Copper Pyrithione Induces Hepatopancreatic Apoptosis and Metabolic Disruption in Litopenaeus vannamei: Integrated Transcriptomic, Metabolomic, and Histopathological Analysis
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design and Sample Collection
2.2. TUNEL Analysis for Hepatopancreas Cell Apoptosis
2.3. Transcriptome Sequencing, Analysis, and Validation
2.3.1. RNA Extraction, Library Construction, and RNA Sequencing
2.3.2. Alignment to Reference Genome
2.3.3. Identification of DEGs and Functional Enrichment Analysis
2.3.4. Validation of RNA-Seq Results with Quantitative Real-Time PCR (q-PCR)
2.4. Metabolite Extraction, Detection, and Analysis
2.4.1. Metabolite Extraction and Detection
2.4.2. Metabolite Analysis and Identification
2.5. Integrative Analysis of Metabolome and Transcriptome
3. Results
3.1. Apoptosis of Hepatopancreatic Cells After CuPT Exposure
3.2. Transcriptome Sequencing Results and Quality Analysis
3.3. Transcriptome Analysis of L. vannamei After CuPT Exposure
3.4. Metabolomic Analysis of L. vannamei After CuPT Exposed
3.5. Integrated Analysis of Metabolome and Transcriptome
4. Discussion
4.1. CuPT Exposure Affects Energy Metabolism
4.2. CuPT Exposure Affects Lipid Metabolism
4.3. CuPT Exposure Affects Detoxification and Immunity
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lavtizar, V.; Kimura, D.; Asaoka, S.; Okamura, H. The Influence of Seawater Properties on Toxicity of Copper Pyrithione and Its Degradation Product to Brine Shrimp Artemia Salina. Ecotoxicol. Environ. Saf. 2018, 147, 132–138. [Google Scholar] [CrossRef]
- Omae, I. Organotin Antifouling Paints and Their Alternatives. Appl. Organom. Chemis. 2003, 17, 81–105. [Google Scholar] [CrossRef]
- International Convention on the Control of Harmful Anti-fouling Systems on Ships AFS/CONF/26. Available online: https://www.imo.org/en/about/conventions/pages/international-convention-on-the-control-of-harmful-anti-fouling-systems-on-ships-(afs).aspx (accessed on 15 January 2022).
- Paz-Villarraga, C.A.; Castro, Í.B.; Fillmann, G. Biocides in Antifouling Paint Formulations Currently Registered for Use. Environ. Sci. Pollut. Res. 2022, 29, 30090–30101. [Google Scholar] [CrossRef] [PubMed]
- Bressy, C.; Briand, J.-F.; Lafond, S.; Davy, R.; Mazeas, F.; Tanguy, B.; Martin, C.; Horatius, L.; Anton, C.; Quiniou, F.; et al. What Governs Marine Fouling Assemblages on Chemically-Active Antifouling Coatings? Prog. Org. Coat. 2022, 164, 106701. [Google Scholar] [CrossRef]
- Turley, P.A.; Fenn, R.J.; Ritter, J.C. Pyrithiones as Antifoulants: Environmental Chemistry and Preliminary Risk Assessment. Biofouling 2000, 15, 175–182. [Google Scholar] [CrossRef]
- Turley, P.A.; Fenn, R.J.; Ritter, J.C.; Callow, M.E. Pyrithiones as Antifoulants: Environmental Fate and Loss of Toxicity. Biofouling 2005, 21, 31–40. [Google Scholar] [CrossRef]
- Maraldo, K.; Dahllöf, I. Indirect Estimation of Degradation Time for Zinc Pyrithione and Copper Pyrithione in Seawater. Mar. Pollut. Bull. 2004, 48, 894–901. [Google Scholar] [CrossRef]
