Natural Product-Induced Modulation of Androstenone Metabolism in Porcine Hepatocytes
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Research Animals and Sample Collection
2.2. Buffer and Media Preparation
2.3. Isolation of Primary Hepatocytes
2.4. Hepatocyte Treatments
2.5. Quantification of Androstenone Metabolism and Metabolite Production
2.6. Gene Expression Analysis in Isolated Hepatocytes
2.7. Statistical Analysis
3. Results
3.1. Effect of Conventional Agonist Treatments on Hepatic Gene Expression
3.2. Effect of Natural Product Treatments on Hepatic Gene Expression
3.3. Effect of Treatments on Androstenone Metabolism by Isolated Hepatocytes
3.4. Differences in Androstenone Metabolism and Gene Expression by Treatment Response
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| PXR | Pregnane X receptor |
| CAR | Constitutive androstane receptor |
| FXR | Farnesoid X receptor |
| UGTs | UDP-Glucuronosyltransferases |
| RIF | Rifampicin |
| CDCA | Chenodeoxycholic acid |
| CITCO | 6-(4-chlorophenyl)imidazo[2,1-b][1,3]thiazole-5-carbaldehyde-O-(3,4-dichlorobenzyl)oxime |
| HYP | Hyperforin |
| DAS | Diallyl sulfide |
| OA | Oleanolic acid |
| GINK | Ginkgolide A |
| GUG | (Z)-Guggulsterone |
| HBSS | Hank’s Balanced Salt Solution |
| DMSO | Dimethyl sulfoxide |
| HPLC | High-performance liquid chromatography |
| PR | Positive response |
| NR | Negative/non-responsive |
| RT-qPCR | Real-Time Quantitative Polymerase Chain Reaction |
| AKR1C1 | Aldo-keto reductase 1C1 |
| SULT2A1 | Sulfotransferase 2A1 |
| UGT1A6 | UDP-glucuronosyltransferase 1A6 |
| UGT1A1 | UDP-glucuronosyltransferase 1A1 |
| UGT2A1 | UDP-glucuronosyltransferase 2A1 |
| UGT2B31 | UDP-glucuronosyltransferase 2B31 |
| NR0B2 | Nuclear receptor subfamily 0 group B member 2 |
| NR2F1 | Nuclear receptor subfamily 2 group F member 1 |
| HNF4α | Hepatocyte nuclear factor 4 alpha |
| HNF1α | Hepatocyte nuclear factor 1 alpha |
| PGC1α | Peroxisome proliferator-activated receptor gamma coactivator 1-alpha |
| SIRT1 | NAD-dependent deacetylase sirtuin-1 |
| SRC1 | Steroid receptor coactivator 1 |
| HMGB1 | High mobility group box 1 protein |
| CYP2E1 | Cytochrome P450 2E1 |
References
- Bookout, A.L.; Jeong, Y.; Downes, M.; Yu, R.T.; Evans, R.M.; Mangelsdorf, D.J. Anatomical Profiling of Nuclear Receptor Expression Reveals a Hierarchical Transcriptional Network. Cell 2006, 126, 789–799. [Google Scholar] [CrossRef]
- Jonker, J.W.; Liddle, C.; Downes, M. FXR and PXR: Potential Therapeutic Targets in Cholestasis. J. Steroid Biochem. Mol. Biol. 2012, 130, 147–158. [Google Scholar] [CrossRef]
- Cai, X.; Young, G.M.; Xie, W. The Xenobiotic Receptors PXR and CAR in Liver Physiology, an Update. Biochim. Biophys. Acta BBA-Mol. Basis Dis. 2021, 1867, 166101. [Google Scholar] [CrossRef] [PubMed]
- Gray, M.A.; Squires, E.J. Effects of Nuclear Receptor Transactivation on Boar Taint Metabolism and Gene Expression in Porcine Hepatocytes. J. Steroid Biochem. Mol. Biol. 2013, 133, 110–119. [Google Scholar] [CrossRef] [PubMed]
- Zamaratskaia, G.; Squires, E.J. Biochemical, Nutritional and Genetic Effects on Boar Taint in Entire Male Pigs. Animal 2009, 3, 1508–1521. [Google Scholar] [CrossRef]
- Bone, C.; Anderson, C.; Lou, Y.; Squires, E.J. The Characterization of Androstenone Transport in Boar Plasma. J. Steroid Biochem. Mol. Biol. 2019, 185, 218–224. [Google Scholar] [CrossRef]
- Bone, C.; Squires, E.J. The Uptake and Deconjugation of Androstenone Sulfate in the Adipose Tissue of the Boar. Animals 2021, 11, 3158. [Google Scholar] [CrossRef]
- Endo, S.; Morikawa, Y.; Matsunaga, T.; Hara, A.; Nishinaka, T. Porcine Aldo-Keto Reductase 1C Subfamily Members AKR1C1 and AKR1C4: Substrate Specificity, Inhibitor Sensitivity and Activators. J. Steroid Biochem. Mol. Biol. 2022, 221, 106113. [Google Scholar] [CrossRef] [PubMed]
- Laderoute, H.; Bone, C.; Squires, E.J. The Sulfoconjugation of Androstenone and Dehydroepiandrosterone by Human and Porcine Sulfotransferase Enzymes. Steroids 2018, 136, 8–16. [Google Scholar] [CrossRef]
- Bélanger, A.; Hum, D.W.; Beaulieu, M.; Lévesque, É.; Guillemette, C.; Tchernof, A.; Bélanger, G.; Turgeon, D.; Dubois, S. Characterization and Regulation of UDP-Glucuronosyltransferases in Steroid Target Tissues. J. Steroid Biochem. Mol. Biol. 1998, 65, 301–310. [Google Scholar] [CrossRef]
- Modica, S. Master Regulation of Bile Acid and Xenobiotic Metabolism via the FXR, PXR and CAR Trio. Front. Biosci. 2009, 14, 4719–4745. [Google Scholar] [CrossRef]
- Bachs, L.; Parés, A.; Elena, M.; Piera, C.; Rodés, J. Effects of Long-Term Rifampicin Administration in Primary Biliary Cirrhosis. Gastroenterology 1992, 102, 2077–2080. [Google Scholar] [CrossRef]
- Hedrich, W.D.; Xiao, J.; Heyward, S.; Zhang, Y.; Zhang, J.; Baer, M.R.; Hassan, H.E.; Wang, H. Activation of the Constitutive Androstane Receptor Increases the Therapeutic Index of CHOP in Lymphoma Treatment. Mol. Cancer Ther. 2016, 15, 392–401. [Google Scholar] [CrossRef]
- Sakisaka, S.; Anno, H.; Kumashiro, R.; Yoshida, H.; Nagata, E.; Abe, H.; Tanikawa, K. The cytotoxicity of chenodeoxycholic acid (CDCA) and ursodeoxycholic acid (UDCA) on primary cultured hepatocytes, and cytoprotective effect of polyenephosphatidylcholine (PPC). Kanzo 1984, 25, 350–358. [Google Scholar] [CrossRef]
- Mizoguchi, Y.; Kodama, C.; Sakagami, Y.; Seki, S.; Kobayashi, K.; Yamamoto, S.; Morisawa, S. Effects of Bile Acids on Liver Cell Injury by Cultured Supernatant of Activated Liver Adherents Cells. Gastroenterol. Jpn. 1989, 24, 25–30. [Google Scholar] [CrossRef]
