and RNA chemical synthesis. Biochem. Soc. Trans. 2011, 39, 575–580. [Google Scholar] [CrossRef]
- Yazdi, S.; Gabrys, R.; Milenkovic, O. Portable and Error-Free DNA-Based Data Storage. Sci. Rep. 2017, 7, 5011. [Google Scholar] [CrossRef]
- Organick, L.; Ang, S.D.; Chen, Y.J.; Lopez, R.; Yekhanin, S.; Makarychev, K.; Racz, M.Z.; Kamath, G.; Gopalan, P.; Nguyen, B.; et al. Random access in large-scale DNA data storage. Nat. Biotechnol. 2018, 36, 242–248. [Google Scholar] [CrossRef]
- Yazdi, S.M.; Yuan, Y.; Ma, J.; Zhao, H.; Milenkovic, O. A Rewritable, Random-Access DNA-Based Storage System. Sci. Rep. 2015, 5, 14138. [Google Scholar] [CrossRef]
- Bornholt, J.; Lopez, R.; Carmean, D.M.; Ceze, L.; Seelig, G.; Strauss, K. Toward a DNA-Based Archival Storage System. IEEE Micro 2017, 37, 98–104. [Google Scholar] [CrossRef]
- Organick, L.; Chen, Y.J.; Dumas Ang, S.; Lopez, R.; Liu, X.; Strauss, K.; Ceze, L. Probing the physical limits of reliable DNA data retrieval. Nat. Commun. 2020, 11, 616. [Google Scholar] [CrossRef] [PubMed]
- Huo, W.X.; Ling, W.; Wang, Z.L.; Li, Y.; Zhou, M.X.; Ren, M.N.; Li, X.T.; Li, J.M.; Xia, Z.Q.; Liu, X.Y.; et al. Miniaturized DNA Sequencers for Personal Use: Unreachable Dreams or Achievable Goals. Front. Nanotechnol. 2021, 3, 628861. [Google Scholar] [CrossRef]
- Zhu, J.; Ermann, N.; Chen, K.; Keyser, U.F. Image Encoding Using Multi-Level DNA Barcodes with Nanopore Readout. Small 2021, 17, e2100711. [Google Scholar] [CrossRef]
- Grass, R.N.; Heckel, R.; Dessimoz, C.; Stark, W.J. Genomic Encryption of Digital Data Stored in Synthetic DNA. Angew. Chem. Int. Ed. 2020, 59, 8476–8480. [Google Scholar] [CrossRef]
- Zhang, Y.; Wang, F.; Chao, J.; Xie, M.; Liu, H.; Pan, M.; Kopperger, E.; Liu, X.; Li, Q.; Shi, J.; et al. DNA origami cryptography for secure communication. Nat. Commun. 2019, 10, 5469. [Google Scholar] [CrossRef]
- Clelland, C.T.; Risca, V.; Bancroft, C. Hiding messages in DNA microdots. Nature 1999, 399, 533–534. [Google Scholar] [CrossRef]
- Breithaupt, H. DNA and consumer confidence. DNA fingerprinting and DNA-based labelling systems are gaining importance in the security market to verify the authenticity of products. EMBO Rep. 2003, 4, 232–234. [Google Scholar] [CrossRef]
- Sharief, S.A.; Chahal, P.; Alocilja, E. Application of DNA sequences in anti-counterfeiting: Current progress and challenges. Int. J. Pharm. 2021, 602, 120580. [Google Scholar] [CrossRef]
- Eurofins. Leather DNA Traceability. Available online: https://www.blcleathertech.com/consulting/research-innovation/dna-tracking-in-leather (accessed on 24 July 2024).
