Next Article in Journal
Effects of Different Levels of Antarctic Krill Oil on the Ovarian Development of Macrobrachium rosenbergii
Previous Article in Journal
Expert Consultation: Factors Influencing End-of-Life Decision-Making for Dairy Cattle Across the United States Supply Chain
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 22
10.3390/ani14223312
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Efficacy of Plant Extracts and Probiotics on Growth and Gut Health in Chickens with Necrotic Enteritis

by
Ruiting Zhang
1,2,†,
Jia Yang
1,3,†,
Qingjie Wang
4,
Dandan Hu
2,
Qiping Zhao
1,
Shunhai Zhu
1,
Yu Qiao
1,
Fanghe Zhao
1,
Zhongchuang Wang
1,2,
Jinwen Wang
1,
Yu Yu
1,
Hongyu Han
1,
Lili Hao
3,* and
Hui Dong
1,*
1
Key Laboratory of Animal Parasitology of Ministry of Agriculture, Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Minhang, Shanghai 200241, China
2
College of Animal Science and Technology, Guangxi University, Nanning 530004, China
3
College of Animal Husbandry and Veterinary Medicine, Southwest Minzu University, Chengdu 610041, China
4
Shaanxi Provincial Center for Animal Disease Prevention and Control, Xi’an 710003, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2024, 14(22), 3312; https://doi.org/10.3390/ani14223312
Submission received: 15 October 2024 / Revised: 14 November 2024 / Accepted: 16 November 2024 / Published: 18 November 2024
(This article belongs to the Section Poultry)
Browse Figures
Versions Notes

Simple Summary

Necrotic enteritis, a severe intestinal disease in chickens caused by bacteria and parasites, poses a major challenge in poultry farming. Traditionally, antibiotics have been used to control this disease, but due to rising antibiotic resistance and regulatory restrictions, alternative treatments are needed. This study explored the use of four plant extracts—Astragalus, pomegranate peel, Sophora flavescens, and Artemisia annua—combined with a beneficial bacterium, Bacillus subtilis, to manage necrotic enteritis in chickens. Researchers found that pomegranate peel was effective, even surpassing a standard antibiotic in reducing inflammation and promoting growth. Some combinations, like S. flavescens extract with B. subtilis, showed increased tight junction proteins’ expression, while others, like pomegranate peel extract with B. subtilis, had reduced growth performance. This research highlights the potential of natural treatments as safe, effective options for farmers to improve chicken health, reduce reliance on antibiotics, and support sustainable poultry production.

Abstract

Necrotic enteritis (NE), caused by Clostridium perfringens, represents a major economic challenge to poultry production. This study evaluated the effects of four plant extracts—Astragalus, pomegranate peel, Sophora flavescens, and Artemisia annua—in combination with B. subtilis, as potential antibiotic alternatives for controlling NE. Using an experimentally induced NE model produced by coinfection with Eimeria maxima and C. perfringens, 288 chickens were divided into 12 groups to assess growth performance, intestinal lesions, and inflammatory markers. Compared with the enramycin group, the pomegranate peel extract group had a 9.9% increase in body weight gain (BWG), significant enhancement in claudin-2 expression, and reduced production of inflammatory factors. Compared with the infected control group, the combination of A. annua extract and B. subtilis resulted in the lowest intestinal lesion scores. The claudin-2, occludin, and zonula occludens-1 expression levels in the group treated with S. flavescens extract combined with B. subtilis increased to the highest levels compared to those in the healthy control group. These findings emphasize the potential of plant extracts, particularly pomegranate peel and A. annua with B. subtilis, as natural alternatives for NE management in poultry, providing a promising approach to reducing reliance on antibiotics.

1. Introduction

Necrotic enteritis (NE) is caused by Clostridium perfringens and is one of the most important and economically devastating infectious diseases in the global chicken industry [1,2]. The industry incurs annual costs exceeding USD 6 billion due to control measures, treatment, and lost production [3]. The Eimeria species belong to the phylum Apicomplexa, including Eimeria tenella, Eimeria acervulina, Eimeria maxima, Eimeria brunetti, Eimeria mitis, Eimeria necatrix, and Eimeria praecox, and parasitize in the intestines of chickens [4]. The consequences of infection include malabsorption, enteritis, and, in severe cases for some Eimeria species, mortality [5]. Among these species, E. maxima infection is considered one of the main factors inducing necrotic enteritis [6]. Eimeria-induced NE is associated with epithelial damage, which releases nutrients and serum, or triggers mucogenesis, creating a favorable environment for the colonization and growth of C. perfringens [7]. Outbreaks of coccidiosis often occur at the same time as NE [8]. For several decades, antibiotics and other drugs have been used preventively to control NE in commercial poultry [9]. However, due to the global movement to ban antibiotic use in animal food production and the emergence of drug resistance, NE has resurfaced as a serious threat to the poultry industry [10,11]. Consequently, there is an urgent need to identify natural alternatives for managing this disease and enhancing growth and production.
Plant extracts and probiotics are regarded as safe and effective natural alternatives, demonstrating growth-promoting activity, immunomodulation, pathogen inhibition, and antibacterial potential against a wide range of pathogens [9,12]. Plant extracts disrupt cell walls, membranes, proteins, and DNA of bacteria [13,14]. Previous reports showed that Astragalus polysaccharides extracted from Astragalus roots and artemisinin extracted from the stems and leaves of Artemisia annua improved the growth performance of chickens infected with Eimeria spp. and proved to be effective against NE [15,16,17,18]. In addition, pomegranate peel, which mainly contains polyphenols and ellagic acid, and Sophora flavescens, which contains matrine and oxymatrine, also exert inhibitory effects on Eimeria infections [19,20]. Bacillus subtilis, a probiotic bacterium, has antibacterial properties and promotes health through active substance production, competitive exclusion, immune enhancement, and digestion improvement [21,22,23,24]. However, the benefits of individual plant extracts or B. subtilis are often limited [25]. For example, in a previous report, the combination of Nigella sativa and Kefir resulted in a mortality rate of 14.06%, whereas the separate administration of N. sativa and Kefir yielded mortality rates of 31.25% and 23.44%, respectively [26]. Consequently, the synergistic application of a plant extract alongside probiotics may provide a more effective approach for addressing chronic NE.
Currently, there have been no reports on the independent treatment of NE with S. flavescens extract and pomegranate peel extract, as well as the effect evaluation of the combination of four plant extracts (Astragalus, pomegranate peel, S. flavescens, and A. annua) with B. subtilis. Therefore, in this article, this study utilized a co-infection model involving E. maxima and C. perfringens, which induced NE, to assess the effects of four plant extracts used alone or in combination with B. subtilis on the growth, intestinal lesions, intestinal inflammation, and other relevant factors in chickens.

