Lactobacillus plantarum Alters Gut Microbiota and Metabolites Composition to Improve High Starch Metabolism in Megalobrama amblycephala
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statement
2.2. Experimental Diets
2.3. The Addition of LAB
2.4. Fish and Feeding Management
2.5. Sample Collection
2.6. Gut Microbiota Analysis
2.7. Metabolites Analysis
2.8. Real-Time PCR Analysis on Gene mRNA Expressions
2.9. Transmission Electron Microscope Analysis
2.10. Statistical Analysis of Data
3. Results
3.1. Effect of Lactobacillus plantarum on Gut Microbiota of Juvenile M. amblycephala
3.2. Effect of Lactobacillus plantarum on Metabolites of Juvenile M. amblycephala
3.3. Effect of Lactobacillus plantarum on Liver and Intestinal Bile Acids and Glycolipid Metabolism of Juvenile M. amblycephala
3.4. Correlation Analyses Combined with Gut Microbiota, Metabolites, and Gene Expressiones
3.5. Effect of Lactobacillus plantarum on the Histopathology of the Intestine and Liver
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
SCFAs | short-chain fatty acids |
BAs | bile acids |
NAFLD | nonalcoholic fatty liver disease |
FXR | farnesoid X receptor |
TGF15 | fibroblast growth factor 15 |
T2DM | type II diabetic |
LAB | Lactobacillus plantarum |
Ldlr | low-density lipoprotein |
Lxr | liver X receptor |
Cyp7a1 | cholesterol 7α-hydroxylase |
Rxr | vitamin α X receptor |
Hmgcr | 3-hydroxyl-3-meglutaryl-CoA reductase |
Hnf4α | liver nuclear factor 4α |
Abca1 | ATP binding box transporter A1 |
Shp | nuclear receptor subfamily 0 group B member 2 |
Srebp1c | sterol regulatory element-binding transcription factor1c |
Pk | pyruvate kinase |
G6pase | glucose-6-phosphatase |
Acc | acetyl-CoA carboxylase |
Fas | adipose synthase |
Lpl | lipoprotein lipase |
Pparβ | peroxisome proliferator-activated receptor delta |
References
- Wang, C.; Chuprom, J.; Wang, Y.; Fu, L. Beneficial bacteria for aquaculture: Nutrition, bacteriostasis and immunoregulation. J. Appl. Microbiol. 2020, 128, 28–40. [Google Scholar] [CrossRef] [PubMed]
- Hardy, H.; Harris, J.; Lyon, E.; Beal, J.; Foey, A. Probiotics, prebiotics and immunomodulation of gut mucosal defences: Homeostasis and immunopathology. Nutrients 2013, 5, 1869–1912. [Google Scholar] [CrossRef]
- Novik, G.; Savich, V. Beneficial microbiota. Probiotics and pharmaceutical products in functional nutrition and medicine. Microbes Infect. 2020, 22, 8–18. [Google Scholar] [CrossRef]
- Liang, X.; Lv, Y.; Zhang, Z.; Yi, H.; Liu, T.; Li, R.; Yu, Z.; Zhang, L. Study on intestinal survival and cholesterol metabolism of probiotics. LWT 2020, 124, 109132. [Google Scholar] [CrossRef]
- Xv, Z.; Zhong, Y.; Wei, Y.; Zhang, T.; Zhou, W.; Jiang, Y.; Lin, S. Yeast culture supplementation alters the performance and health status of juvenile largemouth bass (Micropterus salmoides) fed a high-plant protein diet. Aquacult. Nutr. 2021, 27, 2637–2650. [Google Scholar] [CrossRef]
- Yang, G.; Xiang, Y.; Wang, S.; Tao, Y.; Xie, L.; Bao, L.; Shen, K.; Li j Hu, B.; Wen, C.; Kumar, V.; et al. Response of intestinal microbiota to the variation in diets in grass carp (Ctenopharyngodon idella). Metabolites 2022, 12, 1115. [Google Scholar] [CrossRef] [PubMed]
- Auger, L.; Deschamps, M.; Vandenberg, G.; Derome, N. Microbiota is structured by gut regions, life stage, and diet in the Black Soldier Fly (Hermetia illucens). Front. Microbiol. 2023, 17, 1221728. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.Y.; Tiffany, C.R.; Mahan, S.P.; Kellom, M.; Rogers, A.W.; Nguyen, H.; Stevens, E.T.; Masson, H.L.; Yamazaki, K.; Marco, M.L.; et al. High fat intake sustains sorbitol intolerance after antibiotic-mediated Clostridia depletion from the gut microbiota. Cell 2024, 187, 1191–1205.E15. [Google Scholar] [CrossRef] [PubMed]
- Borrelli, L.; Aceto, S.; Agnisola, C.; De Paolo, S.; Dipineto, L.; Stilling, R.M.; Fioretti, A. Probiotic modulation of the microbiota-gut-brain axis and behaviour in zebrafish. Sci. Rep. 2016, 6, 30046. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Grosfeld, A.; Williams, E.; Vasiliauskas, D.; Barretto, S.; Smith, L.; Mariadassou, M.; Philippe, C.; Devime, F.; Melchior, C.; et al. Fructose malabsorption induces cholecystokinin expression in the ileum and cecum by changing microbiota composition and metabolism. FASEB J. 2019, 33, 7126. [Google Scholar] [CrossRef]
- Wu, T.; Zhang, Y.; Li, W.; Zhao, Y.; Long, H.; Muhindo, E.M.; Liu, R.; Sui, W.; Li, Q.; Zhang, M. Lactobacillus rhamnosus LRa05 ameliorate hyperglycemia through a regulating glucagon-mediated signaling pathway and gut microbiota in type 2 diabetic mice. J. Agric. Food Chem. 2021, 69, 8797–8806. [Google Scholar] [CrossRef]
- Luo, M.; Yan, J.; Wu, L.; Wu, J.; Chen, Z.; Jiang, J.; He, B. Probiotics alleviated nonalcoholic fatty liver disease in high-fat diet-fed rats via gut microbiota/FXR/FGF15 signaling pathway. J. Immunol. 2021, 2021, 2264737. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Li, M.; Ding, L.; Peng, C.; Wu, Y.; Liu, W.; Wu, L. Ampelopsis grossedentata improves type 2 diabetes mellitus through modulating the gut microbiota and bile acid metabolism. J. Funct. 2023, 107, 105622. [Google Scholar] [CrossRef]
- Slover, C.M.; Danziger, L. Lactobacillus: A review. Clin. Microbiol. Newsl. 2008, 30, 23–27. [Google Scholar] [CrossRef]
- Salas-Jara, M.J.; Ilabaca, A.; Vega, M.; García, A. Biofilm forming Lactobacillus: New challenges for the development of probiotics. Microorganisms 2016, 4, 35. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Y.; Ji, H.; Wang, S.; Liu, H.; Zhang, D.; Zhang, W.; Zhang, Y.; Zheng, C.; Wang, J. Effect of live and heat-inactivated Lactobaillus plantarum to Escherichia coli adhesion on IPEC-J2 cell. J. Gansu Agric. Univ. 2017, 52, 11–17. [Google Scholar] [CrossRef]
- Muscariello, L.; De Siena, B.; Marasco, R. Lactobacillus cell surface proteins involved in interaction with mucus and extracellular matrix components. Curr. Microbiol. 2020, 77, 3831–3841. [Google Scholar] [CrossRef] [PubMed]
- Huang, R.; Wu, F.; Zhou, Q.; Wei, W.; Yue, J.; Xiao, B.; Luo, Z. Lactobacillus and intestinal diseases: Mechanisms of action and clinical applications. Microbiol. Res. 2022, 260, 127019. [Google Scholar] [CrossRef] [PubMed]
- Kinoshita, H.; Uchida, H.; Kawai, Y.; Kawasaki, T.; Wakahara, N.; Matsuo, H.; Miura, K. Cell surface Lactobacillus plantarum LA 318 glyceraldehyde-3-phosphate dehydrogenase (GAPDH) adheres to human colonic mucin. J. Appl. Microbiol. 2008, 104, 1667–1674. [Google Scholar] [CrossRef]
- Wu, Y.; Jha, R.; Li, A.; Liu, H.; Zhang, Z.; Zhang, C.; Zhang, J. Probiotics (Lactobacillus plantarum HNU082) supplementation relieves ulcerative colitis by affecting intestinal barrier functions, immunity-related gene expression, gut microbiota, and metabolic pathways in mice. Microbiol. Spectr. 2022, 10, e01651-22. [Google Scholar] [CrossRef]
- Chen, M.; Guo, W.; Li, Q.; Xu, J.; Cao, Y.; Liu, B.; Lv, X. The protective mechanism of Lactobacillus plantarum FZU3013 against non-alcoholic fatty liver associated with hyperlipidemia in mice fed a high-fat diet. Food Funct. 2020, 11, 3316–3331. [Google Scholar] [CrossRef]
- Qian, L.J.; Miao, L.H.; Yan, L.; Gao, L.; Yu, D.; Ge, X.P. Effects of high starch diets with different probiotic supplements on growth, serum biochemistry and liver antioxidant capacity of juvenile blunt snout bream (Megalobrama amblycephala). JDOU 2023, 38, 388–396. [Google Scholar] [CrossRef]
- Xu, R.; Wang, T.; Ding, F.F.; Zhou, N.N.; Qiao, F.; Chen, L.Q.; Zhang, M.L. Lactobacillus plantarum ameliorates high-carbohydrate diet-induced hepatic lipid accumulation and oxidative stress by upregulating uridine synthesis. Antioxidants 2022, 11, 1238. [Google Scholar] [CrossRef]
- Du, Y.; Li, H.; Shao, J.; Wu, T.; Xu, W.; Hu, X.; Chen, J. Adhesion and colonization of the probiotic Lactobacillus plantarum HC-2 in the intestine of Litopenaeus vannamei are associated with bacterial surface proteins. Front. Microbiol. 2022, 13, 878874. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Ge, X.; Liu, B.; Xie, J.; Miao, L. Effect of high dietary carbohydrate on the growth performance and physiological responses of juvenile Wuchang bream, Megalobrama amblycephala. Asian Austral. J. Anim. 2013, 26, 1598. [Google Scholar] [CrossRef]
- Zhou, C.; Liu, B.; Ge, X.; Xie, J.; Xu, P. Effect of dietary carbohydrate on the growth performance, immune response, hepatic antioxidant abilities and heat shock protein 70 expression of Wuchang bream, Megalobrama amblycephala. J. Appl. Ichthyol. 2013, 29, 1348–1356. [Google Scholar] [CrossRef]
- GB/T 6435-2014; Determination of Moisturein Feedstuffs. Standardization Administration of the People’s Republic of China: Beijing, China, 2014.
- GB/T 6432-2018; Determination of Crude Protein in Feeds—Kjeldahl Method. Standardization Administration of the People’s Republic of China: Beijing, China, 2018.
- GB/T 6433-2006; Determination of Crude Fat in Feeds. Standardization Administration of the People’s Republic of China: Beijing, China, 2006.
- GB/T 6438-1992; Method for the Determination of Crude Ash in Feedstuffs. Standardization Administration of the People’s Republic of China: Beijing, China, 1992.
- Kou, S.; Vincent, G.; Gonzalez, E.; Pitre, F.E.; Labrecque, M.; Brereton, N.J. The response of a 16S ribosomal RNA gene fragment amplified community to lead, zinc, and copper pollution in a Shanghai field trial. Front. Microbiol. 2018, 9, 366. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.T.; Li, J.; Zhou, S.S.; Li, K.; Niu, L.L.; Zhao, L.; Xu, D.M. Analysis of the effects of sulfamethoxazole on the secondary metabolites and antioxidants in oilseed rape (Brassica napus L.) and the underlying mechanisms. Sci. Total. Environ. 2023, 902, 13. [Google Scholar] [CrossRef]
- Patel, P.N.; Kumar, D.R.; Gananadhamu, S.; Srinivas, R. Characterization of the stress degradation products of tolvaptan by UPLC-Q-TOF-MS/MS. RSC Adv. 2015, 5, 21142–21152. [Google Scholar] [CrossRef]
- Wang, L.; Zeng, B.; Liu, Z.; Liao, Z.; Zhong, Q.; Gu, L.; Fang, X. Green tea polyphenols modulate colonic microbiota diversity and lipid metabolism in high-fat diet treated HFA mice. J. Food Sci. 2018, 83, 864–873. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.B.; Pan, Q.; Yan, S.Q.; Chen, Y.H.; Li, M.J.; Chen, D.; Han, H.C.; Wu, B.; Cai, J.P. Bdellovibrio and like organisms promoted growth and survival of juvenile abalone Haliotis discus hannai Ino and modulated bacterial community structures in its gut. Aquac. Int. 2017, 25, 1625–1643. [Google Scholar] [CrossRef]
- Teixeira, L.D.; Lamberti, M.F.T.; DeBose-Scarlett, E.; Bahadiroglu, E.; Garrett, T.J.; Gardner, C.L.; Gonzalez, C.F. Lactobacillus johnsonii N6. 2 and blueberry phytophenols affect lipidome and gut microbiota composition of rats under high-fat diet. Front. Nutr. 2021, 8, 757256. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.Y.; Huang, W.Q.; Hou, Q.C.; Kwok, L.Y.; Sun, Z.H.; Ma, H.M.; Zhao, F.Y.; Lee, Y.H.; Zhang, H.P. The effects of probiotics administration on the milk production, milk components and fecal bacteria microbiota of dairy cows. Sci. Bull. 2017, 62, 767–774. [Google Scholar] [CrossRef] [PubMed]
- Peng, R.L.; Zhang, Z.Y.; Qu, Y.; Chen, W.W. The impact of Helicobacter pylori eradication with vonoprazan-amoxicillin dual therapy combined with probiotics on oral microbiota: A randomized double-blind placebo-controlled trial. Front. Microbiol. 2023, 14, 1273709. [Google Scholar] [CrossRef]
- Butt, R.L.; Volkoff, H. Gut Microbiota and Energy Homeostasis in Fish. Front. Endcrinol. 2019, 10, 12. [Google Scholar] [CrossRef] [PubMed]
- Mazier, W.; Le Corf, K.; Martinez, C.; Tudela, H.; Kissi, D.; Kropp, C.; Claus, S.P. A new strain of christensenella minuta as a potential biotherapy for obesity and associated metabolic diseases. Cells 2021, 10, 823. [Google Scholar] [CrossRef]
- Ismail, N.A.; Ragab, S.H.; Abd ElBaky, A.; Shoeib, A.R.; Alhosary, Y.; Fekry, D. Frequency of Firmicutes and Bacteroidetes in gut microbiota in obese and normal weight Egyptian children and adults. Arch. Med. Sci. 2011, 7, 501–507. [Google Scholar] [CrossRef] [PubMed]
- Mohamed, Q.R.; Assafi, M.S. The association between body mass index and the oral Firmicutes and Bacteroidetes profiles of healthy individuals. Malays. Fam. Physician 2021, 16, 36–43. [Google Scholar] [CrossRef] [PubMed]
- Ramírez, C.; Coronado, J.; Silva, A.; Romero, J. Cetobacterium is a major component of the microbiome of giant amazonian fish (Arapaima gigas) in Ecuador. Animals 2018, 8, 189. [Google Scholar] [CrossRef] [PubMed]
- Xiang, J.; Chi, Y.; Han, J.; Kong, P.; Liang, Z.; Wang, D.; Xiang, H.; Xie, Q. Litchi chinensis seed prevents obesity and modulates the gut microbiota and mycobiota compositions in high-fat diet-induced obese zebrafish. Food Funct. 2022, 13, 2832–2845. [Google Scholar] [CrossRef]
- Wahlström, A.; Sayin, S.I.; Marschall, H.U.; Bäckhed, F. Intestinal crosstalk between bile acids and microbiota and its impact on host metabolism. Cell Metab. 2016, 24, 41–50. [Google Scholar] [CrossRef] [PubMed]
- Nakahara, D.; Nan, C.; Mori, K.; Hanayama, M.; Egashira, Y. Effect of mushroom polysaccharides from Pleurotus eryngii on obesity and gut microbiota in mice fed a high-fat diet. Eur. J. Nutr. 2019, 59, 3231–3244. [Google Scholar] [CrossRef] [PubMed]
- Chiang, J.Y. Bile acid metabolism and signaling. Compr. Physiol. 2013, 3, 1191. [Google Scholar] [PubMed]
- Saeed, A.; Hoekstra, M.; Hoeke, M.O.; Heegsma, J.; Faber, K.N. The interrelationship between bile acid and vitamin A homeostasis. Biochim. Biophys. Acta 2017, 1862, 496–512. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.B.; Guleria, R.S.; Nizamutdinova, I.T.; Baker, K.M.; Pan, J. High Glucose-induced repression of RAR/RXR in cardiomyocytes is mediated through oxidative stress/JNK signaling. J. Cell Physiol. 2012, 227, 2632–2644. [Google Scholar] [CrossRef]
- Huang, X.; Fan, M.; Huang, W. Pleiotropic roles of FXR in liver and colorectal cancers. Mol. Cell Endocrinol. 2022, 543, 111543. [Google Scholar] [CrossRef]
- Degirolamo, C.; Modica, S.; Vacca, M.; Di Tullio, G.; Morgano, A.; D’Orazio, A.; Moschetta, A. Prevention of spontaneous hepatocarcinogenesis in Farnesoid X Receptor-Null mice by intestinal-specific Farnesoid X Receptor Reactivation. Hepatology 2015, 61, 161–170. [Google Scholar] [CrossRef]
- Berrabah, W.; Aumercier, P.; Gheeraert, C.; Dehondt, H.; Bouchaert, E.; Alexandre, J.; Lefebvre, P. Glucose sensing O-GlcNAcylation pathway regulates the nuclear bile acid receptor farnesoid X receptor (FXR). Hepatology 2014, 59, 2022–2033. [Google Scholar] [CrossRef] [PubMed]
- Liang, C.; Zhou, X.; Gong, P.; Niu, H.; Lyu, L.; Wu, Y.; Han, X.; Zhang, L. Lactiplantibacillus plantarum H-87 prevents high-fat diet-induced obesity by regulating bile acid metabolism in C57BL/6J mice. Food Funct. 2021, 12, 4315–4324. [Google Scholar] [CrossRef]
- Armeni, T.; Cianfruglia, L.; Piva, F.; Urbanelli, L.; Caniglia, M.L.; Pugnaloni, A.; Principato, G. SD-Lactoylglutathione can be an alternative supply of mitochondrial glutathione. Free Radic. Biol. Med. 2014, 67, 451–459. [Google Scholar] [CrossRef]
- Kawase, H.; Nishimura, K.; Yasheng, R.; Kureishi, B.Y.; Murohara, T. P1589 Metabolomic impact of glucagon-like peptide-1 on diabetic myocardium-glucagon-like peptide-1 accelerates myocardial glycolysis and utilizes more lactate as myocardial substrate. Eur. Heart J. 2017, 38 (Suppl. S1), ehx502.P1589. [Google Scholar] [CrossRef]
- Yadav, R.; Dey, D.K.; Vij, R.; Meena, S.; Kapila, R.; Kapila, S. Evaluation of anti-diabetic attributes of Lactobacillus rhamnosus MTCC: 5957, Lactobacillus rhamnosus MTCC: 5897 and Lactobacillus fermentum MTCC: 5898 in streptozotocin induced diabetic rats. Microb. Pathog. 2018, 125, 454–462. [Google Scholar] [CrossRef]
- Zhang, Y.L.; Wu, T.; Li, W.; Zhao, Y.J.; Long, H.R.; Liu, R.; Zhang, M. Lactobacillus casei LC89 exerts antidiabetic effects through regulating hepatic glucagon response and gut microbiota in type 2 diabetic mice. Food Funct. 2021, 12, 8288–8299. [Google Scholar] [CrossRef] [PubMed]
- Girard, R.; Darsigny, M.; Jones, C.; Maloum-Rami, F.; Gélinas, Y.; Carpentier, A.C.; Laplante, M.; Perreault, N.; Boudreau, F. HNF4α is a novel regulator of intestinal glucose-dependent insulinotropic polypeptide. Sci. Rep. 2019, 9, 4200. [Google Scholar] [CrossRef]
- Prestin, K.; Olbert, M.; Hussner, J.; Volzke, H.; Schwabedissen, H.E. Functional assessment of genetic variants located in the promoter of SHP1 (NR0B2). Pharmacogenet. Genom. 2017, 27, 410–415. [Google Scholar] [CrossRef]
- Zhu, R.Z.; Tu, Y.J.; Chang, J.X.; Xu, H.X.; Li, J.C.; Liu, W.; Li, B.Y. The orphan nuclear receptor gene NR0B2 is a favorite prognosis factor modulated by multiple cellular signal pathways in human liver cancers. Front. Oncol. 2021, 11, 12. [Google Scholar] [CrossRef] [PubMed]
- Yuan, J.; Zhao, F.; Liu, Y.; Liu, H.; Zhang, K.; Tian, X.; Wang, Y. Effects of Lactiplantibacillus plantarum on oxidative stress, mitophagy, and NLRP3 inflammasome activation in broiler breast meat. Poult. Sci. 2023, 102, 103128. [Google Scholar] [CrossRef] [PubMed]
- Wen, X.; Tang, L.; Zhong, R.; Liu, L.; Chen, L.; Zhang, H. Role of mitophagy in regulating intestinal oxidative damage. Antioxidants 2023, 12, 480. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Chen, G.; Zhang, J.; Pei, C.; Chen, Y.; Gong, J.; Wang, D. Live Lactobacillus acidophilus alleviates ulcerative colitis via the SCFAs/mitophagy/NLRP3 inflammasome axis. Food Funct. 2022, 13, 2985–2997. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.E.; Oh, T.J.; Moon, J.H.; Park, K.S.; Jang, H.C.; Choi, S.H. Serum neopterin concentration and impaired glucose metabolism: Relationship with β-Cell function and insulin resistance. Front. Endocrinol. 2019, 10, 43. [Google Scholar] [CrossRef] [PubMed]
- Bartz, R.; Li, W.H.; Venables, B.; Zehmer, J.K.; Roth, M.R.; Welti, R.; Chapman, K.D. Lipidomics reveals that adiposomes store ether lipids and mediate phospholipid traffic. J. Lipid. Res. 2007, 48, 837–847. [Google Scholar] [CrossRef] [PubMed]
- Hohenester, S.; Beuers, U.; Kowdley, K.; McCaughan, G.; Trautwein, C. Phosphatidylcholines as regulators of glucose and lipid homeostasis: Promises and potential risks. Hepatology 2010, 54, 2266–2268. [Google Scholar] [CrossRef] [PubMed]
- Christinat, N.; Valsesia, A.; Masoodi, M. Untargeted profiling of bile acids and lysophospholipids identifies the lipid signature associated with glycemic outcome in an obese non-diabetic clinical cohort. Biomolecules 2020, 10, 1049. [Google Scholar] [CrossRef]
- Hu, C.; Liu, M.; Tang, L.; Liu, H.; Sun, B.; Chen, L. Probiotic intervention mitigates the metabolic disturbances of perfluorobutanesulfonate along the gut-liver axis of zebrafish. Chemosphere 2021, 284, 131374. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Lu, K.M.; Luo, H.; Liang, D.F.; Long, X.; Yuan, Y.; Bao, J.K. In silico identification of small molecules as novel LXR agonists for the treatment of cardiovascular disease and cancer. J. Mol. Model. 2018, 24, 14. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Wang, L.; Liu, F.; Li, B.; Tang, Y.; Yu, S.; Zhang, D.; Huo, G. Effect of bile salt hydrolase-active Lactobacillus plantarum KLDS 1.0344 on cholesterol metabolism in rats fed a high-cholesterol diet. J. Funct. Foods 2019, 61, 103497. [Google Scholar] [CrossRef]
- Luciani, M.F.; Chimini, G.; Götz, A.; Spruss, T.; Kaminski, W.E.; Orsó, E.; Rothe, G. Transport of lipids from Golgi to plasma membrane is defective in Tangier disease patients and Abc1 -deficient mice. Nat. Genet. 2000, 24, 192–196. [Google Scholar] [CrossRef]
Ingredient (%) | LW | HW |
---|---|---|
Fishmeal 1 | 6.4 | 6.4 |
Soybean meal (46%) 1 | 25.4 | 21.6 |
Rapeseed meal 1 | 16.2 | 16.2 |
Cottonseed meal (50%) 1 | 15.3 | 15.3 |
Wheat meal 1 | 16.6 | 33.2 |
Rice bran | 5.7 | 0.0 |
Bran | 5.8 | 0.0 |
Soybean oil 2 | 3.1 | 3.9 |
Monocalcium phosphate | 1.0 | 1.0 |
Premix 1 | 1.0 | 1.0 |
Vitamin C 1 | 0.5 | 0.5 |
Choline chloride 1 | 0.4 | 0.4 |
Microcrystalline cellulose 1 | 2.1 | 0.0 |
Bentonite 1 | 0.5 | 0.5 |
Total | 100 | 100 |
Nutrient composition, % air-dried base | ||
Crude protein | 33.49 | 32.66 |
Crude fat | 6.23 | 6.57 |
Ash | 7.9 | 7.3 |
Gross energy (KJ/g) 3 | 17.48 | 17.49 |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Genbank No. | Product Length (bps) |
---|---|---|---|---|
fxr | TGGTGGGGAGGATTGGTACT | CTACAGGGCAAGACTCGTCG | XM_048169656.1 | 101 |
ldlr | ACTGATGACTGTGGAGACGG | AGGTCTTAGGCACACACTGG | XM_048158987.1 | 115 |
lxr | GCACGTACCTCTACAGTGGC | GAGCGTTTGTTGCACTGCTT | XM_048184573.1 | 119 |
cyp7a1 | TTTCCGTCAGACGCTTCAGG | CCCTTCTTCAAGCCAGTCGT | XM_048186424.1 | 118 |
rxr | GCCATATTCGACAGGGTGCT | ACTCCACTTCACTTGGGCTG | XM_048202891.1 | 142 |
hmgcr | CATGTGCTCTGGCCAAGTTT | AGTTAGCCAGGACAGACAAACC | XM_048189198.1 | 204 |
hnf4α | GGGGAGCATATCCCAATGCC | ATGTGTGAAGACCTCAGCCC | XM_048186071.1 | 111 |
abca1 | AGGACTACTCGGTGTCCCAG | ACCGCTGTCTCTTTACGACG | XM_048177071.1 | 109 |
shp | GGGCAGCATCCCAACTGTAA | CGCAGGACTTCGTCACCTTT | XM_048153777.1 | 149 |
srebp1c | ACAACAGTAGCGACACCCTG | CATCAGTGGAACGGTGGTCA | XM_048187188.1 | 117 |
pk | GCCGAGAAAGTCTTCATCGCGCAG | CGTCCAGAACCGCATTAGCCAC | XM_048152870.1 | 157 |
g6pase | TTCAGTGTCACGCTGTTCCT | TCTGGACTGACGCACCATTT | XM_048171060.1 | 119 |
acc | TAGCAGTGAGCATTGGCACA | CATCGCTGGCGTATGAGGAT | XM_048188636.1 | 327 |
fas | GTTTGCCAACCGCTTGTCTT | GGCCATGGCGAATAGCATTG | XM_048171583.1 | 119 |
lpl | TCTGATGGGATCTGGCAC | GTTTCTGGATTTGGGTCG | XM_048164066.1 | 85 |
pparβ | CATCCTCACGGGCAAGAC | CACTGGCAGCGGTAGAAG | XM_048209548.1 | 153 |
β-actin | TCGTCCACCGCAAATGCTTCTA | CCGTCACCTTCACCGTTCCAGT | AY170122.2 | 152 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qian, L.; Lu, S.; Jiang, W.; Mu, Q.; Lin, Y.; Gu, Z.; Wu, Y.; Ge, X.; Miao, L. Lactobacillus plantarum Alters Gut Microbiota and Metabolites Composition to Improve High Starch Metabolism in Megalobrama amblycephala. Animals 2025, 15, 583. https://doi.org/10.3390/ani15040583
Qian L, Lu S, Jiang W, Mu Q, Lin Y, Gu Z, Wu Y, Ge X, Miao L. Lactobacillus plantarum Alters Gut Microbiota and Metabolites Composition to Improve High Starch Metabolism in Megalobrama amblycephala. Animals. 2025; 15(4):583. https://doi.org/10.3390/ani15040583
Chicago/Turabian StyleQian, Linjie, Siyue Lu, Wenqiang Jiang, Qiaoqiao Mu, Yan Lin, Zhengyan Gu, Yeyang Wu, Xianping Ge, and Linghong Miao. 2025. "Lactobacillus plantarum Alters Gut Microbiota and Metabolites Composition to Improve High Starch Metabolism in Megalobrama amblycephala" Animals 15, no. 4: 583. https://doi.org/10.3390/ani15040583
APA StyleQian, L., Lu, S., Jiang, W., Mu, Q., Lin, Y., Gu, Z., Wu, Y., Ge, X., & Miao, L. (2025). Lactobacillus plantarum Alters Gut Microbiota and Metabolites Composition to Improve High Starch Metabolism in Megalobrama amblycephala. Animals, 15(4), 583. https://doi.org/10.3390/ani15040583