- Bone, C.; Squires, E.J. Nuclear Receptor Pathways Mediating the Development of Boar Taint. Metabolites 2022, 12, 785. [Google Scholar] [CrossRef]
- Moore, L.B.; Goodwin, B.; Jones, S.A.; Wisely, G.B.; Serabjit-Singh, C.J.; Willson, T.M.; Collins, J.L.; Kliewer, S.A.S. John’s Wort Induces Hepatic Drug Metabolism through Activation of the Pregnane X Receptor. Proc. Natl. Acad. Sci. USA 2000, 97, 7500–7502. [Google Scholar] [CrossRef] [PubMed]
- Rao, P.; Midde, N.; Miller, D.; Chauhan, S.; Kumar, A.; Kumar, S. Diallyl Sulfide: Potential Use in Novel Therapeutic Interventions in Alcohol, Drugs, and Disease Mediated Cellular Toxicity by Targeting Cytochrome P450 2E1. Curr. Drug Metab. 2015, 16, 486–503. [Google Scholar] [CrossRef] [PubMed]
- Fisher, C.D.; Augustine, L.M.; Maher, J.M.; Nelson, D.M.; Slitt, A.L.; Klaassen, C.D.; Lehman-McKeeman, L.D.; Cherrington, N.J. Induction of Drug-Metabolizing Enzymes by Garlic and Allyl Sulfide Compounds via Activation of Constitutive Androstane Receptor and Nuclear Factor E2-Related Factor 2. Drug Metab. Dispos. 2007, 35, 995–1000. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Camino, M.C.; Cert, A. Quantitative Determination of Hydroxy Pentacyclic Triterpene Acids in Vegetable Oils. J. Agric. Food Chem. 1999, 47, 1558–1562. [Google Scholar] [CrossRef]
- Liu, W.; Wong, C. Oleanolic Acid Is a Selective Farnesoid X Receptor Modulator. Phytother. Res. 2010, 24, 369–373. [Google Scholar] [CrossRef]
- Li, L.; Stanton, J.D.; Tolson, A.H.; Luo, Y.; Wang, H. Bioactive Terpenoids and Flavonoids from Ginkgo Biloba Extract Induce the Expression of Hepatic Drug-Metabolizing Enzymes Through Pregnane X Receptor, Constitutive Androstane Receptor, and Aryl Hydrocarbon Receptor-Mediated Pathways. Pharm. Res. 2009, 26, 872–882. [Google Scholar] [CrossRef]
- Chang, T.K.H.; Chen, J.; Teng, X.W. Distinct Role of Bilobalide and Ginkgolide A in the Modulation of Rat CYP2B1 and CYP3A23 Gene Expression by Ginkgo Biloba Extract in Cultured Hepatocytes. Drug Metab. Dispos. 2006, 34, 234–242. [Google Scholar] [CrossRef]
- Rajaraman, G.; Chen, J.; Chang, T.K.H. Ginkgolide A Contributes to the Potentiation of Acetaminophen Toxicity by Ginkgo Biloba Extract in Primary Cultures of Rat Hepatocytes. Toxicol. Appl. Pharmacol. 2006, 217, 225–233. [Google Scholar] [CrossRef] [PubMed]
- Brobst, D.E.; Ding, X.; Creech, K.L.; Goodwin, B.; Kelley, B.; Staudinger, J.L. Guggulsterone Activates Multiple Nuclear Receptors and Induces CYP3A Gene Expression through the Pregnane X Receptor. J. Pharmacol. Exp. Ther. 2004, 310, 528–535. [Google Scholar] [CrossRef]
- Ding, X.; Staudinger, J.L. The Ratio of Constitutive Androstane Receptor to Pregnane X Receptor Determines the Activity of Guggulsterone against the Cyp2b10 Promoter. J. Pharmacol. Exp. Ther. 2005, 314, 120–127. [Google Scholar] [CrossRef] [PubMed]