2. Materials and Methods

2.1. Ethics Statement

The animal protocols were approved by the Institutional Animal Care and Use Committee of Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences (SHVRI-SZ-20230423-2).

2.2. Plant Extracts, Probiotics, Antibiotics

Four plant extracts, Astragalus (major active ingredients: 60% astragalus polysaccharides and 20% astragaloside), pomegranate peel (major active ingredients: 40% polyphenol, 20% ellagic acid, and 20% punicalagin), S. flavescens (major active ingredients: 35% matrine and 20% oxymatrine), and A. annua (major active ingredient: 98% artemisinin), were purchased from Anhui Xuancheng Baicao Pharmaceutical Co. Ltd. (Xuancheng, China). B. subtilis was obtained from Shanghai Chuangbo Ecological Engineering Co. Ltd. (Shanghai, China). Enramycin was purchased from Shandong Victory Biological (Jining, China). These plant extracts, B. subtilis, or enramycin were thoroughly mixed into the base diet.

2.3. Animals, C. perfringens, and E. maxima

One-day-old healthy three-yellow chickens were purchased from the Shanghai Minyou Poultry Farming Professional Cooperative, and were raised under conditions free of coccidia and antibiotics, with feed and water available ad libitum. Chickens were raised at a temperature of 35 °C and 65% humidity from 1 to 7 days. From 7 to 28 days, the temperature should be maintained above 30 °C, with the humidity controlled at 55%. E. maxima (Shanghai) and C. perfringens type A (CP11) were isolated and preserved by the Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences. E. maxima was maintained by inoculating 2–5-week-old coccidia-free chickens.

2.4. Experimental Design

A total of 288 1-day-old chickens were divided into 12 experimental groups based on random allocation and similar body weight. Each treatment group comprised three replicates, with eight chickens in each replicate. The experiment included an untreated and uninfected group (NC), untreated and infected group (PC), and 10 treated and infected groups (Table 1). Enramycin was used as a drug control. All chickens received a standardized basic diet (Table S1), and the 10 treatment groups were administered the corresponding drugs mixed into their feed from the beginning until the end of the experiment. The specific dosages of the additives are outlined in Table 1.
Except for the NC group, each chicken was inoculated with 30,000 sporulated oocysts of E. maxima at 14 days of age, and the number of sporulated oocysts was calculated using a McMaster counting chamber. On days 18, 19, and 20, each chicken, except for the NC group, was administered 1 mL CP11 at a concentration of 108 CFU/mL orally, which caused NE. The experiment lasted for 28 days, during which growth performance, jejunal lesions, jejunal villus height and crypt depth, and the expression of intestinal-related factors were recorded.

2.5. Growth Performance

The body weight (BW) and feed intake of the chickens were recorded on days 14 and 28 to calculate BW gain (BWG), the BWG rate (BWGR), and the feed conversion ratio (FCR) as follows [27].

2.6. Jejunum Lesion Score

At 28 days of age, all chickens were euthanized using the cervical dislocation euthanasia method, and their intestines were harvested for lesion scoring. Intestinal lesions were assessed on a scale from 0 to 4, with 0 indicating no visible lesions; 1+ signifying a thin-walled or fragile small intestine; 2+ representing focal necrosis or ulceration; 3+ indicating more extensive necrotic patches; and 4+ corresponding to severe, widespread necrosis [28].

2.7. Jejunal Villus Height and Crypt Depth

Jejunal samples were preserved in 4% paraformaldehyde, and then paraffin embedding, sectioning, and Hematoxylin and Eosin staining were all performed by Shanghai Yuxiu Biotechnology Co. Ltd. (Shanghai, China). From each slice, ten well-preserved intestinal villi were randomly selected for observation under an Olympus microscope (Model BX53; Olympus, Tokyo, Japan). The height of the villi and the corresponding crypt depth were measured using Image-Pro Plus software (version 6.0). Villus height was defined as the vertical distance from the tip of the villus to the villus–crypt junction, while crypt depth was the distance from this junction to the crypt base. The ratio of villus height to crypt depth was then calculated for analysis.

2.8. Determination of Intestinal-Related Factors Expression Levels

Total RNA was isolated from the jejunum of each group using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Genomic DNA was removed using RNase-free DNase I (40 U/mg; Takara, Tokyo, Japan). cDNAs were synthesized using a transcriptase kit (Invitrogen).
Specific primers for interleukin (IL)-1β, IL-6, tumor necrosis factor (TNF)-α, interferon (IFN)-γ, zonula occludens (ZO)-1, claudin-2, occludin, and the housekeeping gene β-actin were designed according to reference [29,30,31,32,33] and synthesized by Sangon Biotech (Shanghai) Co. Ltd. (Table 2).
QRT-PCR was conducted following the recommended procedure of the SYBR® Premix Ex Taq™ (Perfect Real Time) kit (Takara, Japan). The experiment was carried out in triplicate. Additionally, each group included three technical replicates, ensuring reliable and consistent results.

2.9. Statistical Analysis

Statistical analysis was conducted using SPSS 20.0 software (IBM, Armonk, NY, USA). Multivariate analysis of variance (MANOVA) was performed on all normally distributed data, followed by Duncan’s multiple comparison test to evaluate differences among treatments. The images were generated using GraphPad Prism 10 (San Diego, CA, USA). A significance level of p < 0.05 was considered statistically significant.

3. Results

3.1. All Group Growth Performance

The infected-untreated chickens (PC group) showed significantly reduced BWG (p < 0.05) and increased FCR (p < 0.05) compared with the uninfected control group (NC). The BWG of all treated groups, except for the PPL+BS group, was significantly increased compared to that of the PC group (p < 0.05). The BWG of the PPL group was significantly higher than that of the EN group, increasing 9.9% in BWG (p < 0.05). The BWG of the AST, AST+BS, and FLA+BS groups was similar to that of the EN group (p > 0.05). However, the BWG of the PPL+BS FLA, AA, AA+BS, and BS groups was significantly lower than that of the EN group, with reductions of 12.9%, 7.9%, 9.9%, 7.9%, and 7.9%, respectively (p < 0.05) (Table 3).
The FCR of all treated groups was significantly lower than that of the PC group (p < 0.05). But the FCR of the PPL group was similar to that of the NC group (p > 0.05), and both were significantly lower than that of the EN group. The FCR of the other treatment groups was similar to that of the EN group (p > 0.05) (Table 3).
It is worth noting that we used a low pathogenicity model, and no chickens died from NE.