- Harino, H.; Yamamoto, Y.; Eguchi, S.; Kawai, S.; Kurokawa, Y.; Arai, T.; Ohji, M.; Okamura, H.; Miyazaki, N. Concentrations of Antifouling Biocides in Sediment and Mussel Samples Collected from Otsuchi Bay, Japan. Arch. Environ. Contam. Toxicol. 2007, 52, 179–188. [Google Scholar] [CrossRef]
- Harino, H.; Midorikawa, S.; Arai, T.; Ohji, M.; Cu, N.D.; Miyazaki, N. Concentrations of Booster Biocides in Sediment and Clams from Vietnam. J. Mar. Biol. Ass. 2006, 86, 1163–1170. [Google Scholar] [CrossRef]
- Rodrigues, P.d.A.; Ferrari, R.G.; Kato, L.S.; Hauser-Davis, R.A.; Conte-Junior, C.A. A Systematic Review on Metal Dynamics and Marine Toxicity Risk Assessment Using Crustaceans as Bioindicators. Biol. Trace Elem. Res. 2021, 200, 881–903. [Google Scholar] [CrossRef]
- Su, Y.; Li, H.; Xie, J.; Xu, C.; Dong, Y.; Han, F.; Qin, J.G.; Chen, L.; Li, E. Toxicity of 4,5-Dichloro-2-n-Octyl-4-Isothiazolin-3-One (DCOIT) in the Marine Decapod Litopenaeus vannamei. Environ. Pollut. 2019, 251, 708–716. [Google Scholar] [CrossRef] [PubMed]
- Wei, S.; Hu, M.; Sokolova, I.; Tu, Z.; Chen, L.; Xu, P.; Mao, Y.; Wang, S.; Wang, Y. Laboratory-Simulated Marine Heatwave Enhances Physiological Damage to Mussels Exposed to Titanium Dioxide Nanoparticles by Disrupting the Gut−hepatopancreas Axis. J. Hazard. Mater. 2025, 486, 137006. [Google Scholar] [CrossRef] [PubMed]
- Thammatorn, W.; Cholewińska, P.; Kruangkum, T.; Palić, D. Aged Polyethylene Microplastics and Glyphosate-Based Herbicide Co-Exposure Toxicity in Pacific White Shrimp (Litopenaeus vannamei). Front. Mar. Sci. 2024, 11, 1384487. [Google Scholar] [CrossRef]
- Zeng, Y.; Deng, B.; Kang, Z.; Araujo, P.; Mjøs, S.A.; Liu, R.; Lin, J.; Yang, T.; Qu, Y. Tissue Accumulation of Polystyrene Microplastics Causes Oxidative Stress, Hepatopancreatic Injury and Metabolome Alterations in Litopenaeus vannamei. Ecotoxicol. Environ. Saf. 2023, 256, 114871. [Google Scholar] [CrossRef]
- Lv, H.; Park, J.; Lim, H.K.; Abraham, I.J.; Yin, X.; Gao, Y.; Hur, J. Impacts of Polyhydroxybutyrate (PHB) Microplastic Exposure on Physiology and Metabolic Profiles of Litopenaeus vannamei. Sci. Total Environ. 2024, 951, 175588. [Google Scholar] [CrossRef]
- Mochida, K.; Ito, K.; Harino, H.; Kakuno, A.; Fujii, K. Acute Toxicity of Pyrithione Antifouling Biocides and Joint Toxicity with Copper to Red Sea Bream (Pagrus major) and Toy Shrimp (Heptacarpus futilirostris). Environ. Toxic. Chem. 2006, 25, 3058–3064. [Google Scholar] [CrossRef]
- Bao, V.W.W.; Yeung, J.W.Y.; Leung, K.M.Y. Acute and Sub-Lethal Toxicities of Two Common Pyrithione Antifouling Biocides to the Marine Amphipod Elasmopus rapax. Toxicol. Environ. Health Sci. 2012, 4, 194–202. [Google Scholar] [CrossRef]
- Bao, V.W.W.; Lui, G.C.S.; Leung, K.M.Y. Acute and Chronic Toxicities of Zinc Pyrithione Alone and in Combination with Copper to the Marine Copepod Tigriopus japonicus. Aquat. Toxicol. 2014, 157, 81–93. [Google Scholar] [CrossRef]