- Cui, J.; Huang, L.; Zhao, A.; Lew, J.-L.; Yu, J.; Sahoo, S.; Meinke, P.T.; Royo, I.; Peláez, F.; Wright, S.D. Guggulsterone Is a Farnesoid X Receptor Antagonist in Coactivator Association Assays but Acts to Enhance Transcription of Bile Salt Export Pump. J. Biol. Chem. 2003, 278, 10214–10220. [Google Scholar] [CrossRef] [PubMed]
- Bone, C.; Squires, E.J. Hepatic Gene Expression and Metabolite Profiles of Androstenone and Skatole Relative to Plasma Estrone Sulfate Levels in Boars. Biomolecules 2024, 14, 850. [Google Scholar] [CrossRef]
- Willems, E.; Leyns, L.; Vandesompele, J. Standardization of Real-Time PCR Gene Expression Data from Independent Biological Replicates. Anal. Biochem. 2008, 379, 127–129. [Google Scholar] [CrossRef]
- She, J.; Gu, T.; Pang, X.; Liu, Y.; Tang, L.; Zhou, X. Natural Products Targeting Liver X Receptors or Farnesoid X Receptor. Front. Pharmacol. 2022, 12, 772435. [Google Scholar] [CrossRef]
- Gao, J.; Xie, W. Targeting Xenobiotic Receptors PXR and CAR for Metabolic Diseases. Trends Pharmacol. Sci. 2012, 33, 552–558. [Google Scholar] [CrossRef] [PubMed]
- Nainu, F.; Frediansyah, A.; Mamada, S.S.; Permana, A.D.; Salampe, M.; Chandran, D.; Emran, T.B.; Simal-Gandara, J. Natural Products Targeting Inflammation-Related Metabolic Disorders: A Comprehensive Review. Heliyon 2023, 9, e16919. [Google Scholar] [CrossRef] [PubMed]
- Walter Bock, K.; Köhle, C. UDP-Glucuronosyltransferase 1A6: Structural, Functional, and Regulatory Aspects. In Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 2005; Volume 400, pp. 57–75. ISBN 978-0-12-182805-9. [Google Scholar]
- Hankele, A.-K.; Bauersachs, S.; Ulbrich, S.E. Conjugated Estrogens in the Endometrium during the Estrous Cycle in Pigs. Reprod. Biol. 2018, 18, 336–343. [Google Scholar] [CrossRef]
- Xie, W.; Yeuh, M.-F.; Radominska-Pandya, A.; Saini, S.P.S.; Negishi, Y.; Bottroff, B.S.; Cabrera, G.Y.; Tukey, R.H.; Evans, R.M. Control of Steroid, Heme, and Carcinogen Metabolism by Nuclear Pregnane X Receptor and Constitutive Androstane Receptor. Proc. Natl. Acad. Sci. USA 2003, 100, 4150–4155. [Google Scholar] [CrossRef] [PubMed]
- Ihunnah, C.A.; Jiang, M.; Xie, W. Nuclear Receptor PXR, Transcriptional Circuits and Metabolic Relevance. Biochim. Biophys. Acta BBA-Mol. Basis Dis. 2011, 1812, 956–963. [Google Scholar] [CrossRef]
- Kurosawa, K.; Nakano, M.; Yokoseki, I.; Tomii, M.; Higuchi, Y.; Uehara, S.; Yoneda, N.; Suemizu, H.; Fukami, T.; Nakajima, M. Switch/Sucrose Non-Fermentable Complex Interacts with Constitutive Androstane Receptor to Regulate Drug-Metabolizing Enzymes and Transporters in the Liver. Drug Metab. Dispos. 2025, 53, 100057. [Google Scholar] [CrossRef]
