Development of a Melting Curve-Based Triple Eva Green Real-Time PCR Assay for Simultaneous Detection of Three Shrimp Pathogens
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples and Nucleic Acids
2.2. Design of Primers
2.3. Construction of the Standard Plasmids
2.4. Optimization of the Triple Eva Green Real-Time PCR Assay
2.5. Construction of Standard Curves
2.6. Specificity Analysis
2.7. Sensitivity Analysis
2.8. Repeatability Analysis
2.9. Detection of the Clinical Samples
3. Results
3.1. Primers Selection
3.2. Determination of the Optimal Reaction Conditions
3.3. Generation of Standard Curves and Sensitivity Analysis
3.4. Specificity Analysis
3.5. Repeatability Analysis
3.6. Detection of the Clinical Samples
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture 2020. Sustainability in Action; Food and Agriculture Organization of the United Nations: Rome, Italy, 2020. [Google Scholar] [CrossRef]
- FAO. The State of World Fisheries and Aquaculture 2022. Towards Blue Transformation; Food and Agriculture Organization of the United Nations: Rome, Italy, 2022; Available online: https://www.fao.org/3/cc0461en/cc0461en.pdf (accessed on 7 May 2023).
- Flegel, T.W. Historic emergence, impact and current status of shrimp pathogens in Asia. J. Invertebr. Pathol. 2012, 110, 166–173. [Google Scholar] [CrossRef]
- Lightner, D.V.; Redman, R.M.; Pantoja, C.R.; Tang, K.F.; Noble, B.L.; Schofield, P.; Mohney, L.L.; Nunan, L.M.; Navarro, S.A. Historic emergence, impact and current status of shrimp pathogens in the Americas. J. Invertebr. Pathol. 2012, 110, 174–183. [Google Scholar] [CrossRef]
- Tourtip, S.; Wongtripop, S.; Stentiford, G.D.; Bateman, K.S.; Sriurairatana, S.; Chavadej, J.; Sritunyalucksana, K.; Withyachumnarnkul, B. Enterocytozoon hepatopenaei sp. nov. (Microsporida: Enterocytozoonidae), a parasite of the black tiger shrimp Penaeus monodon (Decapoda: Penaeidae): Fine structure and phylogenetic relationships. J. Invertebr. Pathol. 2009, 102, 21–29. [Google Scholar] [CrossRef]
- Loh, P.C.; Lu, Y.; Brock, J.A. Growth of the penaeid shrimp virus infectious hypodermal and hematopoietic necrosis virus in a fish cell line. J. Virol. Methods 1990, 28, 273–280. [Google Scholar] [CrossRef]
- Bonami, J.R.; Trumper, B.; Mari, J.; Brehelin, M.; Lightner, D.V. Purification and characterization of the infectious hypodermal and haematopoietic necrosis virus of penaeid shrimps. J. Gen. Virol. 1990, 71 Pt 11, 2657–2664. [Google Scholar] [CrossRef]
- Xu, L.; Wang, T.; Li, F.; Yang, F. Isolation and preliminary characterization of a new pathogenic iridovirus from redclaw crayfish Cherax quadricarinatus. Dis. Aquat. Org. 2016, 120, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Qiu, L.; Chen, X.; Zhao, R.H.; Li, C.; Gao, W.; Zhang, Q.L.; Huang, J. Description of a natural infection with Decapod iridescent virus 1 in farmed giant freshwater prawn, Macrobrachium rosenbergii. Viruses 2019, 11, 354. [Google Scholar] [CrossRef] [PubMed]