- Chen, T.; Li, S.; Liang, Z.; Li, L.; Guo, H. Effects of Copper Pyrithione (CuPT) on Apoptosis, ROS Production, and Gene Expression in Hemocytes of White Shrimp Litopenaeus vannamei. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2022, 256, 109323. [Google Scholar] [CrossRef]
- Lee, S.; Haque, M.N.; Lee, D.-H.; Rhee, J.-S. Comparison of the Effects of Sublethal Concentrations of Biofoulants, Copper Pyrithione and Zinc Pyrithione on a Marine Mysid—A Multigenerational Study. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2023, 271, 109694. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An Ultra-Fast All-in-One FASTQ Preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Chen, S. Ultrafast One-Pass FASTQ Data Preprocessing, Quality Control, and Deduplication Using Fastp. iMeta 2023, 2, e107. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Yuan, J.; Sun, Y.; Li, S.; Gao, Y.; Yu, Y.; Liu, C.; Wang, Q.; Lv, X.; Zhang, X.; et al. Penaeid Shrimp Genome Provides Insights into Benthic Adaptation and Frequent Molting. Nat. Commun. 2019, 10, 356. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Paggi, J.M.; Park, C.; Bennett, C.; Salzberg, S.L. Graph-Based Genome Alignment and Genotyping with HISAT2 and HISAT-Genotype. Nat. Biotechnol. 2019, 37, 907–915. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. featureCounts: An Efficient General Purpose Program for Assigning Sequence Reads to Genomic Features. Bioinformatics 2013, 30, 923–930. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Kanehisa, M.; Goto, S. KEGG: Kyoto Encyclopedia of Genes and Genomes. Nucleic Acids Res. 2000, 28, 27–30. [Google Scholar] [CrossRef]
- R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2022; Available online: https://www.R-project.org (accessed on 15 January 2022).
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Thévenot, E.A.; Roux, A.; Xu, Y.; Ezan, E.; Junot, C. Analysis of the Human Adult Urinary Metabolome Variations with Age, Body Mass Index, and Gender by Implementing a Comprehensive Workflow for Univariate and OPLS Statistical Analyses. J. Proteome Res. 2015, 14, 3322–3335. [Google Scholar] [CrossRef]
- Yu, X.; Zhang, X.; Zhang, P.; Yu, C. Critical Swimming Speed, Tail-Flip Speed and Physiological Response to Exercise Fatigue in Kuruma Shrimp, Marsupenaeus japonicus. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2009, 153, 120–124. [Google Scholar] [CrossRef]
- Li, J.; Li, W.; Zhang, X.; He, P. Physiological and Behavioral Responses of Different Modes of Locomotion in the Whiteleg Shrimp Litopenaeus vannamei (Boone, 1931) (Caridea: Penaeidae). J. Crustac. Biol. 2018, 38, 79–90. [Google Scholar] [CrossRef]
- Cota-Ruiz, K.; Peregrino-Uriarte, A.B.; Felix-Portillo, M.; Martínez-Quintana, J.A.; Yepiz-Plascencia, G. Expression of Fructose 1,6-Bisphosphatase and Phosphofructokinase Is Induced in Hepatopancreas of the White Shrimp Litopenaeus vannamei by Hypoxia. Mar. Environ. Res. 2015, 106, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Shi, X.; Guo, J.; Mao, X.; Fan, B. Acute Stress Response in Gill of Pacific White Shrimp Litopenaeus vannamei to High Alkalinity. Aquaculture 2024, 586, 740766. [Google Scholar] [CrossRef]
- Chang, C.-H.; Zhou, X.-W.; Wang, Y.-C.; Lee, T.-H. Differential Effects of Hypothermal Stress on Lactate Metabolism in Fresh Water- and Seawater-Acclimated Milkfish, Chanos chanos. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2020, 248, 110744. [Google Scholar] [CrossRef]
- Sanchez, M.-P.; Guatteo, R.; Davergne, A.; Saout, J.; Grohs, C.; Deloche, M.-C.; Taussat, S.; Fritz, S.; Boussaha, M.; Blanquefort, P.; et al. Identification of the ABCC4, IER3, and CBFA2T2 Candidate Genes for Resistance to Paratuberculosis from Sequence-Based GWAS in Holstein and Normande Dairy Cattle. Genet. Sel. Evol. 2020, 52, 14. [Google Scholar] [CrossRef]
- He, L.; Vasiliou, K.; Nebert, D.W. Analysis and Update of the Human Solute Carrier (SLC) Gene Superfamily. Hum. Genom. 2009, 3, 195. [Google Scholar] [CrossRef]
- Lou, F.; Gao, T.; Han, Z. Effect of Salinity Fluctuation on the Transcriptome of the Japanese Mantis Shrimp Oratosquilla oratoria. Int. J. Biol. Macromol. 2019, 140, 1202–1213. [Google Scholar] [CrossRef]
- Wang, Z.; Zhao, R.; Jia, X.; Li, X.; Ma, L.; Fu, H. Three Novel SLC37A4 Variants in Glycogen Storage Disease Type 1b and a Literature Review. J. Int. Med. Res. 2023, 51, 03000605231216633. [Google Scholar] [CrossRef]
- Xiao, Y.; Zhang, Y.-M.; Xu, W.-B.; Chen, D.-Y.; Li, B.-W.; Cheng, Y.-X.; Guo, X.-L.; Dong, W.-R.; Shu, M.-A. The Effects of Salinities Stress on Histopathological Changes, Serum Biochemical Index, Non-Specific Immune and Transcriptome Analysis in Red Swamp Crayfish Procambarus clarkii. Sci. Total Environ. 2022, 840, 156502. [Google Scholar] [CrossRef]
- Wen, B.; Jin, S.-R.; Chen, Z.-Z.; Gao, J.-Z. Physiological Responses to Cold Stress in the Gills of Discus Fish (Symphysodon aequifasciatus) Revealed by Conventional Biochemical Assays and GC-TOF-MS Metabolomics. Sci. Total Environ. 2018, 640–641, 1372–1381. [Google Scholar] [CrossRef]
- Wu, X.; Lu, C.; Dong, X.; Zhang, Z.; Yang, M.; Xu, H. Proteomics Analysis of Zebrafish Brain Following Chronically Exposed to Bisphenol A. Toxicol. Environ. Chem. 2017, 99, 469–481. [Google Scholar] [CrossRef]
- Zhu, Y.; Xue, J.; Cao, J.; Xiao, H. A Potential Mechanism for Degradation of 4,5-Dichloro-2-(n-Octyl)-3[2H]-Isothiazolone (DCOIT) by Brown-Rot Fungus Gloeophyllum trabeum. J. Hazard. Mater. 2017, 337, 72–79. [Google Scholar] [CrossRef]
- Luo, Z.; Zhou, F.; Jiang, S.; Huang, J.; Yang, L.; Yang, Q.; Shi, J.; Li, E.; Ma, Z.; Li, Y. Immune and Physiological Responses in Penaeus monodon to Ammonia-N Stress: A Multi-Omics Approach. Front. Immunol. 2024, 15, 1510887. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.; Zhong, G.; Xiao, M.; Yang, Y.; Wang, Y.; Nan, Y. Integrated Physiological, Energy Metabolism, and Metabonomic Responses Indicate the Stress Response in the Hepatopancreas of Litopenaeus vannamei to Nitrite Stress. Aquat. Toxicol. 2024, 277, 107164. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.; Liu, Q.; Kan, D.; Zhao, W.; Guo, H.; Lv, L. Effects of Ammonia-N Exposure on the Growth, Metabolizing Enzymes, and Metabolome of Macrobrachium rosenbergii. Ecotoxicol. Environ. Saf. 2020, 189, 110046. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Meng, X.; Wei, Y.; Ma, Q.; Liang, M.; Turchini, G.M. Arachidonic Acid Matters. Rev. Aquac. 2022, 14, 1912–1944. [Google Scholar] [CrossRef]
- Duan, Y.; Zeng, S.; Lu, Z.; Dan, X.; Mo, Z.; Xing, Y.; Zhang, J.; Li, Y. Responses of Lipid Metabolism and Lipidomics in the Hepatopancreas of Pacific White Shrimp Litopenaeus vannamei to Microcystin-LR Exposure. Sci. Total Environ. 2022, 820, 153245. [Google Scholar] [CrossRef]
- Yu, Q.; Xia, C.; Han, F.; Xu, C.; Rombenso, A.; Qin, J.G.; Chen, L.; Li, E. Effect of Different Dietary Selenium Sources on Growth Performance, Antioxidant Capacity, Gut Microbiota, and Molecular Responses in Pacific White Shrimp Litopenaeus vannamei. Aquac. Nutr. 2022, 2022, 5738008. [Google Scholar] [CrossRef]
- Zhai, S.; Wang, Y.; He, Y.; Chen, X. Oligomeric Proanthocyanidins Counteracts the Negative Effects of High Level of Dietary Histamine on American Eel (Anguilla rostrata). Front. Mar. Sci. 2020, 7, 549145. [Google Scholar] [CrossRef]
- Khila, Z.; Trabelsi, W.; Bejaoui, S.; Beuret, M.; Belhassen, D.; Ben Abdallah, B.; Devin, S.; Soudani, N. New Insight into Barium Toxicity in the Gills of the European Clam (Ruditapes decussatus): A Focus on Redox Status, Fatty Acids Profiles, and Histological Structures. Aquat. Sci. 2025, 87, 23. [Google Scholar] [CrossRef]
- Deenarn, P.; Tobwor, P.; Vichai, V.; Phomklad, S.; Chaitongsakul, P.; Leelatanawit, R.; Wimuttisuk, W. Polychaete Consumption Increased Prostaglandin Biosynthesis in Female Penaeus monodon. Reproduction 2020, 160, 873–885. [Google Scholar] [CrossRef]
- Gagné, F.; Auclair, J.; Peyrot, C.; Wilkinson, K.J. The Influence of Zinc Chloride and Zinc Oxide Nanoparticles on Air-Time Survival in Freshwater Mussels. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2015, 172–173, 36–44. [Google Scholar] [CrossRef]
- Liu, X.; Liang, P.; Gao, X.; Shi, X. Induction of the Cytochrome P450 Activity by Plant Allelochemicals in the Cotton Bollworm, Helicoverpa armigera (Hübner). Pestic. Biochem. Physiol. 2006, 84, 127–134. [Google Scholar] [CrossRef]
- Palliyath, G.K. Meta-Analysis to Unravel Core Transcriptomic Responses in Penaeus vannamei Exposed to Biotic and Abiotic Stresses. Biochem. Genet. 2025, 63, 1459–1478. [Google Scholar] [CrossRef]
- Lien, N.T.K.; Ngoc, N.T.H.; Lan, N.N.; Hien, N.T.; Tung, N.V.; Ngan, N.T.T.; Hoang, N.H.; Binh, N.T.H. Transcriptome Sequencing and Analysis of Changes Associated with Insecticide Resistance in the Dengue Mosquito (Aedes aegypti) in Vietnam. Am. J. Trop. Med. Hyg. 2019, 100, 1240–1248. [Google Scholar] [CrossRef]
- Yu, D.; Zhai, Y.; He, P.; Jia, R. Comprehensive Transcriptomic and Metabolomic Analysis of the Litopenaeus vannamei Hepatopancreas After WSSV Challenge. Front. Immunol. 2022, 13, 826794. [Google Scholar] [CrossRef]
- Xue, Q.; Yang, B.; Luo, K.; Luan, S.; Kong, J.; Li, X.; Meng, X. Molecular Characterization and Expression Analysis of the C-Type Lectin Domain Family 4 Member F in Litopenaeus vannamei against White Spot Syndrome Virus. Animals 2024, 14, 1137. [Google Scholar] [CrossRef]










| Gene Name | Genebank ID | Sequences (5′-3′) |
|---|---|---|
| chi3l1 | XM_027369287.1 | F:ACTGCTCGTCCTACTTGCAC |
| R:GTCGAATTTGCCATCGCCAG | ||
| perlucin-like | XM_027364808.1 | F:CACCCAGGAACGTCTATGCT |
| R:TATCAGGCATCCCGTTAGCC | ||
| mrc1 | XM_027372201.1 | F:CGCCAACGCAGTTTAAGGAAG |
| R:TGTTCTCCTCCGTGTTCGTT | ||
| arsb | XM_027370159.1 | F:GAGTTACGTGCAGCCTCTGT |
| R:CCGATCATGTGCGTGGAGTA | ||
| apod | XM_027367111.1 | F: CACGGTCGCAGTTCACAAC |
| R:CATAGTCGGTGTCCAGCACG | ||
| cyp9e2 | XM_027375382.1 | F:GCCTCGGGTCTGAAAGTCTG |
| R:TGACCGATGAATGGGACCAC | ||
| cyp4c1 | XM_027375771.1 | F:TTCGGTTCTCGCCGTATCAG |
| R:GATCATGCACGTCGGGAGAA | ||
| zcchc3 | XM_027361571.1 | F:AGCGGTGTAAATCCTGCAAC |
| R:TTTTGACGCTGAAGTTGGCTG | ||
| slc37a2 | XM_027373750.1 | F:TACCACCTCTCAAGGAAGCC |
| R:CTAGGAGTGTTGCGGAGTTT | ||
| slc37a4 | XM_027355483.1 | F:ACCAACATGACTGTGAGGGAC |
| R:TGAAGCCACCCGTTTCTATGG | ||
| bche | XM_027371209.1 | F:CGCCCTTATCTGCACCACTT |
| R:GACACCAGGAACCGCATCTC | ||
| Pck1 | XM_027371589.1 | F:CTTCCATCTCCGTCACCCAT |
| R:AGTTGCTGTACTTGGGCAGG | ||
| phyh | XM_027363522.1 | F:GGGGAACGACACAGGAAAAC |
| R:CAGGCTGTCCTCTACGCCTC | ||
| glul | XM_027354704.1 | F:GCTCCAAGACACGTACCCTC |
| R:CTTGTAGGTCTCGCAGAGCA | ||
| β-actin | AF300705 | F:CATCAAGGAGAAACTGTGCTACG |
| R:CATGATGGAGTTGTAGGTGGTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, J.; Yang, Y.; Yu, S.; Jiang, C.; Su, X.; Zou, Y.; Guo, H. Copper Pyrithione Induces Hepatopancreatic Apoptosis and Metabolic Disruption in Litopenaeus vannamei: Integrated Transcriptomic, Metabolomic, and Histopathological Analysis. Animals 2025, 15, 2134. https://doi.org/10.3390/ani15142134
Guo J, Yang Y, Yu S, Jiang C, Su X, Zou Y, Guo H. Copper Pyrithione Induces Hepatopancreatic Apoptosis and Metabolic Disruption in Litopenaeus vannamei: Integrated Transcriptomic, Metabolomic, and Histopathological Analysis. Animals. 2025; 15(14):2134. https://doi.org/10.3390/ani15142134
Chicago/Turabian StyleGuo, Jieyu, Yang Yang, Siying Yu, Cairui Jiang, Xianbin Su, Yongfeng Zou, and Hui Guo. 2025. "Copper Pyrithione Induces Hepatopancreatic Apoptosis and Metabolic Disruption in Litopenaeus vannamei: Integrated Transcriptomic, Metabolomic, and Histopathological Analysis" Animals 15, no. 14: 2134. https://doi.org/10.3390/ani15142134
APA StyleGuo, J., Yang, Y., Yu, S., Jiang, C., Su, X., Zou, Y., & Guo, H. (2025). Copper Pyrithione Induces Hepatopancreatic Apoptosis and Metabolic Disruption in Litopenaeus vannamei: Integrated Transcriptomic, Metabolomic, and Histopathological Analysis. Animals, 15(14), 2134. https://doi.org/10.3390/ani15142134
