Synchronously Mature Intersex Japanese Flounder (Paralichthys olivaceus): A Rare Case
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Dissection
2.3. Histology
2.4. DNA Isolation and Whole-Genome Resequencing
2.5. Steroid Hormone Measurement Using Enzyme-Linked Immunosorbent Assay (ELISA)
2.6. Quantitative Real-Time PCR (qRT-PCR)
2.7. Measuring Experimental Indicators
2.8. Statistics
3. Results
3.1. Physical Description of Intersex Flounder
3.2. Histological Characteristics of the Intersex Flounder
3.3. The Intersex Flounder Produced Both Eggs and Sperm
3.4. The Intersex Flounder Had Unique Endocrine Characteristics
3.5. The Intersex Flounder Had Unique Gene Expression Profiles
3.6. Resequencing and Activity Detection Revealed cyp21a (Steroid 21-Hydroxylase-like Gene, LOC109633161) Gene Mutation in the Intersex Flounder
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kobayashi, Y.; Nagahama, Y.; Nakamura, M. Diversity and plasticity of sex determination and diferentiation in fishes. Sex. Dev. 2013, 7, 115–125. [Google Scholar] [CrossRef] [PubMed]
- Avise, J.C.; Mank, J.E. Evolutionary perspectives on hermaphroditism in fishes. Sex. Dev. 2009, 3, 152–163. [Google Scholar] [CrossRef] [PubMed]
- Casas, L.; Saborido-Rey, F.; Ryu, T.; Michell, C.; Ravasi, T.; Irigoien, X. Sex change in clownfish: Molecular insights from transcriptome analysis. Sci. Rep. 2016, 6, 35461. [Google Scholar] [CrossRef] [PubMed]
- Nakadera, Y.; Koene, J.M. Reproductive strategies in hermaphroditic gastropods: Conceptual and empirical approaches. Can. J. Zool. 2013, 91, 367–381. [Google Scholar] [CrossRef]
- Pieplow, C.A.; Furze, A.R.; Wessel, G.M. A case of hermaphroditism in the gonochoristic sea urchin, Strongylocentrotus purpuratus, reveals key mechanisms of sex determination. Biol. Reprod. 2023, 108, 960–973. [Google Scholar] [CrossRef]
- Robert, H.D.; Nagahama, Y. Sex determination and sex differentiation in fish: An overview of genetic, physiological, and environmental influences. Aquaculture 2002, 208, 191–364. [Google Scholar]
- Komen, J.; de Boer, P.; Richter, C.J.J. Male sex reversal in gynogenetic XX females of common carp Cyprinus carpio L. by a recessive mutation in a sex-determining gene. J. Hered. 1992, 83, 431–434. [Google Scholar] [CrossRef]
- Tang, H.P.; Chen, Y.; Liu, Y.; Yin, Y.K.; Li, G.F.; Guo, Y.; Liu, X.C.; Lin, H.R. New Insights Into the Role of Estrogens in Male Fertility Based on Findings in romatase-Deficient Zebrafish. Endocrinology 2017, 158, 3042–3054. [Google Scholar] [CrossRef] [PubMed]
- Ortiz-Zarragoitia, M.; Bizarro, C.; Rojo-Bartolomé, I.; Diaz de Cerio, O.; Cajaraville, M.P.; Cancio, L. Mugilid fish are sentinels of exposure to endocrine disrupting compounds in coastal and estuarine environments. Mar. Drugs 2014, 12, 4756–4782. [Google Scholar] [CrossRef]
- Baldi, C.; Cho, S.; Ellis, R.E. Mutations in two independent pathways are sufficient to create hermaphroditic nematodes. Science 2009, 326, 1002–1005. [Google Scholar] [CrossRef]
- Ávila-Hernández, J.G.; Cárdenas-Aquino, M.D.R.; Camas-Reyes, A.; Martínez-Antonio, A. Sex determination in papaya: Current status and perspectives. Plant Sci. 2023, 335, 111814. [Google Scholar] [CrossRef] [PubMed]
- Senthilkumaran, B.; Kar, S. Advances in Reproductive Endocrinology and Neuroendocrine Research Using Catfish Models. Cells 2021, 10, 2807. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Oakes, J.A.; Storbeck, K.H.; Cunliffe, V.T.; Krone, N.P. The P450 side-chain cleavage enzyme Cyp11a2 facilitates steroidogenesis in zebrafish. J. Endocrinol. 2020, 244, 309–321. [Google Scholar] [CrossRef] [PubMed]
