Effects of Enterococcus faecalis Supplementation on Growth Performance, Hepatic Lipid Metabolism, and mRNA Expression of Lipid Metabolism Genes and Intestinal Flora in Geese
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Material
2.2. Experimental Design and Geese Management
2.3. Measurements of Growth Performance and Sample Collection
2.4. Assessment of Serum and Hepatic Lipid Metabolism-Related Parameters
2.5. Expression of Genes Related to Hepatic Lipid Metabolism
2.6. Histomorphological Observations
2.7. Ileal Gut Microbiota Analysis via High-Throughput Sequencing
2.8. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Slaughtering Indicators
3.3. Serum Indicators of Lipid Metabolism
3.4. Serum Lipid Metabolism-Related Hormone Indicators
3.5. Indicators of Hepatic Lipid Metabolism
3.6. Gene Expression Related to Hepatic Lipid Metabolism
3.7. Ileum Morphology
3.8. Lipid Droplet Deposition in Liver
3.9. Ileal Intestinal Flora Diversity Analysis
3.10. Alpha and Beta Diversity Analyses
3.11. Analysis of Species Differences
3.12. Relationship Between Intestinal Microbiota and Lipid Metabolism Markers
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Luo, N.; Shu, J.; Yuan, X.; Jin, Y.; Cui, H.; Zhao, G.; Wen, J. Differential regulation of intramuscular fat and abdominal fat deposition in chickens. BMC Genom. 2022, 23, 308. [Google Scholar] [CrossRef] [PubMed]
- Korver, D.R. Review: Current challenges in poultry nutrition, health, and welfare. Animal 2023, 17 (Suppl. S2), 100755. [Google Scholar] [CrossRef] [PubMed]
- Ye, M.; Fan, Z.; Xu, Y.; Luan, K.; Guo, L.; Zhang, S.; Luo, Q. Exploring the association between fat-related traits in chickens and the RGS16 gene: Insights from polymorphism and functional validation analysis. Front. Vet. Sci. 2023, 10, 1180797. [Google Scholar] [CrossRef]
- Khasanah, H.; Kusbianto, D.E.; Purnamasari, L.; Cruz, J.F.D.; Widianingrum, D.C.; Hwang, S.G. Modulation of chicken gut microbiota for enhanced productivity and health: A review. Vet. World. 2024, 17, 1073–1083. [Google Scholar] [CrossRef] [PubMed]
- Hu, R.; Li, S.; Diao, H.; Huang, C.; Yan, J.; Wei, X.; Zhou, M.; He, P.; Wang, T.; Fu, H.; et al. The interaction between dietary fiber and gut microbiota, and its effect on pig intestinal health. Front. Immunol. 2023, 14, 1095740. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Chen, M.; Zhang, Y.; Wang, G.; Zhao, H. Lead exposure disrupted ileal barrier of developmental Japanese quails (Coturnix japonica): Histopathological damages, microbiota dysbiosis and immune disorder. Ecotoxicol. Environ. Saf. 2023, 264, 115488. [Google Scholar] [CrossRef] [PubMed]
- Amoroso, C.; Perillo, F.; Strati, F.; Fantini, M.C.; Caprioli, F.; Facciotti, F. The Role of Gut Microbiota Biomodulators on Mucosal Immunity and Intestinal Inflammation. Cells 2020, 9, 1234. [Google Scholar] [CrossRef]
- Phillips, C.J.C.; Hosseintabar-Ghasemabad, B.; Gorlov, I.F.; Slozhenkina, M.I.; Mosolov, A.A.; Seidavi, A. Immunomodulatory Effects of Natural Feed Additives for Meat Chickens. Life 2023, 13, 1287. [Google Scholar] [CrossRef]
