3-Hydroxy-5,6-epoxy-β-ionone Isolated from Invasive Harmful Brown Seaweed Sargassum Horneri Protects MH-S Mouse Lung Cells from Urban Particulate Matter-Induced Inflammation
Abstract
:Featured Application
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Purification and Isolation of HEBI from S. horneri
2.3. Estimation of UPM
2.4. Cell Culture and Sample Treatment
2.5. 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide (MTT) Assay
2.6. Determination of NO Secretion Levels
2.7. Determination of PGE2 and Pro-Inflammatory Cytokine Secretion
2.8. Western Blot Analysis
2.9. Quantitative RT-PCR
2.10. Statistical Analysis
3. Results
3.1. Composition of UPM
3.2. Effect of UPM on Viability and NO Secretion of MH-S Macrophages
3.3. Effect of HEBI on the Viability of MH-S Macrophages
3.4. HEBI Down-Regulated UPM-Induced Cell Death, NO, and PGE2 Release in MH-S Cells
3.5. HEBI Down-Regulated UPM-Induced iNOS and COX2 Production
3.6. HEBI Down-Regulated UPM-Stimulated Pro-Inflammatory Cytokine Secretion
3.7. Inhibitory Effect of HEBI against UPM-Induced TLR Activations (RT-qPCR)
3.8. Suppressive Effect of HEBI in UPM-Induced NF-κB Activation
3.9. HEBI Inhibits MAPK Phosphorylation in UPM-Exposed MH-S Cells
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Perini, K.; Ottelé, M.; Giulini, S.; Magliocco, A.; Roccotiello, E. Quantification of fine dust deposition on different plant species in a vertical greening system. Ecol. Eng. 2017, 100, 268–276. [Google Scholar] [CrossRef]
- Soberanes, S.; Misharin, A.V.; Jairaman, A.; Morales-Nebreda, L.; McQuattie-Pimentel, A.C.; Cho, T.; Hamanaka, R.B.; Meliton, A.Y.; Reyfman, P.A.; Walter, J.M.; et al. Metformin Targets Mitochondrial Electron Transport to Reduce Air-Pollution-Induced Thrombosis. Cell Metab. 2019, 29, 335–347.e335. [Google Scholar] [CrossRef] [Green Version]
- Lee, Y.G.; Ho, C.-H.; Kim, J.-H.; Kim, J. Quiescence of Asian dust events in South Korea and Japan during 2012 spring: Dust outbreaks and transports. Atmos. Environ. 2015, 114, 92–101. [Google Scholar] [CrossRef]
- Oh, H.-R.; Ho, C.-H.; Koo, Y.-S.; Baek, K.-G.; Yun, H.-Y.; Hur, S.-K.; Choi, D.-R.; Jhun, J.-G.; Shim, J.-S. Impact of Chinese air pollutants on a record-breaking PMs episode in the Republic of Korea for 11–15 January 2019. Atmos. Environ. 2020, 223, 117262. [Google Scholar] [CrossRef]
- Jung, S.; Kang, H.; Sung, S.; Hong, T. Health risk assessment for occupants as a decision-making tool to quantify the environmental effects of particulate matter in construction projects. Build. Environ. 2019, 161, 106267. [Google Scholar] [CrossRef]
- He, M.; Ichinose, T.; Kobayashi, M.; Arashidani, K.; Yoshida, S.; Nishikawa, M.; Takano, H.; Sun, G.; Shibamoto, T. Differences in allergic inflammatory responses between urban PM2.5 and fine particle derived from desert-dust in murine lungs. Toxicol Appl. Pharmacol. 2016, 297, 41–55. [Google Scholar] [CrossRef] [PubMed]
- Su, R.; Jin, X.; Zhang, W.; Li, Z.; Liu, X.; Ren, J. Particulate matter exposure induces the autophagy of macrophages via oxidative stress-mediated PI3K/AKT/mTOR pathway. Chemosphere 2017, 167, 444–453. [Google Scholar] [CrossRef] [PubMed]
- Baldwin, A.S., Jr. The NF-kappa B and I kappa B proteins: New discoveries and insights. Annu. Rev. Immunol. 1996, 14, 649–683. [Google Scholar] [CrossRef] [Green Version]
- Tak, P.P.; Firestein, G.S. NF-kappaB: A key role in inflammatory diseases. J. Clin. Investig. 2001, 107, 7–11. [Google Scholar] [CrossRef]