3.2. Jejunal Lesion Scores

The jejunal lesion scores in the PC group were significantly elevated compared with those in the NC group (p < 0.05). All treated groups showed a decrease in lesion scores compared with the PC group (p < 0.05). Compared with the EN group, the lesion scores in the FLA group were significantly increased, while that of the AA+BS group was significantly decreased (p < 0.05) (Figure 1).

3.3. Jejunal Villus Height and Crypt Depth

The values for villus height (VH) in all treatment groups were higher than those in the PC group (436 μm), but the AST group (613 μm), PPL+BS group (650 μm), and BS group (637 μm) showed a statistically significant increase compared to the PC group (p < 0.05) (Figure 2a). Similarly, the values for crypt depth (CD) in all treated groups and NC group were lower than those in the PC group (114 μm) (p < 0.05) (Figure 2b). The villus height/crypt depth (VH/CD) ratio in the PC group (3.1) was significantly lower than that in the NC group (13.8) (p < 0.05) (Figure 2c). The VH/CD ratios of all treated groups were higher than that of the PC group, but the differences were not significant (p > 0.05) (Figure 2c). The histological staining image of the intestinal villi for each group can be found in Figure S1.

3.4. Tight Junction Proteins

The expression of claudin-2 and occludin in the PC group was significantly decreased compared with that in the NC group (p < 0.05), but the expression level of ZO-1 was similar between the PC group and NC group (p > 0.05) (Figure 3a–c). The expression of claudin-2 in the treated groups was higher than that in the PC group (p < 0.05) (Figure 3a). The expression of claudin-2 in the FLA+BS and PPL groups was significantly higher than that in the EN and other treated groups. However, the expression of claudin-2 in the BS group was significantly lower than that in the EN group (Figure 4a). The expression of occludin in the PPL+BS, FLA+BS, and BS groups was significantly higher than that in the EN group (p < 0.05) (Figure 3a). The expression of claudin-2 in the other treated groups was similar to that in the PC and EN groups (p > 0.05) (Figure 3b). The expression of ZO-1 in the FLA+BS and AA groups was significantly elevated compared with that in the PC and EN groups (p < 0.05). The FLA+BS group had the highest expression of ZO-1, which was significantly higher than that of all other groups (p < 0.05). The expression of ZO-1 in the other treated groups was similar to that in the PC and EN groups (p > 0.05) (Figure 3c).

3.5. Proinflammatory Cytokines

The expression of IL-1β, IL-6, IFN-γ, and TNF-α in the PC group was significantly increased compared with that in the NC group (p < 0.05) (Figure 4a–d). When compared with the PC group, IL-1β expression was significantly increased in the FLA+BS and AA groups (p < 0.05), significantly decreased in the PPL, PPL+BS, and FLA groups (p < 0.05), but not significantly different compared with the other treated groups (p > 0.05) (Figure 4a). All treated groups showed significantly lower IL-6 levels compared with the PC group (p < 0.05) (Figure 4b).
IFN-γ expression in the FLA+BS, AA, AA+BS, and EN groups was decreased compared with that in the PC group (p < 0.05). The IFN-γ expression level of the FLA group was similar to that of the NC and EN groups (p > 0.05), while the IFN-γ expression levels of the other groups are significantly lower than those of the NC and EN groups (p < 0.05) (Figure 4c).
TNF-α expression in the FLA+BS group was comparable to that in the PC group (p > 0.05) (Figure 4d). Its expression in the other treated groups was significantly lower than that in the PC group (p < 0.05) (Figure 4d).