- Rajput, D.S.; Zeng, D.; Khalique, A.; Rajput, S.S.; Wang, H.; Zhao, Y.; Sun, N.; Ni, X. Pretreatment with probiotics ameliorate gut health and necrotic enteritis in broiler chickens, a substitute to antibiotics. AMB Express 2020, 10, 220. [Google Scholar] [CrossRef]
- Reuben, R.C.; Roy, P.C.; Sarkar, S.L.; Alam, R.U.; Jahid, I.K. Isolation, characterization, and assessment of lactic acid bacteria toward their selection as poultry probiotics. BMC Microbiol. 2019, 19, 253. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez-Lucas, C.; Ladero, V. Enterococcal Phages: Food and Health Applications. Antibiotics 2023, 12, 842. [Google Scholar] [CrossRef] [PubMed]
- Nueno-Palop, C.; Narbad, A. Probiotic assessment of Enterococcus faecalis CP58 isolated from human gut. Int. J. Food Microbiol. 2011, 145, 390–394. [Google Scholar] [CrossRef]
- Quan, L.H.; Zhang, C.; Dong, M.; Jiang, J.; Xu, H.; Yan, C.; Liu, X.; Zhou, H.; Zhang, H.; Chen, L.; et al. Myristoleic acid produced by enterococci reduces obesity through brown adipose tissue activation. Gut 2020, 69, 1239–1247. [Google Scholar] [CrossRef]
- Franz, C.M.; Huch, M.; Abriouel, H.; Holzapfel, W.; Gálvez, A. Enterococci as probiotics and their implications in food safety. Int. J. Food Microbiol. 2011, 151, 125–140. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Hibberd, M.L.; Pettersson, S.; Lee, Y.K. Enterococcus faecalis from healthy infants modulates inflammation through MAPK signaling pathways. PLoS ONE 2014, 9, e97523. [Google Scholar] [CrossRef]
- Dang, X.; Zou, Q.; Xu, Y.; Cui, Y.; Li, X.; Xiao, Y.; Wang, T.; Li, D. Feeding Broiler Chicks with Bacillus subtilis, Clostridium butyricum, and Enterococcus faecalis Mixture Improves Growth Performance and Regulates Cecal Microbiota. Probiotics Antimicrob. Proteins 2024, 16, 113–124. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Chang, J.; Wang, P.; Liu, C.; Liu, M.; Zhou, T.; Yin, Q.; Yan, G. Combination of glycyrrhizic acid and compound probiotics alleviates deoxynivalenol-induced damage to weaned piglets. Ecotoxicol. Environ. Saf. 2023, 256, 114901. [Google Scholar] [CrossRef] [PubMed]
- Rautmann, A.W.; de La Serre, C.B. Microbiota’s Role in Diet-Driven Alterations in Food Intake: Satiety, Energy Balance, and Reward. Nutrients 2021, 13, 3067. [Google Scholar] [CrossRef] [PubMed]
- Xiao-Yu, Z.; Quan-Zhuang, Z.; Min-Xue, Z.; Zhi-Yong, M.; Pei-Lei, Z. Research on growth and development law and growth curve fitting analysis of Yili goose. Feed Res. 2021, 44, 41–45. [Google Scholar] [CrossRef]
- Suzuki, S.; Kobayashi, M.; Murai, A.; Tsudzuki, M.; Ishikawa, A. Characterization of Growth, Fat Deposition, and Lipid Metabolism-Related Gene Expression in Lean and Obese Meat-Type Chickens. J. Poult. Sci. 2019, 56, 101–111. [Google Scholar] [CrossRef]
- Ding, C.; Wu, H.; Cao, X.; Ma, X.; Gao, X.; Gao, Z.; Liu, S.; Fan, W.; Liu, B.; Song, S. Lactobacillus johnsonii 3-1 and Lactobacillus crispatus 7-4 promote the growth performance and ileum development and participate in lipid metabolism of broilers. Food Funct. 2021, 12, 12535–12549. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Hua, J.; Li, Z. Probiotics improve high fat diet-induced hepatic steatosis and insulin resistance by increasing hepatic NKT cells. J. Hepatol. 2008, 49, 821–830. [Google Scholar] [CrossRef]