- Aranguren, L.F.; Han, J.E.; Tang, K.F. Enterocytozoon hepatopenaei (EHP) is a risk factor for acute hepatopancreatic necrosis disease (AHPND) and septic hepatopancreatic necrosis (SHPN) in the Pacific white shrimp Penaeus vannamei. Aquaculture 2017, 471, 37–42. [Google Scholar] [CrossRef]
- Lopez-Carvallo, J.A.; Cruz-Flores, R.; Dhar, A.K. The emerging pathogen Enterocytozoon hepatopenaei drives a degenerative cyclic pattern in the hepatopancreas microbiome of the shrimp (Penaeus vannamei). Sci. Rep. 2022, 12, 14766. [Google Scholar] [CrossRef] [PubMed]
- Vega-Heredia, S.; Mendoza-Cano, F.; Sanchez-Paz, A. The infectious hypodermal and haematopoietic necrosis virus: A brief review of what we do and do not know. Transbound. Emerg. Dis. 2012, 59, 95–105. [Google Scholar] [CrossRef]
- Huang, Q.J.; Chen, Y.; Liu, H.; St-Hilaire, S.; Gao, S.; MacKinnon, B.; Zhu, S.Q.; Wen, Z.Q.; Jia, P.; Zheng, X.C. Establishment of a real-time Recombinase Polymerase Amplification (RPA) for the detection of decapod iridescent virus 1 (DIV1). J. Virol. Methods 2022, 300, 114377. [Google Scholar] [CrossRef] [PubMed]
- Tong, G.; Yin, W.; Wu, X.; Lin, Y.; Huang, G.; Chen, X.; Chen, X.; Huang, L.; Sun, T.; Wei, X.; et al. Rapid detection of Decapod iridescent virus 1 (DIV1) by recombinase polymerase amplification. J. Virol. Methods 2022, 300, 114362. [Google Scholar] [CrossRef] [PubMed]
- Ma, C.; Fan, S.; Wang, Y.; Yang, H.; Qiao, Y.; Jiang, G.; Lyu, M.; Dong, J.; Shen, H.; Gao, S. Rapid Detection of Enterocytozoon hepatopenaei Infection in Shrimp With a Real-Time Isothermal Recombinase Polymerase Amplification Assay. Front. Cell. Infect. Microbiol. 2021, 11, 631960. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Lv, Q.; He, Y.; Gu, R.; Zhou, B.; Chen, J.; Fan, X.; Pan, G.; Long, M.; Zhou, Z. Integrated qPCR and Staining Methods for Detection and Quantification of Enterocytozoon hepatopenaei in Shrimp Litopenaeus vannamei. Microorganisms 2020, 8, 1366. [Google Scholar] [CrossRef]
- Chen, B.K.; Dong, Z.; Pang, N.Y.; Nian, Y.Y.; Yan, D.C. A novel real-time PCR approach for detection of infectious hypodermal and haematopoietic necrosis virus (IHHNV) in the freshwater crayfish Procambarus clarkii. J. Invertebr. Pathol. 2018, 157, 100–103. [Google Scholar] [CrossRef] [PubMed]
- Cowley, J.A.; Rao, M.; Coman, G.J. Real-time PCR tests to specifically detect IHHNV lineages and an IHHNV EVE integrated in the genome of Penaeus monodon. Dis. Aquat. Org. 2018, 129, 145–158. [Google Scholar] [CrossRef]
- Qiu, L.; Chen, X.; Guo, X.M.; Gao, W.; Zhao, R.H.; Zhang, Q.L.; Yang, B.; Huang, J. A TaqMan probe based real-time PCR for the detection of Decapod iridescent virus 1. J. Invertebr. Pathol. 2020, 173, 107367. [Google Scholar] [CrossRef]
- Aloisio, M.; Morelli, M.; Elicio, V.; Saldarelli, P.; Ura, B.; Bortot, B.; Severini, G.M.; Minafra, A. Detection of four regulated grapevine viruses in a qualitative, single tube real-time PCR with melting curve analysis. J. Virol. Methods 2018, 257, 42–47. [Google Scholar] [CrossRef]
- Otaguiri, E.S.; Morguette, A.E.B.; Morey, A.T.; Tavares, E.R.; Kerbauy, G.; de Almeida Torres, R.S.L.; Chaves Junior, M.; Tognim, M.C.B.; Goes, V.M.; Krieger, M.A.; et al. Development of a melting-curve based multiplex real-time PCR assay for simultaneous detection of Streptococcus agalactiae and genes encoding resistance to macrolides and lincosamides. BMC Pregnancy Childbirth 2018, 18, 126. [Google Scholar] [CrossRef]
- Liu, Y.M.; Qiu, L.; Sheng, A.Z.; Wan, X.Y.; Cheng, D.Y.; Huang, J. Quantitative detection method of Enterocytozoon hepatopenaei using TaqMan probe real-time PCR. J. Invertebr. Pathol. 2018, 151, 191–196. [Google Scholar] [CrossRef]
- Tang, K.F.; Lightner, D.V. Detection and quantification of infectious hypodermal and hematopoietic necrosis virus in penaeid shrimp by real-time PCR. Dis. Aquat. Org. 2001, 44, 79–85. [Google Scholar] [CrossRef]
- Gao, Y.; Chen, C.Y.; Cao, Z.; Yuan, R.Q.; Chang, L.R.; Li, T.; Si, L.J.; Yan, D.C.; Li, F. Development of a duplex PCR for the simultaneous detection of EHP and IHHNV and analysis of the correlation between these two pathogens. J. Invertebr. Pathol. 2023, 201, 108013. [Google Scholar] [CrossRef]
- Li, M.; Li, Y.M.; Xiong, J.H.; Chen, X.L.; Jiang, W.M.; Zeng, D.G.; Peng, M.; Yang, C.L.; Ma, N.; Chen, X.H. Multiplex RT-PCR assay for detection of virus of invalid Penaeus vannamei in Guangxi. Southwest China J. Agric. Sci. 2009, 22, 1780–1784. [Google Scholar]
- Liu, F.; Zhang, B.C.; Zhang, X.H.; Huang, J. Multiplex PCR assay for simultaneous detection of six viruses in shrimp. Prog. Fish. Sci. 2014, 35, 60–67. [Google Scholar]
- Tavares, E.R.; de Lima, T.F.; Bartolomeu-Goncalves, G.; de Castro, I.M.; de Lima, D.G.; Borges, P.H.G.; Nakazato, G.; Kobayashi, R.K.T.; Venancio, E.J.; Tarley, C.R.T.; et al. Development of a melting-curve-based multiplex real-time PCR assay for the simultaneous detection of viruses causing respiratory infection. Microorganisms 2023, 11, 2692. [Google Scholar] [CrossRef] [PubMed]
- Cao, Z.; Chen, C.; Wang, C.; Li, T.; Chang, L.; Si, L.; Yan, D. Enterocytozoon hepatopenaei (EHP) infection alters the metabolic processes and induces oxidative stress in Penaeus vannamei. Animals 2023, 13, 3661. [Google Scholar] [CrossRef]
- Bureau of Fisheries, Ministry of Agriculture and Rural Affairs, P.R. China; National Fisheries Technology Extension Center, China Society of Fisheries. 2019 Aquatic Animal Health in China; China Agriculture Press: Beijing, China, 2019.
Primer | Sequence (5′–3′) | References |
---|---|---|
EHP-F157 | AGTAAACTATGCCGACAA | [22] |
EHP-R157 | AATTAAGCAGCACAATCC | |
EHP-TaqMan probe | FAM-TCCTGGTAGTGTCCTTCCGT-TAMRA | |
IHHNV-1608F | TACTCCGGACACCCAACCA | [23] |
IHHNV-1688R | GGCTCTGGCAGCAAAGGTAA | |
IHHNV-TaqMan probe | FAM-ACCAGACATAGAGCTACAATCCTCGCCTATTTG-TAMRA | |
DIV1-142F | AATCCATGCAAGGTTCCTCAGG | [19] |
DIV1-142R | CAATCAACATGTCGCGGTGAAC | |
DIV1-TaqMan probe | FAM-CCATACGTGCTCGCTCGGCTTCGG-TAMRA |
Primer | Sequence (5′–3′) | Amplicon Size (bps) | Tm (°C) |
---|---|---|---|
EHP-F | GCCGAGTTTGGCGGCACAATTCTCA | 117 | 76.0 |
EHP-R | CAGGTCCTACAAATGCTGTGTCTGTGTAA | ||
IHHNV-F | GCACCGCTACAAACAGCTATGGACCCG | 103 | 79.7 |
IHHNV-R | GCGCCGTACAGTTGGCTTTGGTTTGAC | ||
DIV1-F | GTTGGTGCGGCCCACAATGG | 79 | 81.4 |
DIV1-R | GTGAGGGGGCAACGGCGATA |
Sample Ct Values/Mg2+ Concentration | 1.5 mM | 2.0 mM | 2.5 mM | 3 mM |
---|---|---|---|---|
EHP-mean of Ct values | 27.03 | 26.69 | 27.02 | 27.26 |
EHP-standard deviation of Ct values | 0.10 | 0.50 | 0.17 | 0.16 |
IHHNV-mean of Ct values | 30.75 | 27.01 | 26.92 | 27.34 |
IHHNV-standard deviation of Ct values | 1.18 | 0.03 | 0.15 | 0.15 |
DIV1-mean Ct Value | 27.61 | 27.83 | 27.64 | 28.29 |
DIV1-standard deviation of Ct values | 0.26 | 0.08 | 0.22 | 0.01 |
Sample Ct Values/Primer Concentration | 0.3 μM | 0.4 μM | 0.5 μM | 0.6 μM |
---|---|---|---|---|
EHP-mean of Ct values | 26.70 | 26.69 | 27.14 | 27.11 |
EHP-standard deviation of Ct values | 0.14 | 0.04 | 0.14 | 0.07 |
IHHNV-mean of Ct values | —— | 26.74 | 27.58 | 27.39 |
IHHNV-standard deviation of Ct values | —— | 0.14 | 0.35 | 0.12 |
DIV1-mean Ct Value | —— | 27.48 | 27.99 | 30.02 |
DIV1-standard deviation of Ct values | —— | 0.12 | 0.40 | 0.81 |
Sample Ct Values/Annealing Temperature | 66 °C | 64 °C | 62 °C | 60 °C | 58 °C | 56 °C |
---|---|---|---|---|---|---|
EHP-mean of Ct values | 27.58 | 27.33 | 27.40 | 26.77 | 26.52 | 27.5 |
EHP-standard deviation of Ct values | 0.14 | 0.19 | 0.06 | 0.60 | 0.59 | 0.15 |
IHHNV-mean of Ct values | 31.23 | 27.69 | 27.56 | 26.89 | 27.18 | 26.37 |
IHHNV-standard deviation of Ct values | 0.14 | 0.21 | 0.04 | 0.31 | 0.30 | 1.46 |
DIV1-mean Ct Value | 28.24 | 27.93 | 28.37 | 27.86 | 28.32 | 28.47 |
DIV1-standard deviation of Ct values | 0.17 | 0.13 | 0.07 | 0.21 | 0.11 | 0.14 |
Plasmid | Concentration (Copies/μL) | Intra-Assay Ct | Inter-Assay Ct | ||||
---|---|---|---|---|---|---|---|
SD | CV (%) | SD | CV (%) | ||||
pUC57-EHP | 1.0 × 109 | 10.20 | 0.17 | 1.63 | 10.23 | 0.12 | 1.20 |
1.0 × 108 | 13.74 | 0.09 | 0.63 | 13.63 | 0.29 | 2.13 | |
1.0 × 107 | 16.72 | 0.05 | 0.27 | 16.35 | 0.41 | 2.54 | |
1.0 × 106 | 20.08 | 0.04 | 0.20 | 19.63 | 0.51 | 2.61 | |
1.0 × 105 | 23.35 | 0.09 | 0.36 | 22.91 | 0.50 | 2.17 | |
1.0 × 104 | 26.53 | 0.15 | 0.55 | 26.02 | 0.57 | 2.20 | |
1.0 × 103 | 29.70 | 0.02 | 0.05 | 29.27 | 0.48 | 1.62 | |
1.0 × 102 | 33.60 | 0.25 | 0.74 | 33.13 | 0.57 | 1.72 | |
pUC57-IHHNV | 1.0 × 109 | 9.81 | 0.20 | 2.04 | 9.89 | 0.23 | 2.31 |
1.0 × 108 | 13.38 | 0.14 | 1.05 | 13.32 | 0.20 | 1.53 | |
1.0 × 107 | 16.41 | 0.18 | 1.07 | 16.35 | 0.24 | 1.47 | |
1.0 × 106 | 19.89 | 0.16 | 0.81 | 19.90 | 0.18 | 0.90 | |
1.0 × 105 | 23.47 | 0.15 | 0.64 | 23.47 | 0.11 | 0.47 | |
1.0 × 104 | 26.78 | 0.19 | 0.71 | 26.67 | 0.21 | 0.79 | |
1.0 × 103 | 29.98 | 0.17 | 0.55 | 30.05 | 0.18 | 0.60 | |
1.0 × 102 | 32.29 | 0.39 | 1.22 | 32.62 | 0.47 | 1.44 | |
pUC57-DIV1 | 1.0 × 109 | 12.01 | 0.15 | 1.21 | 11.94 | 0.14 | 1.14 |
1.0 × 108 | 15.18 | 0.20 | 1.31 | 15.17 | 0.29 | 1.90 | |
1.0 × 107 | 18.24 | 0.21 | 1.18 | 18.03 | 0.31 | 1.75 | |
1.0 × 106 | 21.67 | 0.08 | 0.38 | 21.44 | 0.28 | 1.30 | |
1.0 × 105 | 25.21 | 0.23 | 0.90 | 25.02 | 0.27 | 1.07 | |
1.0 × 104 | 28.39 | 0.05 | 0.17 | 28.31 | 0.20 | 0.71 | |
1.0 × 103 | 31.68 | 0.34 | 1.08 | 31.50 | 0.54 | 1.70 | |
1.0 × 102 | 34.45 | 0.32 | 0,92 | 34.03 | 0.55 | 1.61 |
Pathogens | Total Clinical Samples | Positive Rate | |
---|---|---|---|
Triple Eva Green qPCR | TaqMan qPCR | ||
EHP | 190 | 10.5% (13/190) | 10.5% (13/190) |
IHHNV | 190 | 18.9% (29/190) | 18.9% (29/190) |
DIV1 | 190 | 44.2% (86/190) | 44.2% (86/190) |
EHP and IHHNVco-infection | 190 | 3.0% (7/190) | 3.0% (7/190) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dong, X.; Chen, Y.; Lou, H.; Wang, G.; Zhou, C.; Wang, L.; Li, X.; Luo, J.; Huang, J. Development of a Melting Curve-Based Triple Eva Green Real-Time PCR Assay for Simultaneous Detection of Three Shrimp Pathogens. Animals 2024, 14, 592. https://doi.org/10.3390/ani14040592
Dong X, Chen Y, Lou H, Wang G, Zhou C, Wang L, Li X, Luo J, Huang J. Development of a Melting Curve-Based Triple Eva Green Real-Time PCR Assay for Simultaneous Detection of Three Shrimp Pathogens. Animals. 2024; 14(4):592. https://doi.org/10.3390/ani14040592
Chicago/Turabian StyleDong, Xuan, Yujin Chen, Haoyu Lou, Guohao Wang, Chengyan Zhou, Liying Wang, Xuan Li, Jingfei Luo, and Jie Huang. 2024. "Development of a Melting Curve-Based Triple Eva Green Real-Time PCR Assay for Simultaneous Detection of Three Shrimp Pathogens" Animals 14, no. 4: 592. https://doi.org/10.3390/ani14040592
APA StyleDong, X., Chen, Y., Lou, H., Wang, G., Zhou, C., Wang, L., Li, X., Luo, J., & Huang, J. (2024). Development of a Melting Curve-Based Triple Eva Green Real-Time PCR Assay for Simultaneous Detection of Three Shrimp Pathogens. Animals, 14(4), 592. https://doi.org/10.3390/ani14040592