4. Discussion

Coccidia species predispose towards the exacerbation of NE because Eimeria parasites undergo intracellular development in the gut that impairs the intestinal mucosa [34]. Different Eimeria species influence NE to different degrees [6]. E. maxima is a suitable predisposing factor in experimentally induced NE in chickens, causing physical damage to the upper intestinal epithelium and creating favorable conditions for the colonization and proliferation of C. perfringens [35]. So, co-infection with E. maxima followed by C. perfringens was used to develop our NE model in the present study.
E. maxima and C. perfringens infections compromise intestinal integrity and trigger inflammation, highlighting the importance of selecting plant extracts with antibacterial and anti-inflammatory properties that also preserve gut integrity. Consequently, Astragalus, pomegranate peel, S. flavescens, and A. annua were selected in this study to evaluate their efficacy against NE by using some clinical indicators, including BWG, FCR, and lesion scores. The intestinal morphology reflects the digestive and absorptive capacity of the intestine [36]. Tight junction proteins are crucial for maintaining the integrity of the intestinal barrier, while proinflammatory cytokines are associated with inflammation, which can affect metabolism and feed consumption [37,38]. So, in this study, these indexes were also measured. We found that the PPL group showed the best growth performance, the AA+BS group had the lowest lesion scores, and the FLA+BS group had the highest tight junction protein expression levels. Although the AST or AST+BS group was effective, their performance was not significantly higher than that of other treatment groups.
Astragalus extract contains polysaccharides that possess notable anti-inflammatory, antioxidant, and intestinal epithelial barrier-maintaining properties [39,40]. Previous research has demonstrated that adding Astragalus to feed can improve chicken’s BWG and FCR from 1 to 6 weeks, enhance the growth performance of chickens with NE, and modulate levels of tight junction proteins and cytokines [16]. In the present study, the growth performance of chickens fed a diet supplemented with Astragalus extract was significantly improved, and the jejunal lesion scores were decreased compared to that of the PC group, which is similar to that of the EN group. In addition, the expression of tight junction proteins claudin-2 and occludin was increased, whereas the expression of cytokines IL6, IFN-γ, and TNF-α was reduced. However, the combination of Astragalus extract with B. subtilis did not significantly enhance its anti-NE efficacy. The reason may be that both Astragalus extract and B. subtilis exert their anti-NE effect by regulating the gut microbiota and failing to have a synergistic effect [40].
Pomegranate peel extract is abundant in phenolic compounds and organic acids, which confer substantial antioxidant and antibacterial properties, while lowering intestinal pH to inhibit harmful bacteria [41,42,43]. Previous research found that the addition of 2–4 g of pomegranate peel powder per kilogram feed enhanced BWG and reduced FCR in chickens [44]. In the current study, dietary supplementation with pomegranate peel extract significantly enhanced the expression of claudin-2 and reduced the expression of proinflammatory cytokines, including IL-1β, IL-6, IFN-γ, and TNF-α, outperforming enramycin in its anti-NE effect. However, the coadministration of pomegranate peel extract with B. subtilis showed a significant reduction in anti-NE efficacy, suggesting potential antagonistic effects. Previous studies found that a concentration of 0.39 mg/mL of pomegranate peel extract was sufficient to inhibit the growth of B. subtilis in vitro [41].
S. flavescens extract contains alkaloids, flavonoids, and polysaccharides, providing anti-inflammatory and analgesic benefits, regulating gut microbiota, and repairing intestinal barriers to promote gut health [45,46]. In previous studies, the addition of 200 mg/kg of S. flavescens to feed, along with other plant extracts, enhanced chicken growth performance and intestinal barrier function [47]. In this investigation, compared to the PC group, feeding S. flavescens extract improved the growth performance of chickens and reduced jejunal lesion scores, the claudin-2 expression level was upregulated, and IL-1β, IL-6, IFN-γ, and TNF-α expression levels were significantly downregulated. But, its anti-NE efficacy was less effective than that of enramycin. The combination of S. flavescens extract with B. subtilis enhanced BWG and the expression of tight junction proteins, and reduced the lesion scores compared with either agent alone, resulting in the significant improvement of anti-NE efficacy. However, this combination also caused significant elevation in proinflammatory cytokines. The long-term use of S. flavescens has been shown to possess hepatotoxicity in mice [48]. Based on the increased inflammatory factors, we speculate that S. flavescens extract may exhibit a degree of toxicity in chickens. Moreover, the addition of B. subtilis enhances the benefits of S. flavescens extract in chickens, but may also accelerate its toxic effects.
A. annua extract, primarily composed of artemisinin, possesses antimalarial, antibacterial, and immunomodulating properties [17,18]. Previous studies have indicated that A. annua not only possesses efficacy against NE but can also resist coccidial infections [17,49]. In this study, dietary supplementation with A. annua extract led to an improvement in BWG and claudin-2, ZO-1, and IL-1β expression levels, and a significant decrease in IL-6 and TNF-α expression levels relative to those in the PC group. However, its anti-NE efficacy was less effective than enramycin. Its combination with B. subtilis reduced the jejunal lesion scores, which were lower than that in the enramycin group, highlighting the synergistic potential of this combination in mitigating intestinal damage. B. subtilis has been shown to combat intestinal damage [50]. We hypothesize that there is a synergistic interaction between A. annua extract and B. subtilis.
The previous research showed that plant extracts and probiotics have a synergistic effect. Plant extracts can act as prebiotics to provide substrates for probiotics. In addition, plant extracts metabolized by probiotics are often more easily absorbed and utilized by the host organism [51,52]. In this study, the efficacy of combining four plant extracts with B. subtilis for NE treatment was evaluated for the first time. We found a synergistic effect among S. flavescens extract and A. annua extract with B. subtilis. The combination of Astragalus extract with B. subtilis also leads to a certain enhanced effect in treating NE. However, we found that pomegranate peel extract used in combination with B. subtilis exhibited an antagonistic effect. We speculate that pomegranate peel may also have an inhibitory effect on the growth of B. subtilis in chicken. Therefore, in the future, we will investigate the effects of pomegranate peel extracts with other probiotics for NE treatment to explore whether there is a synergistic effect.

5. Conclusions

The study findings reveal that the independent application of four plant extracts or their co-administration with B. subtilis reduced the detrimental effects of NE. Among these plant extracts, the combination of pomegranate peel extract and A. annua extract with B. subtilis showed the best effect against NE. In addition, it was found that there was a synergistic effect of the combination of A. annua extract and S. flavescens extract with B. subtilis, but an antagonistic effect of the combination of pomegranate peel with B. subtilis. These results maybe provide valuable insights into the utilization of feed additives.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani14223312/s1, Table S1: Ingredients and composition of the experimental diets. Table S2: The p-values for each of the figures. Table S3: The specific numerical values for each figure are as follows. Figure S1: HE-stained slices of the intestine from each group.

Author Contributions

Conceptualization, H.D., J.Y., and L.H.; methodology, H.D. and J.Y.; software, R.Z. and J.W.; validation, D.H., Q.W., and Y.Y.; formal analysis, R.Z. and Y.Q.; investigation, R.Z. and Z.W.; resources, S.Z. and Q.Z.; data curation, F.Z.; writing—original draft preparation, R.Z. and J.Y.; writing—review and editing, H.H. and H.D.; visualization, Q.Z.; supervision, S.Z.; project administration, H.D. and L.H.; funding acquisition, H.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Research and Development of Science and Technology Plan in Tibet Autonomous Region (XZ202401ZY0052), National Natural Science Foundation of China (Grant No. 32373038), and the National Parasitic Resources Center (NPRC-2019-194-30).

Institutional Review Board Statement

The animal protocols were approved by the Institutional Animal Care and Use Committee of Shanghai Veterinary Research Institute, Chinese Academy of Agricultural Sciences (SHVRI-SZ-20230423-2).

Informed Consent Statement

Not applicable.

Data Availability Statement

All the data is in the article.

Acknowledgments

We thank International Science Editing (http://www.internationalscienceediting.com accessed on 30 September 2024) for editing this manuscript.

Conflicts of Interest

The authors declare no conflicts of interest. The funders had no role in the data; in the writing of the manuscript; or in the decision to publish the results.