- Do, M.H.; Oh, M.J.; Lee, H.B.; Kang, C.H.; Yoo, G.; Park, H.Y. Bifidobacterium animalis ssp. lactis MG741 Reduces Body Weight and Ameliorates Nonalcoholic Fatty Liver Disease via Improving the Gut Permeability and Amelioration of Inflammatory Cytokines. Nutrients 2022, 14, 1965. [Google Scholar] [CrossRef]
- Salehizadeh, M.; Modarressi, M.H.; Mousavi, S.N.; Ebrahimi, M.T. Effects of probiotic lactic acid bacteria on growth performance, carcass characteristics, hematological indices, humoral immunity, and IGF-I gene expression in broiler chicken. Trop. Anim. Health Prod. 2019, 51, 2279–2286. [Google Scholar] [CrossRef] [PubMed]
- Wu, Y.; Zhang, Q.; Ren, Y.; Ruan, Z. Effect of probiotic Lactobacillus on lipid profile: A systematic review and meta-analysis of randomized, controlled trials. PLoS ONE 2017, 12, e0178868. [Google Scholar] [CrossRef] [PubMed]
- Skrypnik, K.; Bogdański, P.; Łoniewski, I.; Reguła, J.; Suliburska, J. Effect of probiotic supplementation on liver function and lipid status in rats. Acta Sci. Pol. Technol. Aliment. 2018, 17, 185–192. [Google Scholar] [CrossRef] [PubMed]
- Chayanupatkul, M.; Machchimapiro, P.; Chuaypen, N.; Wanpiyarat, N.; Tumwasorn, S.; Siriviriyakul, P.; Werawatganon, D. Single and Mixed Strains of Probiotics Reduced Hepatic Fat Accumulation and Inflammation and Altered Gut Microbiome in a Nonalcoholic Steatohepatitis Rat Model. Biomedicines 2024, 12, 1847. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.C.; Chen, Y.M.; Kan, N.W.; Ho, C.S.; Wei, L.; Chan, C.H.; Huang, H.Y.; Huang, C.C. Hypolipidemic effects and safety of Lactobacillus reuteri 263 in a hamster model of hyperlipidemia. Nutrients 2015, 7, 3767–3782. [Google Scholar] [CrossRef]
- Zhang, J.M.; Sun, Y.S.; Zhao, L.Q.; Chen, T.T.; Fan, M.N.; Jiao, H.C.; Zhao, J.P.; Wang, X.J.; Li, F.C.; Li, H.F.; et al. SCFAs-Induced GLP-1 Secretion Links the Regulation of Gut Microbiome on Hepatic Lipogenesis in Chickens. Front. Microbiol. 2019, 10, 2176. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.W.; Wang, J.; Zhang, H.J.; Wu, S.G.; Qi, G.H. Supplemental Clostridium butyricum Modulates Lipid Metabolism Through Shaping Gut Microbiota and Bile Acid Profile of Aged Laying Hens. Front. Microbiol. 2020, 11, 600. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Guo, X.; Guo, J.; He, Q.; Li, H.; Song, Y.; Zhang, H. Lactobacillus casei reduces susceptibility to type 2 diabetes via microbiota-mediated body chloride ion influx. Sci. Rep. 2014, 4, 5654. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Wang, X.; Wang, J.; Wu, F.; Sui, Y.; Yang, L.; Wang, Z. Lactobacillus plantarum strains as potential probiotic cultures with cholesterol-lowering activity. J. Dairy Sci. 2013, 96, 2746–2753. [Google Scholar] [CrossRef]
- Postic, C.; Girard, J. Contribution of de novo fatty acid synthesis to hepatic steatosis and insulin resistance: Lessons from genetically engineered mice. J. Clin. Investig. 2008, 118, 829–838. [Google Scholar] [CrossRef] [PubMed]
- Kirpich, I.A.; Marsano, L.S.; McClain, C.J. Gut-liver axis, nutrition, and non-alcoholic fatty liver disease. Clin. Biochem. 2015, 48, 923–930. [Google Scholar] [CrossRef] [PubMed]