- Rojo-Bartolomé, I.; Valencia, A.; Cancio, I. Transcription of ribogenesis genes in fish gonads: Applications in the identification of stages of oogenesis and in environmental monitoring of intersex condition. Mar. Pollut. Bull. 2017, 121, 292–301. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Yu, Y.; Lu, Z.Y.; Ding, Y.; Fan, Q.X.; Shen, Z.G. Induction of XX pseudo-males, and larger-scale reproduction of all-female population in yellow catfish. Acta Hydrobiol. Sin. 2022, 12, 1939–1948. [Google Scholar]
- Li, Z.; Wang, L.J.; Zou, C.C.; Shu, C.; Wu, Z.H.; Zou, Y.X.; You, F. Expression characteristics and function of Anti-Müllerian hormone receptor II gene (amhr2) in Paralichthys olivaceus. J. Thorac. Oncol. 2024, 1, 94–106. [Google Scholar]
- Hattori, R.S.; Kumazawa, K.; Nakamoto, M.; Nakano, Y.; Yamaguchi, T.; Kitano, T.; Yamamoto, E.; Fuji, K.; Sakamoto, T. Y-specific amh allele, amhy, is the master sex-determining gene in Japanese flounder Paralichthys olivaceus. Front. Genet. 2022, 13, 1007548. [Google Scholar] [CrossRef]
- Maekawa, M.; Yoshii, E.; Akase, Y.; Huang, H.; Yoshikawa, S.; Matsuda, M.; Kuruma, Y.; Sawayama, E. Sex-Associated SNP Confirmation of Sex-Reversed Male Farmed Japanese Flounder Paralichthys olivaceus. Mar. Biotechnol. 2023, 25, 718–728. [Google Scholar] [CrossRef]
- Kitano, T.; Takamune, T.; Nagahama, Y.; Abe, S.I. Aromatase inhibitor and 17a-methyltestosterone cause sex-reversal from genetical females to phenotypic males and suppression of P450 aromatase gene expression in Japanese flounder (Paralichthys olivaceus). Mol. Reprod. Dev. 2000, 56, 1–5. [Google Scholar] [CrossRef]
- Chen, S.C.; Zhou, Y.Q.; Chen, Y.R.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef]
- Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef] [PubMed]
- Van der Auwera, G.A.; Carneiro, M.O.; Hartl, C.; Poplin, R.; Del Angel, G.; Levy-Moonshine, A.; Jordan, T.; Shakir, K.; Roazen, D.; Thibault, J.; et al. From FastQ data to high confidence variant calls: The Genome Analysis Toolkit best practices pipeline. Curr. Protoc. Bioinform. 2013, 11, 11.10.1–11.10.33. [Google Scholar] [CrossRef] [PubMed]
- Purcell, S.; Neale, B.; Todd-Brown, K.; Thomas, L.; Ferreira, M.A.R.; Bender, D.; Maller, J.; Sklar, P.; Bakker, P.I.W.D.; Daly, M.J.; et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 2007, 81, 559–575. [Google Scholar] [CrossRef] [PubMed]
- Danecek, P.; Auton, A.; Abecasis, G.; Albers, C.A.; Banks, E.; DePristo, M.A.; Handsaker, R.E.; Lunter, G.; Marth, G.T.; Sherry, S.T.; et al. The variant call format and VCFtools. Bioinformatics 2011, 27, 2156–2158. [Google Scholar] [CrossRef] [PubMed]
- Yoshinaga, N.; Shiraishi, E.; Yamamoto, T.; Iguchi, T.; Abe, S.I.; Kitano, T. Sexually dimorphic expression of a teleost homologue of Müllerian inhibiting substance during gonadal sex differentiation in Japanese flounder, Paralichthys olivaceus. Biochem. Biophys. Res. Commun. 2004, 322, 508–513. [Google Scholar] [CrossRef]
- Schultz, R.J. Unisexual fish: Laboratory synthesis of a “species”. Science 1973, 179, 180–181. [Google Scholar] [CrossRef]
- Harris, C.A.; Hamilton, P.B.; Runnalls, T.J.; Vinciotti, V.; Henshaw, A.; Hodgson, D.; Coe, T.S.; Jobling, S.; Tyler, C.R.; Sumpter, J.P. The consequences of feminization in breeding groups of wild fish. Environ. Health Perspect. 2011, 119, 306–311. [Google Scholar] [CrossRef]