References

  1. Skinner, J.T.; Bauer, S.; Young, V.; Pauling, G.; Wilson, J. An economic analysis of the impact of subclinical (mild) necrotic enteritis in broiler chickens. Avian Dis. 2010, 54, 1237–1240. [Google Scholar] [CrossRef] [PubMed]
  2. Lee, K.W.; Lillehoj, H.S.; Jeong, W.; Jeoung, H.Y.; An, D.J. Avian necrotic enteritis: Experimental models, host immunity, pathogenesis, risk factors, and vaccine development. Poult. Sci. 2011, 90, 1381–1390. [Google Scholar] [CrossRef] [PubMed]
  3. Emami, N.K.; Dalloul, R.A. Centennial Review: Recent developments in host-pathogen interactions during necrotic enteritis in poultry. Poult. Sci. 2021, 100, 101330. [Google Scholar] [CrossRef] [PubMed]
  4. He, P.; Chen, Z.; He, Y.; Chen, J.; Hayat, K.; Pan, J.; Lin, H. A reliable and low-cost deep learning model integrating convolutional neural network and transformer structure for fine-grained classification of chicken Eimeria species. Poult. Sci. 2023, 102, 102459. [Google Scholar] [CrossRef]
  5. Badri, M.; Olfatifar, M.; Hayati, A.; Bijani, B.; Samimi, R.; Abdoli, A.; Nowak, O.; Diaz, D.; Eslahi, A.V. The global prevalence and associated risk factors of Eimeria infection in domestic chickens: A systematic review and meta-analysis. Vet. Med. Sci. 2024, 10, e1469. [Google Scholar] [CrossRef]
  6. Nicholds, J.F.; McQuain, C.; Hofacre, C.L.; Mathis, G.F.; Fuller, A.L.; Telg, B.E.; Montoya, A.F.; Williams, S.M.; Berghaus, R.D.; Jones, M.K. The Effect of Different Species of Eimeria with Clostridium perfringens on Performance Parameters and Induction of Clinical Necrotic Enteritis in Broiler Chickens. Avian Dis. 2021, 65, 132–137. [Google Scholar] [CrossRef]
  7. Moore, R.J. Necrotic enteritis predisposing factors in broiler chickens. Avian Pathol. 2016, 45, 275–281. [Google Scholar] [CrossRef]
  8. Williams, R.B. Intercurrent coccidiosis and necrotic enteritis of chickens: Rational, integrated disease management by maintenance of gut integrity. Avian Pathol. 2005, 34, 159–180. [Google Scholar] [CrossRef]
  9. Kulkarni, R.R.; Gaghan, C.; Gorrell, K.; Sharif, S.; Taha-Abdelaziz, K. Probiotics as Alternatives to Antibiotics for the Prevention and Control of Necrotic Enteritis in Chickens. Pathogens 2022, 11, 692. [Google Scholar] [CrossRef]
  10. Patel, S.J.; Wellington, M.; Shah, R.M.; Ferreira, M.J. Antibiotic Stewardship in Food-producing Animals: Challenges, Progress, and Opportunities. Clin. Ther. 2020, 42, 1649–1658. [Google Scholar] [CrossRef]
  11. Tsiouris, V. Poultry management: A useful tool for the control of necrotic enteritis in poultry. Avian Pathol. 2016, 45, 323–325. [Google Scholar] [CrossRef] [PubMed]
  12. Ibrahim, D.; Abdelfattah-Hassan, A.; Badawi, M.; Ismail, T.A.; Bendary, M.M.; Abdelaziz, A.M.; Mosbah, R.A.; Mohamed, D.I.; Arisha, A.H.; El-Hamid, M. Thymol nanoemulsion promoted broiler chicken’s growth, gastrointestinal barrier and bacterial community and conferred protection against Salmonella Typhimurium. Sci. Rep. 2021, 11, 7742. [Google Scholar] [CrossRef] [PubMed]
  13. Ravipati, A.S.; Zhang, L.; Koyyalamudi, S.R.; Jeong, S.C.; Reddy, N.; Bartlett, J.; Smith, P.T.; Shanmugam, K.; Munch, G.; Wu, M.J.; et al. Antioxidant and anti-inflammatory activities of selected Chinese medicinal plants and their relation with antioxidant content. BMC Complement. Altern. Med. 2012, 12, 173. [Google Scholar] [CrossRef] [PubMed]
  14. Lei, X.; Wang, J.; Zuo, K.; Xia, T.; Zhang, J.; Xu, X.; Liu, Q.; Li, X. Alpinia officinarum Hance: A comprehensive review of traditional uses, phytochemistry, pharmacokinetic and pharmacology. Front. Pharmacol. 2024, 15, 1414635. [Google Scholar] [CrossRef]
  15. Guo, F.C.; Kwakkel, R.P.; Williams, C.B.; Suo, X.; Li, W.K.; Verstegen, M.W. Coccidiosis immunization: Effects of mushroom and herb polysaccharides on immune responses of chickens infected with Eimeria tenella. Avian Dis. 2005, 49, 70–73. [Google Scholar] [CrossRef]
  16. Song, B.; Li, P.; Yan, S.; Liu, Y.; Gao, M.; Lv, H.; Lv, Z.; Guo, Y. Effects of Dietary Astragalus Polysaccharide Supplementation on the Th17/Treg Balance and the Gut Microbiota of Broiler Chickens Challenged With Necrotic Enteritis. Front. Immunol. 2022, 13, 781934. [Google Scholar] [CrossRef]
  17. El-Demerdash, A.S.; Mohamady, S.N.; Megahed, H.M.; Ali, N.M. Evaluation of gene expression related to immunity, apoptosis, and gut integrity that underlies Artemisia’s therapeutic effects in necrotic enteritis-challenged broilers. 3 Biotech 2023, 13, 181. [Google Scholar] [CrossRef]
  18. Sharma, M.K.; Liu, G.; Choppa, V.; Rafieian-Naeini, H.R.; Mahdavi, F.S.; Marshall, B.; Gogal, R.J.; Kim, W.K. Effects of Artemisia annua supplementation on the performance and gut health of laying hens challenged with mixed Eimeria species. Front. Physiol. 2024, 15, 1381548. [Google Scholar] [CrossRef]
  19. Hafeez, A.; Piral, Q.; Naz, S.; Almutairi, M.H.; Alrefaei, A.F.; Ayasan, T.; Khan, R.U.; Losacco, C. Ameliorative Effect of Pomegranate Peel Powder on the Growth Indices, Oocysts Shedding, and Intestinal Health of Broilers under an Experimentally Induced Coccidiosis Condition. Animals 2023, 13, 3790. [Google Scholar] [CrossRef]
  20. Youn, H.J.; Noh, J.W. Screening of the anticoccidial effects of herb extracts against Eimeria tenella. Vet. Parasitol. 2001, 96, 257–263. [Google Scholar] [CrossRef]
  21. Lv, P.; Song, Y.; Liu, C.; Yu, L.; Shang, Y.; Tang, H.; Sun, S.; Wang, F. Application of Bacillus subtilis as a live vaccine vector: A review. J. Vet. Med. Sci. 2020, 82, 1693–1699. [Google Scholar] [CrossRef] [PubMed]
  22. Khochamit, N.; Siripornadulsil, S.; Sukon, P.; Siripornadulsil, W. Antibacterial activity and genotypic-phenotypic characteristics of bacteriocin-producing Bacillus subtilis KKU213: Potential as a probiotic strain. Microbiol. Res. 2015, 170, 36–50. [Google Scholar] [CrossRef]
  23. La Ragione, R.M.; Woodward, M.J. Competitive exclusion by Bacillus subtilis spores of Salmonella enterica serotype Enteritidis and Clostridium perfringens in young chickens. Vet. Microbiol. 2003, 94, 245–256. [Google Scholar] [CrossRef] [PubMed]
  24. Iqbal, S.; Begum, F.; Rabaan, A.A.; Aljeldah, M.; Al, S.B.; Alawfi, A.; Alshengeti, A.; Sulaiman, T.; Khan, A. Classification and Multifaceted Potential of Secondary Metabolites Produced by Bacillus subtilis Group: A Comprehensive Review. Molecules 2023, 28, 927. [Google Scholar] [CrossRef] [PubMed]
  25. Geng, T.; Ruan, X.; Xie, Y.; Shen, B.; Fang, R.; Zhao, J.; Zhou, Y. Anticoccidial activity of a botanical natural product based on eucalyptus, apigenin and eugenol against Eimeria tenella in broiler chickens. Parasites Vectors 2024, 17, 327. [Google Scholar] [CrossRef]