- Bian, X.; Liu, R.; Meng, Y.; Xing, D.; Xu, D.; Lu, Z. Lipid metabolism and cancer. J. Exp. Med. 2021, 218, e20201606. [Google Scholar] [CrossRef] [PubMed]
- Du, X.; Cai, C.; Yao, J.; Zhou, Y.; Yu, H.; Shen, W. Histone modifications in FASN modulated by sterol regulatory element-binding protein 1c and carbohydrate responsive-element binding protein under insulin stimulation are related to NAFLD. Biochem. Biophys. Res. Commun. 2017, 483, 409–417. [Google Scholar] [CrossRef]
- Carotti, A.; Marinozzi, M.; Custodi, C.; Cerra, B.; Pellicciari, R.; Gioiello, A.; Macchiarulo, A. Beyond bile acids: Targeting Farnesoid X Receptor (FXR) with natural and synthetic ligands. Curr. Top. Med. Chem. 2014, 14, 2129–2142. [Google Scholar] [CrossRef] [PubMed]
- Gadaleta, R.M.; van Mil, S.W.; Oldenburg, B.; Siersema, P.D.; Klomp, L.W.; van Erpecum, K.J. Bile acids and their nuclear receptor FXR: Relevance for hepatobiliary and gastrointestinal disease. Biochim. Biophys. Acta 2010, 1801, 683–692. [Google Scholar] [CrossRef] [PubMed]
- Xiong, H.; Zhang, C.; Han, L.; Xu, T.; Saeed, K.; Han, J.; Liu, J.; Klaassen, C.D.; Gonzalez, F.J.; Lu, Y.; et al. Suppressed farnesoid X receptor by iron overload in mice and humans potentiates iron-induced hepatotoxicity. Hepatology 2022, 76, 387–403. [Google Scholar] [CrossRef] [PubMed]
- Sinal, C.J.; Tohkin, M.; Miyata, M.; Ward, J.M.; Lambert, G.; Gonzalez, F.J. Targeted disruption of the nuclear receptor FXR/BAR impairs bile acid and lipid homeostasis. Cell 2000, 102, 731–744. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; He, Q.; Wang, G.; Xu, X.; Hao, H. FXR modulators for enterohepatic and metabolic diseases. Expert Opin. Ther. Pat. 2018, 28, 765–782. [Google Scholar] [CrossRef] [PubMed]
- Pawlak, M.; Lefebvre, P.; Staels, B. Molecular mechanism of PPARα action and its impact on lipid metabolism, inflammation and fibrosis in non-alcoholic fatty liver disease. J. Hepatol. 2015, 62, 720–733. [Google Scholar] [CrossRef] [PubMed]
- Geng, F.; Guo, D. SREBF1/SREBP-1 concurrently regulates lipid synthesis and lipophagy to maintain lipid homeostasis and tumor growth. Autophagy 2024, 20, 1183–1185. [Google Scholar] [CrossRef] [PubMed]
- Martel, J.; Chang, S.H.; Ko, Y.F.; Hwang, T.L.; Young, J.D.; Ojcius, D.M. Gut barrier disruption and chronic disease. Trends Endocrinol. Metab. 2022, 33, 247–265. [Google Scholar] [CrossRef] [PubMed]
- Võ, T.C.; Võ, T.T.B.; Mai, H.Đ.; Bạch, A.B.; Lê, T.H.; Võ, V.T. Effects of dietary supplementation with probiotics on growth performance, gut health and disease resistance of striped catfish (Pangasianodon hypophthalmus). Tạp Chí Nông Nghiệp Và Phát Triển 2024, 23, 88–99. [Google Scholar] [CrossRef]
- Du, J.; Zhao, L.; Kang, Q.; He, Y.; Bi, Y. An optimized method for Oil Red O staining with the salicylic acid ethanol solution. Adipocyte 2023, 12, 2179334. [Google Scholar] [CrossRef]
- Hsieh, F.C.; Lan, C.C.; Huang, T.Y.; Chen, K.W.; Chai, C.Y.; Chen, W.T.; Fang, A.H.; Chen, Y.H.; Wu, C.S. Heat-killed and live Lactobacillus reuteri GMNL-263 exhibit similar effects on improving metabolic functions in high-fat diet-induced obese rats. Food Funct. 2016, 7, 2374–2388. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Z.; Zhang, L.; Yang, L.; Chu, H. The critical role of gut microbiota in obesity. Front. Endocrinol. 2022, 13, 1025706. [Google Scholar] [CrossRef]
- Million, M.; Maraninchi, M.; Henry, M.; Armougom, F.; Richet, H.; Carrieri, P.; Valero, R.; Raccah, D.; Vialettes, B.; Raoult, D. Obesity-associated gut microbiota is enriched in Lactobacillus reuteri and depleted in Bifidobacterium animalis and Methanobrevibacter smithii. Int. J. Obes. 2012, 36, 817–825. [Google Scholar] [CrossRef]
- Joung, H.; Chu, J.; Kim, B.K.; Choi, I.S.; Kim, W.; Park, T.S. Probiotics ameliorate chronic low-grade inflammation and fat accumulation with gut microbiota composition change in diet-induced obese mice models. Appl. Microbiol. Biotechnol. 2021, 105, 1203–1213. [Google Scholar] [CrossRef]
- Chen, S.; Ye, W.; Clements, K.D.; Zan, Z.; Zhao, W.; Zou, H.; Wang, G.; Wu, S. Bacillus licheniformis FA6 Affects Zebrafish Lipid Metabolism Through Promoting Acetyl-CoA Synthesis and Inhibiting β-Oxidation. Int. J. Mol. Sci. 2022, 24, 673. [Google Scholar] [CrossRef] [PubMed]
- Zouari, R.; Hamden, K.; El Feki, A.; Chaabouni, K.; Makni-Ayadi, F.; Sallemi, F.; Ellouze-Chaabouni, S.; Ghribi-Aydi, D. Evaluation of Bacillus subtilis SPB1 biosurfactant effects on hyperglycemia, angiotensin I-converting enzyme (ACE) activity and kidney function in rats fed on high-fat-high-fructose diet. Arch. Physiol. Biochem. 2017, 123, 112–120. [Google Scholar] [CrossRef]
- Cao, G.T.; Dai, B.; Wang, K.L.; Yan, Y.; Xu, Y.L.; Wang, Y.X.; Yang, C.M. Bacillus licheniformis, a potential probiotic, inhibits obesity by modulating colonic microflora in C57BL/6J mice model. J. Appl. Microbiol. 2019, 127, 880–888. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Guo, J.; Reva, A.; Huang, F.; Xiong, B.; Liu, Y.; Deng, Z.; Leadlay, P.F.; Sun, Y. Methyltransferases of gentamicin biosynthesis. Proc. Natl. Acad. Sci. USA 2018, 115, 1340–1345. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Chen, S.; Yang, L.; Zhang, S.; Qin, L.; Jiang, H. Distinct Gut Microbiota and Arachidonic Acid Metabolism in Obesity-Prone and Obesity-Resistant Mice with a High-Fat Diet. Nutrients 2024, 16, 1579. [Google Scholar] [CrossRef] [PubMed]
- Qi, W.; Zhu, S.; Feng, L.; Liang, J.; Guo, X.; Cheng, F.; Guo, Y.; Lan, G.; Liang, J. Integrated Analysis of the Transcriptome and Microbial Diversity in the Intestine of Miniature Pig Obesity Model. Microorganisms 2024, 12, 369. [Google Scholar] [CrossRef] [PubMed]
- Bai, Y.F.; Yue, Z.L.; Wang, Y.N.; Li, Y.D.; Li, C.; Liu, X.T.; Shi, R.H.; Huo, N.N.; Li, D.D.; Gao, S.; et al. Synergistic effect of polysaccharides and flavonoids on lipid and gut microbiota in hyperlipidemic rats. Food Funct. 2023, 14, 921–933. [Google Scholar] [CrossRef]










| Ingredients | Content | Nutrient Levels | Content |
|---|---|---|---|
| Corn | 61.50 | ME/(MJ/Kg) 2 | 10.92 |
| Soybean meal | 25.00 | Crude protein | 16.02 |
| Rice bran | 7.00 | Crude fiber | 5.60 |
| Wheat bran | 3.00 | Calcium | 0.72 |
| NaCl | 0.30 | Phosphorus | 0.54 |