- Ma, X.B.; Wang, G.X.; Liu, H.J.; Jiang, X.F. Genetic diversity analysis of the offshore Japanese flounder (Paralichthys olivaceus) population within Qinhuangdao, China. Jersey Financ. Serv. Comm. 2012, 19, 963–969. [Google Scholar]
- Sun, P.; Wu, Z.H.; You, F.; Li, J. Annual cycle change of sex steroid hormones in cultured Paralichthys olivaceus. Mar. Fish. 2013, 4, 453–459. [Google Scholar]
- Yamamoto, T. Sex differentiation. In Fish Physiology; Hoar, W., Randall, D., Eds.; Academic Press: Cambridge, MA, USA, 1969; pp. 117–175. [Google Scholar]
- Tomy, S. Estrogenic Regulation of Reproduction in Teleosts. In Recent Updates in Molecular Endocrinology and Reproductive Physiology of Fish; Sundaray, J.K., Rather, M.A., Kumar, S., Agarwal, D., Eds.; Springer: Singapore, 2021. [Google Scholar]
- Weinbauer, G.F.; Nieschlag, E. The role of testosterone in spermatogenesis. In Testosterone; Nieschlag, E., Behre, H.M., Eds.; Springer: Berlin/Heidelberg, Germany, 1998. [Google Scholar]
- Miller, W.L.; Auchus, R.J. The molecular biology, biochemistry, and physiology of human steroidogenesis and its disorders. Endocr. Rev. 2011, 32, 81–151. [Google Scholar] [CrossRef]
- El-Maouche, D.; Arlt, W.; Merke, D.P. Congenital adrenal hyperplasia. Lancet 2017, 390, 2194–2210. [Google Scholar] [CrossRef] [PubMed]
- Reisch, N. Substitution therapy in adult patients with congenital adrenal hyperplasia. Best Pract. Res. Clin. Endocrinol. Metab. 2015, 29, 33–45. [Google Scholar] [CrossRef] [PubMed]
- Golshan, M.; Alavi, S.M.H. Androgen signaling in male fishes: Examples of anti-androgenic chemicals that cause reproductive disorders. Theriogenology 2019, 139, 58–71. [Google Scholar] [CrossRef] [PubMed]


indicates the intersex, ♂ indicates male, ♀ indicates female, ↑ indicates up-regulated, ↓ indicates down-regulated.
indicates the intersex, ♂ indicates male, ♀ indicates female, ↑ indicates up-regulated, ↓ indicates down-regulated.
| Primers | Sequence (5′–3′) |
|---|---|
| cyp19a-F | TTGGGAGCAAGCAGGGACT |
| cyp19a-R | TGGTGAAATGGGTGCGTAT |
| amh-F | TATCGCTGGGCTTGTCCTC |
| amh-R | CCCCTTATCACCTCCATCAT |
| dmrt1-F | GGCACCAGCACAGGCATCG |
| dmrt1-R | AGCGGGAGCACTTGGGCAT |
| β-actin-F | GGAAATCGTGCGTGACATTAAG |
| β-actin-R | CCTCTGGACAACGGAACCTCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, T.; Cao, W.; San, L.; Xu, Z.; Wang, G.; He, Z.; Liu, Y.; Ren, Y.; Wang, Y.; Zhang, X.; et al. Synchronously Mature Intersex Japanese Flounder (Paralichthys olivaceus): A Rare Case. Animals 2024, 14, 2948. https://doi.org/10.3390/ani14202948
Han T, Cao W, San L, Xu Z, Wang G, He Z, Liu Y, Ren Y, Wang Y, Zhang X, et al. Synchronously Mature Intersex Japanese Flounder (Paralichthys olivaceus): A Rare Case. Animals. 2024; 14(20):2948. https://doi.org/10.3390/ani14202948
Chicago/Turabian StyleHan, Tian, Wei Cao, Lize San, Zixiong Xu, Guixing Wang, Zhongwei He, Yufeng Liu, Yuqin Ren, Yufen Wang, Xiaoyan Zhang, and et al. 2024. "Synchronously Mature Intersex Japanese Flounder (Paralichthys olivaceus): A Rare Case" Animals 14, no. 20: 2948. https://doi.org/10.3390/ani14202948
APA StyleHan, T., Cao, W., San, L., Xu, Z., Wang, G., He, Z., Liu, Y., Ren, Y., Wang, Y., Zhang, X., & Hou, J. (2024). Synchronously Mature Intersex Japanese Flounder (Paralichthys olivaceus): A Rare Case. Animals, 14(20), 2948. https://doi.org/10.3390/ani14202948