- Baeuerle, P.A.; Baltimore, D. NF-κB: Ten Years After. Cell 1996, 87, 13–20. [Google Scholar] [CrossRef] [Green Version]
- Hommes, D.W.; Peppelenbosch, M.P.; van Deventer, S.J. Mitogen activated protein (MAP) kinase signal transduction pathways and novel anti-inflammatory targets. Gut 2003, 52, 144–151. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kaminska, B. MAPK signalling pathways as molecular targets for anti-inflammatory therapy--from molecular mechanisms to therapeutic benefits. Biochim. Biophys. Acta 2005, 1754, 253–262. [Google Scholar] [CrossRef] [PubMed]
- Kyriakis, J.M.; Avruch, J. Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiol. Rev. 2001, 81, 807–869. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, H.-S.; Sanjeewa, K.K.A.; Fernando, I.P.S.; Ryu, B.; Yang, H.-W.; Ahn, G.; Kang, M.C.; Heo, S.-J.; Je, J.-G.; Jeon, Y.-J. A comparative study of Sargassum horneri Korea and China strains collected along the coast of Jeju Island South Korea: Its components and bioactive properties. Algae 2018, 33, 341–349. [Google Scholar] [CrossRef]
- Choi, H.G.; Lee, K.H.; Yoo, H.I.; Kang, P.J.; Kim, Y.S.; Nam, K.W. Physiological differences in the growth of Sargassum horneri between the germling and adult stages. In Nineteenth International Seaweed Symposium; Borowitzka, M.A., Critchley, A.T., Kraan, S., Peters, A., Sjøtun, K., Notoya, M., Eds.; Springer: Dordrecht, The Netherlands, 2009; pp. 279–285. [Google Scholar]
- Sanjeewa, K.K.; Fernando, I.P.; Kim, E.A.; Ahn, G.; Jee, Y.; Jeon, Y.J. Anti-inflammatory activity of a sulfated polysaccharide isolated from an enzymatic digest of brown seaweed Sargassum horneri in RAW 264.7 cells. Nutr. Res. Pract. 2017, 11, 3–10. [Google Scholar] [CrossRef] [Green Version]
- Herath, K.H.I.N.M.; Kim, H.J.; Mihindukulasooriya, S.P.; Kim, A.; Kim, H.J.; Jeon, Y.-J.; Jee, Y. Sargassum horneri extract containing mojabanchromanol attenuates the particulate matter exacerbated allergic asthma through reduction of Th2 and Th17 response in mice. Environ. Pollut. 2020. [Google Scholar] [CrossRef]
- Byeon, S.Y.; Oh, H.J.; Kim, S.; Yun, S.H.; Kang, J.H.; Park, S.R.; Lee, H.J. The origin and population genetic structure of the ’golden tide’ seaweeds, Sargassum horneri, in Korean waters. Sci. Rep. 2019, 9, 7757. [Google Scholar] [CrossRef] [Green Version]
- Marks, L.M.; Reed, D.C.; Holbrook, S.J. Niche Complementarity and Resistance to Grazing Promote the Invasion Success of Sargassum horneri in North America. Diversity 2020, 12, 54. [Google Scholar] [CrossRef] [Green Version]
- Sanjeewa, K.K.A.; Jayawardena, T.U.; Kim, S.Y.; Lee, H.G.; Je, J.G.; Jee, Y.; Jeon, Y.J. Sargassum horneri (Turner) inhibit urban particulate matter-induced inflammation in MH-S lung macrophages via blocking TLRs mediated NF-kappaB and MAPK activation. J. Ethnopharmacol. 2020, 249, 112363. [Google Scholar] [CrossRef]
- Sanjeewa, K.K.A.; Jayawardena, T.U.; Lee, H.G.; Herath, K.; Jee, Y.; Jeon, Y.J. The protective effect of Sargassum horneri against particulate matter-induced inflammation in lung tissues of an in vivo mouse asthma model. Food Funct. 2019, 10, 7995–8004. [Google Scholar] [CrossRef]
- Kim, H.-S.; Fernando, I.P.S.; Lee, S.-H.; Ko, S.-C.; Kang, M.C.; Ahn, G.; Je, J.-G.; Sanjeewa, K.K.A.; Rho, J.-R.; Shin, H.J.; et al. Isolation and characterization of anti-inflammatory compounds from Sargassum horneri via high-performance centrifugal partition chromatography and high-performance liquid chromatography. Algal Res. 2021, 54, 102209. [Google Scholar] [CrossRef]