  26. Manjunatha, V.; Nixon, J.E.; Mathis, G.F.; Lumpkins, B.S.; Guzel-Seydim, Z.B.; Seydim, A.C.; Greene, A.K.; Jiang, X. Combined Effect of Nigella sativa and Kefir on the Live Performance and Health of Broiler Chickens Affected by Necrotic Enteritis. Animals 2024, 14, 2074. [Google Scholar] [CrossRef]
  27. Al-Khalaifah, H.S.; Shahin, S.E.; Omar, A.E.; Mohammed, H.A.; Mahmoud, H.I.; Ibrahim, D. Effects of graded levels of microbial fermented or enzymatically treated dried brewer’s grains on growth, digestive and nutrient transporter genes expression and cost effectiveness in broiler chickens. BMC Vet. Res. 2020, 16, 424. [Google Scholar] [CrossRef]
  28. Prescott, J.F.; Sivendra, R.; Barnum, D.A. The use of bacitracin in the prevention and treatment of experimentally-induced necrotic enteritis in the chicken. Can. Vet. J. 1978, 19, 181–183. [Google Scholar]
  29. Daneshmand, A.; Kermanshahi, H.; Mohammed, J.; Sekhavati, M.H.; Javadmanesh, A.; Ahmadian, M.; Alizadeh, M.; Razmyar, J.; Kulkarni, R.R. Intestinal changes and immune responses during Clostridium perfringens-induced necrotic enteritis in broiler chickens. Poult. Sci. 2022, 101, 101652. [Google Scholar] [CrossRef]
  30. Yin, L.; Hussain, S.; Tang, T.; Gou, Y.; He, C.; Liang, X.; Yin, Z.; Shu, G.; Zou, Y.; Fu, H.; et al. Protective Effects of Cinnamaldehyde on the Oxidative Stress, Inflammatory Response, and Apoptosis in the Hepatocytes of Salmonella Gallinarum-Challenged Young Chicks. Oxid. Med. Cell Longev. 2022, 2022, 2459212. [Google Scholar] [CrossRef]
  31. Zhang, X.; Zhao, Q.; Ci, X.; Chen, S.; Xie, Z.; Li, H.; Zhang, H.; Chen, F.; Xie, Q. Evaluation of the efficacy of chlorogenic acid in reducing small intestine injury, oxidative stress, and inflammation in chickens challenged with Clostridium perfringens type A. Poult. Sci. 2020, 99, 6606–6618. [Google Scholar] [CrossRef] [PubMed]
  32. Wang, W.; Li, Z.; Han, Q.; Guo, Y.; Zhang, B.; D’Inca, R. Dietary live yeast and mannan-oligosaccharide supplementation attenuate intestinal inflammation and barrier dysfunction induced by Escherichia coli in broilers. Brit J. Nutr. 2016, 116, 1878–1888. [Google Scholar] [CrossRef] [PubMed]
  33. Jiang, J.; Qi, L.; Wei, Q.; Shi, F. Maternal stevioside supplementation improves intestinal immune function of chicken offspring potentially via modulating gut microbiota and down-regulating the promoter methylation level of suppressor of cytokine signaling 1 (SOCS1). Anim. Nutr. 2022, 10, 329–346. [Google Scholar] [CrossRef] [PubMed]
  34. Lee, Y.; Park, I.; Lillehoj, H.S. Oral administration of chicken NK-lysin or recombinant chicken IL-7 improves vaccine efficacy of Eimeria tenella elongation factor-1alpha (EF-1alpha) against coccidiosis in commercial broiler chickens. Poult. Sci. 2023, 102, 102611. [Google Scholar] [CrossRef]
  35. Van Immerseel, F.; Rood, J.I.; Moore, R.J.; Titball, R.W. Rethinking our understanding of the pathogenesis of necrotic enteritis in chickens. Trends Microbiol. 2009, 17, 32–36. [Google Scholar] [CrossRef]
  36. Zhu, X.; Zhang, Y.; Zhao, Y.; Tao, L.; Liu, H.; Dong, W.; Yang, G.; Li, L. Effects of dietary supplementation with itaconic acid on the growth performance, nutrient digestibility, slaughter variables, blood biochemical parameters, and intestinal morphology of broiler chickens. Poult. Sci. 2022, 101, 101732. [Google Scholar] [CrossRef]
  37. Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef]
  38. Martin, L.N.; Scheuerlein, A.; Wikelski, M. Immune activity elevates energy expenditure of house sparrows: A link between direct and indirect costs? Proc. R. Soc. London. Ser. B Biol. Sci. 2003, 270, 153–158. [Google Scholar] [CrossRef]
  39. Jin, M.; Zhao, K.; Huang, Q.; Shang, P. Structural features and biological activities of the polysaccharides from Astragalus membranaceus. Int. J. Biol. Macromol. 2014, 64, 257–266. [Google Scholar] [CrossRef]
  40. Yang, J.; Sun, Y.; Wang, Q.; Yu, S.; Li, Y.; Yao, B.; Yang, X. Astragalus polysaccharides-induced gut microbiota play a predominant role in enhancing of intestinal barrier function of broiler chickens. J. Anim. Sci. Biotechnol. 2024, 15, 106. [Google Scholar] [CrossRef]
  41. Fawole, O.A.; Makunga, N.P.; Opara, U.L. Antibacterial, antioxidant and tyrosinase-inhibition activities of pomegranate fruit peel methanolic extract. BMC Complement. Altern. Med. 2012, 12, 200. [Google Scholar] [CrossRef] [PubMed]
  42. Endo, E.H.; Cortez, D.A.; Ueda-Nakamura, T.; Nakamura, C.V.; Dias, F.B. Potent antifungal activity of extracts and pure compound isolated from pomegranate peels and synergism with fluconazole against Candida albicans. Res. Microbiol. 2010, 161, 534–540. [Google Scholar] [CrossRef] [PubMed]
  43. Khan, R.U.; Naz, S.; Raziq, F.; Qudratullah, Q.; Khan, N.A.; Laudadio, V.; Tufarelli, V.; Ragni, M. Prospects of organic acids as safe alternative to antibiotics in broiler chickens diet. Environ. Sci. Pollut. Res. 2022, 29, 32594–32604. [Google Scholar] [CrossRef] [PubMed]
  44. Abdel, B.S.; Ashour, E.A.; Abd, E.M.; El-Mekkawy, M.M. Effect of different levels of pomegranate peel powder and probiotic supplementation on growth, carcass traits, blood serum metabolites, antioxidant status and meat quality of broilers. Anim. Biotechnol. 2022, 33, 690–700. [Google Scholar] [CrossRef]
  45. Wang, Y.; Shou, Z.; Fan, H.; Xu, M.; Chen, Q.; Tang, Q.; Liu, X.; Wu, H.; Zhang, M.; Yu, T.; et al. Protective effects of oxymatrine against DSS-induced acute intestinal inflammation in mice via blocking the RhoA/ROCK signaling pathway. Biosci. Rep. 2019, 39, BSR20182297. [Google Scholar] [CrossRef]
  46. Jia, Y.Q.; Yuan, Z.W.; Zhang, X.S.; Dong, J.Q.; Liu, X.N.; Peng, X.T.; Yao, W.L.; Ji, P.; Wei, Y.M.; Hua, Y.L. Total alkaloids of Sophora alopecuroides L. ameliorated murine colitis by regulating bile acid metabolism and gut microbiota. J. Ethnopharmacol. 2020, 255, 112775. [Google Scholar] [CrossRef]
  47. Liu, M.; Zhou, J.; Li, Y.; Ding, Y.; Lian, J.; Dong, Q.; Qu, Q.; Lv, W.; Guo, S. Effects of dietary polyherbal mixtures on growth performance, antioxidant capacity, immune function and jejunal health of yellow-feathered broilers. Poult. Sci. 2023, 102, 102714. [Google Scholar] [CrossRef]
  48. Gu, Y.; Lu, J.; Sun, W.; Jin, R.; Ohira, T.; Zhang, Z.; Tian, X. Oxymatrine and its metabolite matrine contribute to the hepatotoxicity induced by radix Sophorae tonkinensis in mice. Exp. Ther. Med. 2019, 17, 2519–2528. [Google Scholar] [CrossRef]
  49. Hezil, N.; Baazize-Ammi, D.; Abdelli, A.; Adel, A.; Kebbal, S.; Gharbi, I.; Djezzar, R.; Guetarni, D. Effects of Artemisia absinthium on broiler chicken coccidiosis: A systematic review and meta-analysis. Avian Pathol. 2024, 53, 350–358. [Google Scholar] [CrossRef]
  50. Ghimire, S.; Subedi, K.; Zhang, X.; Wu, C. Efficacy of Bacillus subtilis probiotic in preventing necrotic enteritis in broilers: A systematic review and meta-analysis. Avian Pathol. 2024, 53, 451–466. [Google Scholar] [CrossRef]