- Soars, M.G.; Petullo, D.M.; Eckstein, J.A.; Kasper, S.C.; Wrighton, S.A. An Assessment of UDP-Glucuronosyltransferase Induction Using Primary Human Hepatocytes. Drug Metab. Dispos. 2004, 32, 140–148. [Google Scholar] [CrossRef]
- Pascussi, J.-M.; Gerbal-Chaloin, S.; Duret, C.; Daujat-Chavanieu, M.; Vilarem, M.-J.; Maurel, P. The Tangle of Nuclear Receptors That Controls Xenobiotic Metabolism and Transport: Crosstalk and Consequences. Annu. Rev. Pharmacol. Toxicol. 2008, 48, 1–32. [Google Scholar] [CrossRef]
- Bwayi, M.N.; Garcia-Maldonado, E.; Chai, S.C.; Xie, B.; Chodankar, S.; Huber, A.D.; Wu, J.; Annu, K.; Wright, W.C.; Lee, H.-M.; et al. Molecular Basis of Crosstalk in Nuclear Receptors: Heterodimerization between PXR and CAR and the Implication in Gene Regulation. Nucleic Acids Res. 2022, 50, 3254–3275. [Google Scholar] [CrossRef]
- Buler, M.; Aatsinki, S.-M.; Skoumal, R.; Hakkola, J. Energy Sensing Factors PGC-1α and SIRT1 Modulate PXR Expression and Function. Biochem. Pharmacol. 2011, 82, 2008–2015. [Google Scholar] [CrossRef]
- Shiraki, T.; Sakai, N.; Kanaya, E.; Jingami, H. Activation of Orphan Nuclear Constitutive Androstane Receptor Requires Subnuclear Targeting by Peroxisome Proliferator-Activated Receptor γ Coactivator-1α. J. Biol. Chem. 2003, 278, 11344–11350. [Google Scholar] [CrossRef]
- Istrate, M.A.; Nussler, A.K.; Eichelbaum, M.; Burk, O. Regulation of CYP3A4 by Pregnane X Receptor: The Role of Nuclear Receptors Competing for Response Element Binding. Biochem. Biophys. Res. Commun. 2010, 393, 688–693. [Google Scholar] [CrossRef]
- Thomas, A.M.; Hart, S.N.; Li, G.; Lu, H.; Fang, Y.; Fang, J.; Zhong, X.; Guo, G.L. Hepatocyte Nuclear Factor 4 Alpha and Farnesoid X Receptor Co-Regulates Gene Transcription in Mouse Livers on a Genome-Wide Scale. Pharm. Res. 2013, 30, 2188–2198. [Google Scholar] [CrossRef]
- Goodwin, B.; Jones, S.A.; Price, R.R.; Watson, M.A.; McKee, D.D.; Moore, L.B.; Galardi, C.; Wilson, J.G.; Lewis, M.C.; Roth, M.E.; et al. A Regulatory Cascade of the Nuclear Receptors FXR, SHP-1, and LRH-1 Represses Bile Acid Biosynthesis. Mol. Cell 2000, 6, 517–526. [Google Scholar] [CrossRef]
- Lamba, J.K.; Lamba, V.; Yasuda, K.; Lin, Y.S.; Assem, M.; Thompson, E.; Strom, S.; Schuetz, E. Expression of Constitutive Androstane Receptor Splice Variants in Human Tissues and Their Functional Consequences. J. Pharmacol. Exp. Ther. 2004, 311, 811–821. [Google Scholar] [CrossRef] [PubMed]
- Lamba, V. PXR (NR1I2): Splice Variants in Human Tissues, Including Brain, and Identification of Neurosteroids and Nicotine as PXR Activators. Toxicol. Appl. Pharmacol. 2004, 199, 251–265. [Google Scholar] [CrossRef] [PubMed]
- Kanno, Y.; Otsuka, S.; Hiromasa, T.; Nakahama, T.; Inouye, Y. Diurnal Difference in CAR mRNA Expression. Nucl. Recept. 2004, 2, 6. [Google Scholar] [CrossRef]
- Yang, D.; Yang, J.; Shi, D.; Xiao, D.; Chen, Y.-T.; Black, C.; Deng, R.; Yan, B. Hypolipidemic Agent Z-Guggulsterone: Metabolism Interplays with Induction of Carboxylesterase and Bile Salt Export Pump. J. Lipid Res. 2012, 53, 529–539. [Google Scholar] [CrossRef]
- Wargovich, M.J. Diallylsulfide and Allylmethylsulfide Are Uniquely Effective among Organosulfur Compounds in Inhibiting CYP2E1 Protein in Animal Models. J. Nutr. 2006, 136, 832S–834S. [Google Scholar] [CrossRef]
- Sheen, L.Y.; Wu, C.C.; Lii, C.-K.; Tsai, S.-J. Metabolites of Diallyl Disulfide and Diallyl Sulfide in Primary Rat Hepatocytes. Food Chem. Toxicol. 1999, 37, 1139–1146. [Google Scholar] [CrossRef] [PubMed]
- Rasmussen, M.K.; Zamaratskaia, G. Regulation of Porcine Hepatic Cytochrome P450—Implication for Boar Taint. Comput. Struct. Biotechnol. J. 2014, 11, 106–112. [Google Scholar] [CrossRef] [PubMed]




| Gene Name | Abbreviation | Primer Forward Sequence (5′-3′) | Primer Reverse Sequence (5′-3′) | Refseq ID |
|---|---|---|---|---|
| Aldo-keto reductase 1C1 | AKR1C1 | GGAGGACTTTTTCCCAAAGG | TCCCTCGTTCTTGCACTTCT | NM_001044618 |
| Sulfotransferase 2A1 | SULT2A1 | ACACGAGAAGCGCCGTAGAG | TGGACATGTTGTTTTCTTTCATGA | NM_001037150 |
| UDP-glucuronosyltransferase 1A6 | UGT1A6 | TGCTTTGGGCAAAATACCTC | CTTTGGGTGACCAAGCAGAT | NM_001278750.1 |
| UDP-glucuronosyltransferase 1A1 | UGT1A1 | ATAATTACCCGAGGCCCATC | CCCCAAAGAGAAAACCACAA | KJ922612.1 |
| UDP-glucuronosyltransferase 2A1 | UGT2B31 | TTTGAGACAATGGGGAAAGC | AGGTAGGGGTTTTGCAGGTT | XM_003356958.4 |
| UDP-glucuronosyltransferase 2B31 | UGT2A1 | TGCACGTTACTGAAAATGCAAG | TTGTAAAAGCCAGAGCACATCA | NM_001244124.1 |
| Farnesoid X receptor | FXR | GTCGTCAAGGGAAGAAGCTG | TTTCCCACTGTTGTCTGCTG | NM_001038005 |
| Pregnane X receptor | PXR | GCCATCTCCCTTTTCTCTCC | CGATGTAGGCCTTCAGGGTA | NM_001038005 |
| Constitutive androstane receptor | CAR | CCGCCATATGGGCACTATGT | GCGAAATGCATGAGCAGAGA | NM_001037996 |
| Nuclear receptor subfamily 0 group B member 2 | NR0B2 | AGTGCTGCCTGGAGTCCTTA | GATGTGGGAGGAGGCATAGA | XM_003127720.4 |
| Nuclear receptor subfamily 2 group F member 1 | NR2F1 | ACAGGAACTGTCCCATCGAC | GATGTAGCCGGACAGGTAGC | XM_003354213.4 |
| Hepatocyte nuclear factor 4 alpha | HNF4α | ACCTCCCCTGTCTCTGGAAT | ATGTACTTGGCCCACTCGAC | NM_001044571.1 |
| Hepatocyte nuclear factor 1 alpha | HNF1α | CCATCCTCAAAGAGCTGGAG | GCTGCAGGTAGGACTTGACC | NM_001032388.1 |
| Peroxisome proliferator-activated receptor gamma coactivator 1-alpha | PGC1α | TAAAGATGCCGCCTCTGACT | TGACCGAAGTGCTTGTTCAG | NM_213963.2 |
| NAD-dependent deacetylase sirtuin-1 | SIRT1 | CCATGGCGCTGAGGTATATT | TCATCCTCCATGGGTTCTTC | NM_001145750.2 |
| Steroid receptor coactivator 1 | SRC1 | AGTGATGACTCGTGGCACTG | GCTGCATGTCTGGACTTTGA | NM_001025228.1 |
| High mobility group box 1 protein | HMGB1 | CCATTGGTGATGTTGCAAAG | CCCTTTAGCTCGGTATGCAG | NM_001004034.1 |
| β-Actin | - | CGTGGACATCAGGAAGGAC | TCTGCTGGAAGGTGGACAG | XM_003357928 |
| Treatment | ||||
|---|---|---|---|---|
| Transcript | CITCO | CDCA | RIF | |
| Phase I metabolism | AKR1C1 | 0.93 (0.72, 1.20) | 0.90 (0.60, 1.35) | 0.95 (0.86, 1.06) |
| Phase II metabolism | SULT2A1 | 0.73 (0.23, 2.28) | 4.01 (0.74, 21.75) | 1.04 (0.45, 2.40) |
| UGT1A1 | 0.82 (0.54, 1.25) | 0.73 (0.47, 1.12) | 1.14 (0.86, 1.51) | |
| UGT1A6 | 1.01 (0.82, 1.25) ab | 0.86 (0.76, 0.97) b | 1.06 (0.94, 1.19) a | |
| UGT2B31 | 1.07 (0.84, 1.36) | 1.01 (0.84, 1.21) | 1.02 (0.82, 1.27) | |
| UGT2A1 | 0.29 (0.09, 0.93) | 0.52 (0.17, 1.64) | 0.30 (0.10, 0.86) | |
| Nuclear receptors | FXR | 0.84 (0.70, 0.99) a | 1.29 (0.92, 1.82) a | 0.70 (0.58, 0.85) b |
| PXR | 0.84 (0.73, 0.96) ab | 1.30 (1.01, 1.67) a | 0.78 (0.71, 0.85) b | |
| CAR | 0.93 (0.76, 1.14) | 0.97 (0.89, 1.06) | 0.78 (0.63, 0.96) | |
| NR0B2 | 0.92 (0.79, 1.07) a | 7.74 (4.90, 12.21) **b | 1.11 (0.83, 1.47) a | |
| NR2F1 | 0.83 (0.56, 1.24) | 0.70 (0.46, 1.07) | 0.72 (0.53, 0.98) | |
| HNF1α | 4.62 (3.01, 7.09) | 3.58 (1.45, 8.81) | 5.77 (1.48, 22.48) | |
| HNF4α | 1.00 (0.83, 1.22) | 0.88 (0.78, 1.00) | 0.96 (0.82, 1.13) | |
| Co-regulatory proteins | PGC1α | 0.52 (0.41, 0.66) * | 0.72 (0.51, 1.03) | 0.56 (0.36, 0.89) * |
| SIRT1 | 0.88 (0.73, 1.06) | 0.83 (0.68, 1.02) | 0.81 (0.75, 0.87) | |
| SRC1 | 0.91 (0.82, 1.03) | 0.91 (0.81, 1.01) | 0.85 (0.81, 0.88) | |
| HMGB1 | 0.83 (0.61, 1.11) | 0.81 (0.55, 1.18) | 0.83 (0.77, 0.91) | |
| (A) | Basal Metabolite Abundance Difference (PR-NR, %) | |||||||
| Receptor | Treatments | Androstenone Metabolism | 3α/β-Androstenols | 16-Androstene Glucuronides | ||||
| PXR | RIF | 30.99 ± 18.38 | −2.77 ± 2.88 | 14.75 ± 11.21 | ||||
| HYP | −9.45 ± 5.10 | −3.31 ± 2.90 | −6.96 ± 6.06 | |||||
| CAR | CITCO | 2.30 ± 7.44 | −2.84 ± 2.17 | 4.53 ± 7.27 | ||||
| DAS | −8.51 ± 4.56 | −6.59 ± 0.58 *** | −1.51 ± 4.86 | |||||
| FXR | CDCA | 6.32 ± 4.56 | −0.95 ± 1.55 | 6.86 ± 4.55 | ||||
| OA | 0.23 ± 6.27 | −2.75 ± 1.75 | 2.49 ± 6.13 | |||||
| Combined | GINK | −9.45 ± 5.10 | −3.31 ± 2.90 | −6.96 ± 6.06 | ||||
| GUG | 5.10 ± 9.79 | −5.00 ± 1.91 | 10.58 ± 8.10 | |||||
| (B) | Basal Expression Difference (PR-NR, ΔCT) | |||||||
| Transcript | PXR | CAR | FXR | Combined | ||||
| RIF | HYP | CITCO | DAS | CDCA | OA | GINK | GUG | |
| AKR1C1 | −1.66 ± 1.02 | −0.17 ± 1.21 | −0.35 ± 1.16 | −0.48 ± 1.79 | 0.17 ± 0.62 | 0.91 ± 0.86 | −0.17 ± 1.21 | −0.58 ± 1.18 |
| SULT2A1 | 0.11 ± 0.45 | −1.00 ± 0.67 | −0.52 ± 0.90 | −0.42 ± 0.66 | −0.54 ± 0.45 | 0.48 ± 0.94 | −1.00 ± 0.67 | 0.13 ± 0.79 |
| UGT1A1 | −0.26 ± 0.64 | −0.50 ± 0.56 | −0.90 ± 0.57 | −0.20 ± 0.62 | −1.44 ± 0.25 | −0.53 ± 0.91 | −0.50 ± 0.56 | −0.57 ± 0.56 |
| UGT1A6 | −0.079 ± 0.61 | 0.014 ± 0.42 | −0.35 ± 0.43 | 0.030 ± 0.54 | −0.23 ± 0.23 | 0.15 ± 0.41 | 0.014 ± 0.42 | −0.34 ± 0.43 |
| UGT2B31 | 0.08 ± 0.98 | 1.05 ± 0.49 | 0.55 ± 0.62 * | 1.35 ± 0.26 ** | 0.93 ± 0.33 | 1.03 ± 0.36 | 1.05 ± 0.49 | 0.62 ± 0.68 |
| UGT2A1 | 0.076 ± 0.90 | 0.79 ± 0.45 | 0.33 ± 0.60 | 0.66 ± 0.54 | 0.84 ± 0.29 | 0.93 ± 0.31 * | 0.79 ± 0.45 | 0.086 ± 0.61 |
| FXR | −0.79 ± 0.24 | −0.30 ± 0.35 | −0.73 ± 0.26 * | −0.23 ± 0.34 | −0.39 ± 0.21 | −0.33 ± 0.28 | −0.30 ± 0.35 | −0.62 ± 0.31 |
| PXR | −1.01 ± 0.32 | −0.28 ± 0.45 | −0.85 ± 0.35 | −0.45 ± 0.34 | −0.43 ± 0.27 | −0.34 ± 0.35 | −0.28 ± 0.45 | −0.95 ± 0.30 * |
| CAR | −0.12 ± 0.27 | 0.071 ± 0.35 | −0.012 ± 0.49 | 0.0030 ± 0.27 | −0.86 ± 0.17 | 0.12 ± 0.83 | 0.071 ± 0.35 | −0.080 ± 0.35 |
| NR0B2 | −1.46 ± 0.32 * | 0.36 ± 0.79 | −0.21 ± 0.72 | −0.015 ± 1.15 | 0.88 ± 0.38 | 0.28 ± 0.72 | 0.36 ± 0.79 | −0.59 ± 0.79 |
| NR2F1 | 0.13 ± 0.26 | 0.0075 ± 0.32 | 0.11 ± 0.45 | 0.065 ± 0.25 | −0.32 ± 0.19 | −0.52 ± 0.22 | 0.0075 ± 0.32 | 0.16 ± 0.32 |
| HNF1α | −3.32 ± 1.25 | −0.46 ± 2.12 | −2.10 ± 2.18 | −2.18 ± 1.40 | −3.13 ± 1.09 | −0.12 ± 2.87 | −0.46 ± 2.12 | −3.46 ± 1.43 |
| HNF4α | −0.39 ± 0.85 | −0.45 ± 0.49 | −0.13 ± 0.43 | −0.51 ± 0.77 | 0.37 ± 0.25 | −0.14 ± 0.38 | −0.45 ± 0.49 | −0.10 ± 0.55 |
| PGC1α | 0.20 ± 0.29 | −0.11 ± 0.46 | −0.12 ± 0.35 | 0.53 ± 0.23 | −0.34 ± 0.20 | −0.039 ± 0.36 | −0.11 ± 0.46 | 0.44 ± 0.31 |
| SIRT1 | 0.27 ± 0.25 | 0.59 ± 0.12 * | 0.59 ± 0.13 * | 0.48 ± 0.15 * | 0.18 ± 0.15 | 0.35 ± 0.19 | 0.59 ± 0.12 * | 0.41 ± 0.21 |
| SRC1 | 0.018 ± 0.47 | 0.39 ± 0.24 | 0.14 ± 0.33 | 0.46 ± 0.21 | −0.17 ± 0.17 | 0.33 ± 0.41 | 0.39 ± 0.24 | 0.13 ± 0.32 |
| HMGB1 | −0.44 ± 0.20 | 0.36 ± 0.32 | 0.16 ± 0.35 | 0.054 ± 0.38 | 0.59 ± 0.16 | 0.47 ± 0.25 | 0.36 ± 0.32 | −0.16 ± 0.33 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bone, C.; Squires, E.J. Natural Product-Induced Modulation of Androstenone Metabolism in Porcine Hepatocytes. Animals 2025, 15, 2199. https://doi.org/10.3390/ani15152199
Bone C, Squires EJ. Natural Product-Induced Modulation of Androstenone Metabolism in Porcine Hepatocytes. Animals. 2025; 15(15):2199. https://doi.org/10.3390/ani15152199
Chicago/Turabian StyleBone, Christine, and E. James Squires. 2025. "Natural Product-Induced Modulation of Androstenone Metabolism in Porcine Hepatocytes" Animals 15, no. 15: 2199. https://doi.org/10.3390/ani15152199
APA StyleBone, C., & Squires, E. J. (2025). Natural Product-Induced Modulation of Androstenone Metabolism in Porcine Hepatocytes. Animals, 15(15), 2199. https://doi.org/10.3390/ani15152199