- Leiro, J.; Alvarez, E.; Garcia, D.; Orallo, F. Resveratrol modulates rat macrophage functions. Int. Immunopharmacol. 2002, 2, 767–774. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Bekki, K.; Ito, T.; Yoshida, Y.; He, C.; Arashidani, K.; He, M.; Sun, G.; Zeng, Y.; Sone, H.; Kunugita, N.; et al. PM2.5 collected in China causes inflammatory and oxidative stress responses in macrophages through the multiple pathways. Environ. Toxicol. Pharmacol. 2016, 45, 362–369. [Google Scholar] [CrossRef] [PubMed]
- Tsai, M.H.; Hsu, L.F.; Lee, C.W.; Chiang, Y.C.; Lee, M.H.; How, J.M.; Wu, C.M.; Huang, C.L.; Lee, I.T. Resveratrol inhibits urban particulate matter-induced COX-2/PGE2 release in human fibroblast-like synoviocytes via the inhibition of activation of NADPH oxidase/ROS/NF-kappaB. Int. J. Biochem. Cell Biol. 2017, 88, 113–123. [Google Scholar] [CrossRef]
- Shikov, A.N.; Flisyuk, E.V.; Obluchinskaya, E.D.; Pozharitskaya, O.N. Pharmacokinetics of Marine-Derived Drugs. Mar. Drugs 2020, 18, 557. [Google Scholar] [CrossRef]
- Pozharitskaya, O.N.; Obluchinskaya, E.D.; Shikov, A.N. Mechanisms of Bioactivities of Fucoidan from the Brown Seaweed Fucus vesiculosus L. of the Barents Sea. Mar. Drugs 2020, 18, 275. [Google Scholar] [CrossRef]
- Ayrapetyan, O.N.; Obluchinskaya, E.D.; Zhurishkina, E.V.; Skorik, Y.A.; Lebedev, D.V.; Kulminskaya, A.A.; Lapina, I.M. Antibacterial Properties of Fucoidans from the Brown Algae Fucus vesiculosus L. of the Barents Sea. Biology 2021, 10, 67. [Google Scholar] [CrossRef]
- Pardo, M.; Xu, F.; Qiu, X.; Zhu, T.; Rudich, Y. Seasonal variations in fine particle composition from Beijing prompt oxidative stress response in mouse lung and liver. Sci. Total Environ. 2018, 626, 147–155. [Google Scholar] [CrossRef]
- Kim, P.W. Operating an environmentally sustainable city using fine dust level big data measured at individual elementary schools. Sustain. Cities Soc. 2018, 37, 1–6. [Google Scholar] [CrossRef]
- Huang, Y.C.; Ghio, A.J.; Stonehuerner, J.; McGee, J.; Carter, J.D.; Grambow, S.C.; Devlin, R.B. The role of soluble components in ambient fine particles-induced changes in human lungs and blood. Inhal. Toxicol. 2003, 15, 327–342. [Google Scholar] [CrossRef] [PubMed]
- Tan, P.X.; Thiyagarasaiyar, K.; Tan, C.Y.; Jeon, Y.J.; Nadzir, M.S.M.; Wu, Y.J.; Low, L.E.; Atanasov, A.G.; Ming, L.C.; Liew, K.B.; et al. Algae-Derived Anti-Inflammatory Compounds against Particulate Matters-Induced Respiratory Diseases: A Systematic Review. Mar. Drugs 2021, 19, 317. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Kim, H.S.; Je, J.-G.; Oh, J.Y.; Kim, Y.-S.; Cha, S.-H.; Jeon, Y.-J. Protective Effect of Diphlorethohydroxycarmalol Isolated from Ishige okamurae Against Particulate Matter-Induced Skin Damage by Regulation of NF-κB, AP-1, and MAPKs Signaling Pathways In Vitro in Human Dermal Fibroblasts. Molecules 2020, 25, 1055. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sanjeewa, K.K.A.; Jayawardena, T.U.; Kim, H.-S.; Kim, S.-Y.; Ahn, G.; Kim, H.-J.; Fu, X.; Jee, Y.; Jeon, Y.-J. Ethanol extract separated from Sargassum horneri (Turner) abate LPS-induced inflammation in RAW 264.7 macrophages. Fish. Aquat. Sci. 2019, 22, 6. [Google Scholar] [CrossRef] [Green Version]
- Vannini, F.; Kashfi, K.; Nath, N. The dual role of iNOS in cancer. Redox Biol. 2015, 6, 334–343. [Google Scholar] [CrossRef] [Green Version]
- Crofford, L.J. COX-1 and COX-2 tissue expression: Implications and predictions. J. Rheumatol. Suppl. 1997, 49, 15–19. [Google Scholar] [PubMed]
- Sutcliffe, S.; Pontari, M.A. Inflammation and Infection in the Etiology of Prostate Cancer. In Prostate Cancer; Mydlo, J.H., Godec, C.J., Eds.; Academic Press: San Diego, CA, USA, 2016; pp. 13–20. [Google Scholar]
- Zakeri, A.; Yazdi, F.G. Toll-like receptor-mediated involvement of innate immune cells in asthma disease. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 3270–3277. [Google Scholar] [CrossRef]
- Arango Duque, G.; Descoteaux, A. Macrophage cytokines: Involvement in immunity and infectious diseases. Front. Immunol. 2014, 5, 491. [Google Scholar] [CrossRef] [Green Version]
- Seok, J.K.; Lee, J.W.; Kim, Y.M.; Boo, Y.C. Punicalagin and (-)-Epigallocatechin-3-Gallate Rescue Cell Viability and Attenuate Inflammatory Responses of Human Epidermal Keratinocytes Exposed to Airborne Particulate Matter PM10. Skin Pharmacol. Physiol. 2018, 31, 134–143. [Google Scholar] [CrossRef]
- Mitchell, J.; Kim, S.J.; Seelmann, A.; Veit, B.; Shepard, B.; Im, E.; Rhee, S.H. Src family kinase tyrosine phosphorylates Toll-like receptor 4 to dissociate MyD88 and Mal/Tirap, suppressing LPS-induced inflammatory responses. Biochem. Pharmacol. 2018, 147, 119–127. [Google Scholar] [CrossRef]







| Gene | Primer | Sequence (5′→3′) |
|---|---|---|
| GAPDH | Forward | AAGGGTCATCATCTCTGCCC |
| Reverse | GTGATGGCATGGACTGTGGT | |
| iNOS | Forward | ATGTCCGAAGCAAACATCAC |
| Reverse | TAATGTCCAGGAAGTAGGTG | |
| COX2 | Forward | CAGCAAATCCTTGCTGTTCC |
| Reverse | TGGGCAAAGAATGCAAACATC | |
| IL-1β | Forward | CAGGATGAGGACATGAGCACC |
| Reverse | CTCTGCAGACTCAAACTCCAC | |
| IL-6 | Forward | GTACTCCAGAAGACCAGAGG |
| Reverse | TGCTGGTGACAACCACGGCC | |
| TNF-α | Forward | TTGACCTCAGCGCTGAGTTG |
| Reverse | CCTGTAGCCCACGTCGTAGC | |
| TLR2 | Forward | CAGCTGGAGAACTCTGACCC |
| Reverse | CAAAGAGCCTGAAGTGGGAG | |
| TLR4 | Forward | CAACATCATCCAGGAAGGC |
| Reverse | GAAGGCGATACAATTCCACC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sanjeewa, K.K.A.; Kim, H.-S.; Lee, H.-G.; Jayawardena, T.U.; Nagahawatta, D.P.; Yang, H.-W.; Udayanga, D.; Kim, J.-I.; Jeon, Y.-J. 3-Hydroxy-5,6-epoxy-β-ionone Isolated from Invasive Harmful Brown Seaweed Sargassum Horneri Protects MH-S Mouse Lung Cells from Urban Particulate Matter-Induced Inflammation. Appl. Sci. 2021, 11, 10929. https://doi.org/10.3390/app112210929
Sanjeewa KKA, Kim H-S, Lee H-G, Jayawardena TU, Nagahawatta DP, Yang H-W, Udayanga D, Kim J-I, Jeon Y-J. 3-Hydroxy-5,6-epoxy-β-ionone Isolated from Invasive Harmful Brown Seaweed Sargassum Horneri Protects MH-S Mouse Lung Cells from Urban Particulate Matter-Induced Inflammation. Applied Sciences. 2021; 11(22):10929. https://doi.org/10.3390/app112210929
Chicago/Turabian StyleSanjeewa, K. K. Asanka, Hyun-Soo Kim, Hyo-Geun Lee, Thilina U. Jayawardena, D. P. Nagahawatta, Hye-Won Yang, Dhanushka Udayanga, Jae-Il Kim, and You-Jin Jeon. 2021. "3-Hydroxy-5,6-epoxy-β-ionone Isolated from Invasive Harmful Brown Seaweed Sargassum Horneri Protects MH-S Mouse Lung Cells from Urban Particulate Matter-Induced Inflammation" Applied Sciences 11, no. 22: 10929. https://doi.org/10.3390/app112210929
APA StyleSanjeewa, K. K. A., Kim, H.-S., Lee, H.-G., Jayawardena, T. U., Nagahawatta, D. P., Yang, H.-W., Udayanga, D., Kim, J.-I., & Jeon, Y.-J. (2021). 3-Hydroxy-5,6-epoxy-β-ionone Isolated from Invasive Harmful Brown Seaweed Sargassum Horneri Protects MH-S Mouse Lung Cells from Urban Particulate Matter-Induced Inflammation. Applied Sciences, 11(22), 10929. https://doi.org/10.3390/app112210929