  51. Smulikowska, S.; Czerwinski, J.; Mieczkowska, A. Effect of an organic acid blend and phytase added to a rapeseed cake-containing diet on performance, intestinal morphology, caecal microflora activity and thyroid status of broiler chickens. J. Anim. Physiol. Anim. Nutr. 2010, 94, 15–23. [Google Scholar] [CrossRef]
  52. Xu, L.; Liao, J.; Li, X.; Zhu, L.; Wang, X.; Xu, B.; Li, L.; Ze, X.; Sun, H.; Li, J. Exploring the mechanism of probiotics in enhancing the utilization of chemical components (or polyphenols) of grape seed extract. Food Chem. 2024, 438, 137982. [Google Scholar] [CrossRef]
Animals 14 03312 g001
Figure 1. Effects of various supplementation groups on jejunal lesion scores in chickens with necrotic enteritis. a, b, c, d, e, Different letters indicate significant differences (p < 0.05). p value in Table S2; the specific numerical values for the images can be found in Table S3.
Figure 1. Effects of various supplementation groups on jejunal lesion scores in chickens with necrotic enteritis. a, b, c, d, e, Different letters indicate significant differences (p < 0.05). p value in Table S2; the specific numerical values for the images can be found in Table S3.
Animals 14 03312 g001
Animals 14 03312 g002
Figure 2. Effects of different supplementation groups on jejunal morphology in 28-day-old chickens. (a) VH of intestinal villi. (b) Intestinal CD. (c) VH/CD ratio in the small intestine. a, b, c, Different letters indicate significant differences (p < 0.05). p value in Table S2; the specific numerical values for the images can be found in Table S3.
Figure 2. Effects of different supplementation groups on jejunal morphology in 28-day-old chickens. (a) VH of intestinal villi. (b) Intestinal CD. (c) VH/CD ratio in the small intestine. a, b, c, Different letters indicate significant differences (p < 0.05). p value in Table S2; the specific numerical values for the images can be found in Table S3.
Animals 14 03312 g002
Animals 14 03312 g003
Figure 3. Effects of treatment on expression of tight junction proteins in 28-day-old chickens. (a) Expression of claudin-2 relative to that in the NC group. (b) Expression of occludin relative to that in the NC group. (c) Expression of ZO-1 relative to that in the NC group. a, b, c, d, e, Different letters indicate significant differences (p < 0.05). p value in Table S2; the specific numerical values for the images can be found in Table S3.
Figure 3. Effects of treatment on expression of tight junction proteins in 28-day-old chickens. (a) Expression of claudin-2 relative to that in the NC group. (b) Expression of occludin relative to that in the NC group. (c) Expression of ZO-1 relative to that in the NC group. a, b, c, d, e, Different letters indicate significant differences (p < 0.05). p value in Table S2; the specific numerical values for the images can be found in Table S3.
Animals 14 03312 g003
Animals 14 03312 g004
Figure 4. Effects of treatment on expression of proinflammatory cytokines in 28-day-old chickens. (a) Expression of IL-1β relative to that in the NC group. (b) Expression of IL-6 relative to that in the NC group. (c) Expression of IFN-γ relative to that in the NC group. (d) Expression of TNF-α relative to that in the NC group. a, b, c, d, Different letters indicate significant differences (p < 0.05). p value in Table S2; the specific numerical values for the images can be found in Table S3.
Figure 4. Effects of treatment on expression of proinflammatory cytokines in 28-day-old chickens. (a) Expression of IL-1β relative to that in the NC group. (b) Expression of IL-6 relative to that in the NC group. (c) Expression of IFN-γ relative to that in the NC group. (d) Expression of TNF-α relative to that in the NC group. a, b, c, d, Different letters indicate significant differences (p < 0.05). p value in Table S2; the specific numerical values for the images can be found in Table S3.
Animals 14 03312 g004
Table 1. Drug dosage schemes and experimental animal grouping.
Table 1. Drug dosage schemes and experimental animal grouping.
GroupsDietGroupsDiet
NCBasal dietFLABasal diet + 0.2 g/kg Sophora flavescens
PCBasal dietFLA+BSBasal diet + 0.2 g/kg Sophora flavescens + 1 g/kg B. subtilis
ASTBasal diet + 0.62 g/kg AstragalusAABasal diet + 1 g/kg Artemisia annua
AST+BSBasal diet + 0.62 g/kg Astragalus + 1 g/kg B. subtilisAA+BSBasal diet + 1 g/kg Artemisia annua + 1 g/kg B. subtilis
PPLBasal diet + 0.68 g/kg pomegranate peelBSBasal diet + 1 g/kg B. subtilis
PPL+BSBasal diet + 0.68 g/kg pomegranate peel + 1 g/kg B. subtilisENBasal diet + 10 mg/kg enramycin
Table 2. Sequences of primer pairs used for amplification of target and reference genes.
Table 2. Sequences of primer pairs used for amplification of target and reference genes.
GenePrimer (5′–3′)Gene Bank Accession Number
proinflammatory cytokinesIL-6 [29]CTGTTCGCCTTTCAGACCTACCHM179640.1
GACCACTTCATCGGGATTTATCA
IL-1β [30]GGTCAACATCGCCACCTACAXM_015297469.3
CATACGAGATGGAAACCAGCAA
TNF-α [31]TGTATGTGCAGCAACCCGTANM_204267.2
CCACACGACAGCCAAGTCAA
IFN-γ [31]GATGCCACCTTCTCTCACGANM_205427.1
GGATGTCGTGGGTGGTTTTG
tight junction proteinsZO-1 [32]CTTCAGGTGTTTCTCTTCCTCCTCXM_413773.4
CTGTGGTTTCATGGCTGGATC
Occludin [32]ACGGCAGCACCTACCTCAAD21837.1
GGGCGAAGAAGCAGATGAG
Claudin2 [33]CTGCTCACCCTCATTGGANM_001277622.1
AACTCACTCTTGGGCTTCTG
housekeeping geneβ-Actin [29]CCTGGCACCTAGCACAATGAANM_205518.2
GGTTTAGAAGCATTTGCGGTG
Table 3. Effects of different supplementation groups on growth, feed intake, and feed conversion rate in chickens.
Table 3. Effects of different supplementation groups on growth, feed intake, and feed conversion rate in chickens.
Groups14–28 Days
BWG/gBWGRp ValueFI/gFCRp Value
NC1290 ± 60 a127.7%12360 ± 451.830 c1
PC810 ± 150 e80.2%<0.00012260 ± 602.795 a<0.0001
AST950 ± 120 cd94.1%<0.00012260 ± 502.383 b<0.0001
AST+BS950 ± 130 cd94.1%<0.00012280 ± 452.401 b<0.0001
PPL1110 ± 120 b109.9%<0.00012230 ± 702.007 c0.0513
PPL+BS880 ± 100 de87.1%<0.00012220 ± 352.524 b<0.0001
FLA930 ± 100 d92.1%<0.00012290 ± 602.468 b<0.0001
FLA+BS1000 ± 160 c99.0%<0.00012280 ± 502.281 b<0.0001
AA910 ± 190 d90.1%<0.00012240 ± 702.457 b<0.0001
AA+BS930 ± 130 d92.1%<0.00012230 ± 502.403 b<0.0001
BS930 ± 160 d92.1%<0.00012220 ± 802.367 b<0.0001
EN1010 ± 110 c1<0.00012390 ± 552.371 b<0.0001
a, b, c, d, e Different letters in the same column indicate significant difference (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, R.; Yang, J.; Wang, Q.; Hu, D.; Zhao, Q.; Zhu, S.; Qiao, Y.; Zhao, F.; Wang, Z.; Wang, J.; et al. Comparative Efficacy of Plant Extracts and Probiotics on Growth and Gut Health in Chickens with Necrotic Enteritis. Animals 2024, 14, 3312. https://doi.org/10.3390/ani14223312