| Vitamin and mineral premix 1 | 1.00 | Lysine | 0.80 |
| DL-Met | 0.10 | Methionine | 0.33 |
| Dicalcium phosphate | 1.10 | ||
| Mountain flour | 1.00 |
| Gene Name | Primer Sequence (5′–3′) |
|---|---|
| ACCA | F: CCGGGAGGTTAATGGAAGGAC |
| R: TGTGCCCTCAGCACTCTTG | |
| SREBP-1 | F: CCGCTCATCCATCAACGAC |
| R: GGCTGAGGTTCTCCTGCTTC | |
| FXR | F: TTTGCTCCAGCTGGACTCAG |
| R: AGAAAGAGACGGTAGTTCCAGAG | |
| FASN | F: GCCTGCCACAACTCTGAAGATAC |
| R: CTCCTTTGCGAACACACCATCC | |
| PPARα | F: CCACAGCTCCAGGTAGCATAG |
| R: AGGCACTTTTGAAAACGACAG | |
| β-actin | F: CCCAGCCATGTATGTAGCCATCC |
| R:AACACCATCACCAGAGTCCATCAC |
| Item | Groups 1 | |
|---|---|---|
| CON | E. faecalis | |
| BW (g) | ||
| 1 d | 350.00 ± 9.79 | 346.00 ± 9.79 |
| 5 d | 528.00 ± 24.45 a | 468.00 ± 24.45 b |
| 25 d | 1380.00 ± 28.35 b | 1742.00 ± 28.35 a |
| 45 d | 2150.00 ± 97.54 b | 2592.00 ± 97.54 a |
| ADG (g/d) | ||
| 1 to 5 d | 35.60 ± 3.57 a | 24.40 ± 3.57 b |
| 6 to 25 d | 42.60 ± 0.92 b | 63.70 ± 0.92 a |
| 26 to 45 d | 38.50 ± 4.07 | 42.50 ± 4.07 |
| 1 to 45 d | 40.00 ± 2.01 b | 49.91 ± 2.01 a |
| ADFI (g/d) | ||
| 1 to 5 d | 233.80 ± 2.97 | 229.60 ± 2.97 |
| 6 to 25 d | 412.00 ± 2.58 a | 330.20 ± 2.58 b |
| 26 to 45 d | 590.80 ± 2.66 a | 526.80 ± 2.66 b |
| 1 to 45 d | 471.67 ± 1.86 a | 406.40 ± 1.86 b |
| FCR | ||
| 1 to 45 d | 11.80 ± 0.36 a | 8.19 ± 0.36 b |
| Item | Groups 1 | |
|---|---|---|
| CON | E. faecalis | |
| Abdominal Fat (g) | ||
| 5d | 28.00 ± 1.20 a | 10.00 ± 1.20 b |
| 25d | 18.80 ± 2.84 | 21.20 ± 2.84 |
| 45d | 130.40 ± 7.38 a | 86.80 ± 7.38 b |
| Liver weight (g) | ||
| 5d | 23.42 ± 1.83 a | 18.76 ± 1.83 b |
| 25d | 49.30 ± 3.86 | 57.16 ± 3.86 |
| 45d | 91.00 ± 3.76 a | 60.92 ± 3.76 b |
| Half-eviscerated weight (g) | ||
| 5d | 397.06 ± 18.39 a | 351.94 ± 18.39 b |
| 25d | 1037.76 ± 21.32 b | 1309.98 ± 21.32 a |
| 45d | 1616.80 ± 73.35 b | 1949.18 ± 73.35 a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, S.; Zhao, Y.; Pang, Z.; Wan, B.; Wang, J.; Wu, Z.; Wang, Q. Effects of Enterococcus faecalis Supplementation on Growth Performance, Hepatic Lipid Metabolism, and mRNA Expression of Lipid Metabolism Genes and Intestinal Flora in Geese. Animals 2025, 15, 268. https://doi.org/10.3390/ani15020268
Sun S, Zhao Y, Pang Z, Wan B, Wang J, Wu Z, Wang Q. Effects of Enterococcus faecalis Supplementation on Growth Performance, Hepatic Lipid Metabolism, and mRNA Expression of Lipid Metabolism Genes and Intestinal Flora in Geese. Animals. 2025; 15(2):268. https://doi.org/10.3390/ani15020268
Chicago/Turabian StyleSun, Siyu, Yujie Zhao, Zhen Pang, Baoxia Wan, Jiaqi Wang, Zhenyu Wu, and Qiuju Wang. 2025. "Effects of Enterococcus faecalis Supplementation on Growth Performance, Hepatic Lipid Metabolism, and mRNA Expression of Lipid Metabolism Genes and Intestinal Flora in Geese" Animals 15, no. 2: 268. https://doi.org/10.3390/ani15020268
APA StyleSun, S., Zhao, Y., Pang, Z., Wan, B., Wang, J., Wu, Z., & Wang, Q. (2025). Effects of Enterococcus faecalis Supplementation on Growth Performance, Hepatic Lipid Metabolism, and mRNA Expression of Lipid Metabolism Genes and Intestinal Flora in Geese. Animals, 15(2), 268. https://doi.org/10.3390/ani15020268