- Koch, J.; Gantenbein, S.; Masania, K.; Stark, W.J.; Erlich, Y.; Grass, R.N. A DNA-of-things storage architecture to create materials with embedded memory. Nat. Biotechnol. 2020, 38, 39–43. [Google Scholar] [CrossRef] [PubMed]
- Nuwaysir, E.F.; Huang, W.; Albert, T.J.; Singh, J.; Nuwaysir, K.; Pitas, A.; Richmond, T.; Gorski, T.; Berg, J.P.; Ballin, J.; et al. Gene expression analysis using oligonucleotide arrays produced by maskless photolithography. Genome Res. 2002, 12, 1749–1755. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.-H.; Holden, M.T.; Smith, L.M. Enzymatic Fabrication of High-Density RNA Arrays. Angew. Chem. Int. Ed. 2014, 53, 13514–13517. [Google Scholar] [CrossRef]
- Holden, M.T.; Smith, L.M. Encrypted Oligonucleotide Arrays for Molecular Authentication. ACS Comb. Sci. 2019, 21, 562–567. [Google Scholar] [CrossRef]
- Schaudy, E.; Somoza, M.M.; Lietard, J. l-DNA Duplex Formation as a Bioorthogonal Information Channel in Nucleic Acid-Based Surface Patterning. Chem. Eur. J. 2020, 26, 14310–14314. [Google Scholar] [CrossRef]
- Schaudy, E.; Holz, K.; Lietard, J.; Somoza, M.M. Simple synthesis of massively parallel RNA microarrays via enzymatic conversion from DNA microarrays. Nat. Commun. 2022, 13, 3772. [Google Scholar] [CrossRef]
- Kekic, T.; Lietard, J. An 8-bit monochrome palette of fluorescent nucleic acid sequences for DNA-based painting. Nanoscale 2022, 14, 17528–17533. [Google Scholar] [CrossRef]
- Kekic, T.; Lietard, J. A Canvas of Spatially Arranged DNA Strands that Can Produce 24-bit Color Depth. J. Am. Chem. Soc. 2023, 145, 22293–22297. [Google Scholar] [CrossRef]
- Kretschy, N.; Holik, A.K.; Somoza, V.; Stengele, K.P.; Somoza, M.M. Next-Generation o-Nitrobenzyl Photolabile Groups for Light-Directed Chemistry and Microarray Synthesis. Angew. Chem. Int. Ed. 2015, 54, 8555–8559. [Google Scholar] [CrossRef]
- Agbavwe, C.; Kim, C.; Hong, D.; Heinrich, K.; Wang, T.; Somoza, M.M. Efficiency, Error and Yield in Light-Directed Maskless Synthesis of DNA Microarrays. J. Nanobiotechnol. 2011, 9, 57. [Google Scholar] [CrossRef]
- Lietard, J.; Kretschy, N.; Sack, M.; Wahba, A.S.; Somoza, M.M.; Damha, M.J. Base-cleavable microarrays for the characterization of DNA and RNA oligonucleotides synthesized in situ by photolithography. Chem. Commun. 2014, 50, 12903–12906. [Google Scholar] [CrossRef] [PubMed]
- Agbavwe, C.; Somoza, M.M. Sequence-Dependent Fluorescence of Cyanine Dyes on Microarrays. PLoS ONE 2011, 6, e22177. [Google Scholar] [CrossRef]
- Kretschy, N.; Sack, M.; Somoza, M.M. Sequence-Dependent Fluorescence of Cy3-and Cy5-Labeled Double-Stranded DNA. Bioconjugate Chem. 2016, 27, 840–848. [Google Scholar] [CrossRef] [PubMed]
- Kekic, T.; Lietard, J. Sequence-dependence of Cy3 and Cy5 dyes in 3′ terminally-labeled single-stranded DNA. Sci. Rep. 2022, 12, 14803. [Google Scholar] [CrossRef] [PubMed]
- LeProust, E.; Zhang, H.; Yu, P.; Zhou, X.; Gao, X. Characterization of oligodeoxyribonucleotide synthesis on glass plates. Nucleic Acids Res. 2001, 29, 2171–2180. [Google Scholar] [CrossRef] [PubMed]
- Lietard, J.; Schaudy, E.; Holz, K.; Ameur, D.; Somoza, M.M. High-Density DNA and RNA microarrays—Photolithographic Synthesis, Hybridization and Preparation of Large Nucleic Acid Libraries. J. Vis. Exp. 2019, 150, e59936. [Google Scholar] [CrossRef]
- Das, A.; Santhosh, S.; Giridhar, M.; Behr, J.; Michel, T.; Schaudy, E.; Ibanez-Redin, G.; Lietard, J.; Somoza, M.M. Dipodal Silanes Greatly Stabilize Glass Surface Functionalization for DNA Microarray Synthesis and High-Throughput Biological Assays. Anal. Chem. 2023, 95, 15384–15393. [Google Scholar] [CrossRef]
- Cypryk, M.; Apeloig, Y. Mechanism of the acid-catalyzed Si-O bond cleavage in siloxanes and siloxanols. A theoretical study. Organometallics 2002, 21, 2165–2175. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).