AMA Style

Zhang R, Yang J, Wang Q, Hu D, Zhao Q, Zhu S, Qiao Y, Zhao F, Wang Z, Wang J, et al. Comparative Efficacy of Plant Extracts and Probiotics on Growth and Gut Health in Chickens with Necrotic Enteritis. Animals. 2024; 14(22):3312. https://doi.org/10.3390/ani14223312

Chicago/Turabian Style

Zhang, Ruiting, Jia Yang, Qingjie Wang, Dandan Hu, Qiping Zhao, Shunhai Zhu, Yu Qiao, Fanghe Zhao, Zhongchuang Wang, Jinwen Wang, and et al. 2024. "Comparative Efficacy of Plant Extracts and Probiotics on Growth and Gut Health in Chickens with Necrotic Enteritis" Animals 14, no. 22: 3312. https://doi.org/10.3390/ani14223312

APA Style

Zhang, R., Yang, J., Wang, Q., Hu, D., Zhao, Q., Zhu, S., Qiao, Y., Zhao, F., Wang, Z., Wang, J., Yu, Y., Han, H., Hao, L., & Dong, H. (2024). Comparative Efficacy of Plant Extracts and Probiotics on Growth and Gut Health in Chickens with Necrotic Enteritis. Animals, 14(22), 3312. https://doi.org/10.3390/ani14223312

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop