The Effects of Tachykinin1 Gene Products on Prepubertal Dabry’s Sturgeon (Acipenser dabrynus) Pituitary Hormone Secretion and Gene Expression
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals Preparation
2.2. In Vivo SP and NKA Treatments and Sampling Procedure
2.3. Pituitary Cell Culture
2.4. Total RNA Extraction and Reverse Transcription
2.5. Real-Time Quantitative PCR
2.6. Detection of Lh Content by ELISA
3. Results
3.1. Molecular Cloning of Dabry’s Sturgeon TAC1 and Tissue Experssion
3.2. In Vivo Effect of NKA and SP on Gonadotropin Expression in Dabry’s Sturgeon
3.3. Effects of TAC1 Gene Products on Gonadotropin in the Pituitary Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhuang, P.; Ke, F.; Wei, Q.; He, X.; Cen, Y. Biology and life history of Dabry’s sturgeon, Acipenser dabryanus, in the Yangtze River. Environ. Biol. Fish. 1997, 48, 257–264. [Google Scholar] [CrossRef]
- Zhang, H.; Wei, Q.W.; Du, H.; Li, L.X. Present status and risk for extinction of the Dabry’s sturgeon (Acipenser dabryanus) in the Yangtze River watershed: A concern for intensified rehabilitation needs. J. Appl. Ichthyol. 2011, 27, 181–185. [Google Scholar] [CrossRef]
- Wei, Q.W.; Ke, F.; Zhang, J.; Zhuang, P.; Lu, J.D.; Zhou, R.Q.; Yang, W.H. Biology, fisheries, and conservation of sturgeons and paddlefish in China. Environ. Biol. Fish. 1997, 48, 241–255. [Google Scholar] [CrossRef]
- Wang, J.H.; Wei, Q.W.; Zou, Y.C. Conservation strategies for the Chinese sturgeon, Acipenser sinesis: An overview on 30 years of practices and future needs. J. Appl. Ichthyol. 2011, 27, 176–180. [Google Scholar] [CrossRef]
- Zohar, Y.; Muñoz-Cueto, J.A.; Elizur, A.; Kah, O. Neuroendocrinology of reproduction in teleost fish. Gen. Comp. Endocr. 2010, 165, 438–455. [Google Scholar] [CrossRef]
- Corander, M.P.; Challis, B.G.; Thompson, E.L.; Jovanovic, Z.; Loraine Tung, Y.C.; Rimmington, D.; Huhtaniemi, I.T.; Murphy, K.G.; Topaloglu, A.K.; Yeo, G.S.; et al. The effects of neurokinin B upon gonadotrophin release in male rodents. J. Neuroendocrinol. 2010, 22, 181–187. [Google Scholar] [CrossRef]
- Almeida, T.A.; Rojo, J.; Nieto, P.M.; Pinto, F.M.; Hernandez, M.; Martin, J.D.; Candenas, M.L. Tachykinins and tachykinin receptors: Structure and activity relationships. Curr. Med. Chem. 2004, 11, 2045–2081. [Google Scholar] [CrossRef]
- Steinhoff, M.S.; von Mentzer, B.; Geppetti, P.; Pothoulakis, C.; Bunnett, N.W. Tachykinins and their receptors: Contributions to physiological control and the mechanisms of disease. Physiol. Rev. 2014, 94, 265–301. [Google Scholar] [CrossRef]
- Pennefather, J.N.; Lecci, A.; Candenas, M.L.; Patak, E.; Pinto, F.M.; Maggi, C.A. Tachykinins and tachykinin receptors: A growing family. Life. Sci. 2004, 74, 1445–1463. [Google Scholar] [CrossRef]
- Lin, C.C.; Chen, W.N.; Chen, C.J.; Lin, Y.W.; Zimmer, A.; Chen, C.C. An antinociceptive role for Substance P in acid-induced chronic muscle pain. Proc. Natl. Acad. Sci. USA 2012, 109, E76–E83. [Google Scholar] [CrossRef]
- Ang, S.F.; Moochhala, S.M.; MacAry, P.A.; Bhatia, M. Hydrogen sulfide and neurogenic inflammation in polymicrobial sepsis: Involvement of Substance P and ERK-NF-κB signaling. PLoS ONE 2011, 6, e24535. [Google Scholar] [CrossRef] [PubMed]
- Cipriani, G.; Serboiu, C.S.; Gherghiceanu, M.; Faussone-Pellegrini, M.S.; Vannucchi, M.G. NK receptors, Substance P, Ano1 expression and ultrastructural features of the muscle coat in Cav-1−/− mouse ileum. J. Cell. Mol. Med. 2011, 15, 2411–2420. [Google Scholar] [CrossRef] [PubMed]
- Shaffer, A.D.; Ball, C.L.; Robbins, M.T.; Ness, T.J.; Randich, A. Effects of acute adult and early-in-life bladder inflammation on bladder neuropeptides in adult female rats. BMC. Urol. 2011, 11, 18. [Google Scholar] [CrossRef] [PubMed]
- Trivedi, C.; Shan, X.; Tung, Y.C.; Kabra, D.; Holland, J.; Amburgy, S.; Heppner, K.; Kirchner, H.; Yeo, G.S.; Perez-Tilve, D. Tachykinin-1 in the central nervous system regulates adiposity in rodents. Endocrinology 2015, 156, 1714–1723. [Google Scholar] [CrossRef] [PubMed]
- Debeljuk, L.; Lasaga, M. Modulation of the hypothalamo-pituitary-gonadal axis and the pineal gland by neurokinin A, neuropeptide K and neuropeptide gamma. Peptides 1999, 20, 285–299. [Google Scholar] [CrossRef] [PubMed]
- Hidalgo-Diaz, C.; Castano, J.P.; Lopez-Pedrera, R.; Malagon, M.M.; Garcia-Navarro, S.; Gracia-Navarro, F. A modulatory role for substance P on the regulation of luteinizing hormone secretion by cultured porcine gonadotrophs. Biol. Reprod. 1998, 58, 678–685. [Google Scholar] [CrossRef]
- Biran, J.; Palevitch, O.; Ben-Dor, S.; Levavi-Sivan, B. Neurokinin Bs and neurokinin B receptors in zebrafish–potential role in controlling fish reproduction. Proc. Natl. Acad. Sci. USA 2012, 109, 10269–10274. [Google Scholar] [CrossRef]
- Zhou, W.; Li, S.; Liu, Y.; Qi, X.; Chen, H.; Cheng, C.H.; Liu, X.; Zhang, Y.; Lin, H.R. The evolution of tachykinin/tachykinin receptor (TAC/TACR) in vertebrates and molecular identification of the TAC3/TACR3 system in zebrafish (Danio rerio). Mol. Cell. Endocrinol. 2012, 361, 202–212. [Google Scholar] [CrossRef]
- Biran, J.; Golan, M.; Mizrahi, N.; Ogawa, S.; Parhar, I.S.; Levavi-Sivan, B. Direct regulation of gonadotropin release by neurokinin B in tilapia (Oreochromis niloticus). Endocrinology 2014, 155, 4831–4842. [Google Scholar] [CrossRef]
- Qi, X.; Zhou, W.Y.; Li, S.S.; Liu, Y.; Ye, G.; Liu, X.C.; Peng, C.; Zhang, Y.; Lin, H.R. Goldfish neurokinin B: Cloning, tissue distribution, and potential role in regulating reproduction. Gen. Comp. Endocrinol. 2015, 221, 267–277. [Google Scholar] [CrossRef]
- Lin, C.Y.; Jiang, X.; Hu, G.F.; Ko, K.W.; Wong, O.L. Grass carp prolactin: Molecular cloning, tissue expression, intrapituitary autoregulation by prolactin and paracrine regulation by growth hormone and luteinizing hormone. Mol. Cell. Enodcrinol. 2015, 399, 267–283. [Google Scholar] [CrossRef] [PubMed]
- Hu, G.F.; He, M.L.; Ko, W.K.; Lin, C.Y.; Wong, A.O. Novel pituitary actions of TAC3 gene products in fish model: Receptor specificity and signal transduction for prolactin and somatolactin alpha regulation by neurokinin B (NKB) and NKB-related peptide in carp pituitary cells. Endocrinology 2014, 155, 3582–3596. [Google Scholar] [CrossRef] [PubMed]
- Lopez-Bellido, R.; Barreto-Valer, K.; Rodriguez, R.E. Substance P mRNA expression during zebrafish development: Influence of mu opioid receptor and cocaine. Neuroscience 2013, 242, 53–68. [Google Scholar] [CrossRef] [PubMed]
- Hu, G.F.; He, M.L.; Ko, W.K.; Wong, A.O. TAC1 gene products regulate pituitary hormone secretion and gene expression in prepubertal grass carp pituitary cells. Endocrinology 2017, 158, 1776. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.Y.; Qin, Q.B.; Xu, S.H.; Zhou, L.L.; Xia, C.H.; Shi, X.T.; Zhang, H.Y.; Jia, J.Y.; Yin, Z.; Hu, G.H.; et al. Pituitary actions of EGF on gonadotropins, growth hormone, prolactin and somatolactins in grass carp. Biology 2020, 9, 279. [Google Scholar] [CrossRef] [PubMed]
- Sandoval-Guzmán, T.; Rance, N.E. Central injection of senktide, an NK3 receptor agonist, or neuropeptide Y inhibits LH secretion and induces different patterns of Fos expression in the rat hypothalamus. Brain. Res. 2004, 1026, 307–312. [Google Scholar] [CrossRef]
- Arisawa, M.; De Palatis, L.; Ho, R.; Snyder, G.D.; Yu, W.H.; Pan, G.; McCann, S.M. Stimulatory role of substance P on gonadotropin release in ovariectomized rats. Neuroendocrinology 1990, 51, 523–529. [Google Scholar] [CrossRef] [PubMed]
- Pisera, D.; Debeljuk, L.; Seilicovich, A.; Afione, S.; Duvilanski, B.; Diaz, M.C.; Lasaga, M.; Traktemberg, R.; Bartke, A. Possible role of neurokinin A in the control of prolactin secretion in rats and hamsters. J. Neuroendocrinol. 1991, 3, 279–283. [Google Scholar] [CrossRef]
- Battmann, T.; Mĕlik Parsadaniantz, S.; Jeanjean, B.; Kerdelhué, B. In-vivo inhibition of the preovulatory LH surge by substance P and in-vitro modulation of gonadotrophin-releasing hormone-induced LH release by substance P, oestradiol and progesterone in the female rat. J. Endocrinol. 1991, 130, 169–175. [Google Scholar] [CrossRef]
- Mattioli, R.; Santangelo, E.M.; Costa, A.C.; Vasconcelos, L. Substance P facilitates memory in goldfish in an appetitively motivated learning task. Behav. Brain. Res. 1997, 85, 117–120. [Google Scholar] [CrossRef]
- Ytteborg, E.; Torgersen, J.S.; Pedersen, M.E.; Helland, S.J.; Grisdale-Helland, B.; Takle, H. Exercise induced mechano-sensing and substance P mediated bone modeling in Atlantic salmon. Bone 2013, 53, 259–268. [Google Scholar] [CrossRef] [PubMed]
- Ogawa, S.; Ramadasan, P.N.; Anthonysamy, R.; Parhar, I.S. Sexual dimorphic distribution of hypothalamic Tachykinin1 cells and their innervations to GnRH neurons in the zebrafish. Front. Endocrinol. 2021, 11, 534343. [Google Scholar] [CrossRef] [PubMed]
- Hu, G.F.; Lin, C.Y.; He, M.L.; Wong, A.O. Neurokinin B and reproductive functions: “KNDy neuron” model in mammals and the emerging story in fish. Gen. Comp. Endocrinol. 2014, 208, 94–108. [Google Scholar] [CrossRef] [PubMed]
- Topaloglu, A.K.; Reimann, F.; Guclu, M.; Yalin, A.S.; Kotan, L.D.; Porter, K.M.; Serin, A.; Mungan, N.O.; Cook, J.R.; Ozbek, M.N.; et al. TAC3 and TACR3 mutations in familial hypogonadotropic hypogonadism reveal a key role for Neurokinin B in the central control of reproduction. Nat. Genet. 2009, 41, 354–358. [Google Scholar] [CrossRef]
- Ogawa, S.; Ramadasan, P.N.; Goschorska, M.; Anantharajah, A.; Ng, K.W.; Parhar, I.S. Cloning and expression of tachykinins and their association with kisspeptins in the brains of zebrafish. J. Comp. Neurol. 2012, 520, 2991–3012. [Google Scholar] [CrossRef]
- Huang, H.T.; Xiao, K.; Shu, T.T.; Liu, X.Q.; Yang, J. Effects of Kisspeptin on the reproductive function in the Dabry’s sturgeon (Acipenser dabrynus). Gen. Comp. Endocrinol. 2023, 336, 114244. [Google Scholar]
- Fergani, C.; Mazzella, L.; Coolen, L.M.; McCosh, R.B.; Hardy, S.L.; Newcomb, N.; Grachev, P.; Lehman, M.N.; Goodman, R.L. Do substance P and neurokinin A play important roles in the control of LH secretion in ewes? Endocrinology 2016, 157, 4829–4841. [Google Scholar]
Primer | Sequence(5′-3′) | Primer Length (bp) | Amplicon Length (bp) |
---|---|---|---|
fsh-F | CTTACGCAGGCCGATGTG | 18 | 208 |
fsh-R | AGGGTCCAAGGCTTAGGG | 18 | |
lh-F | AGGAGGAATGTCCAAAGTGC | 20 | 194 |
lh-R | CAGCGGGAAGGTGAAGTG | 18 | |
actin-F | CCTTCTTGGGTATGGAATCTTGC | 23 | 201 |
actin-R | CAGAGTATTTACGCTCAGGTGGG | 23 | |
fsh-CDS-F | TATAAAGACATGGCATCAG | 19 | 525 |
fsh-CDS-R | AAGGGAAAGGTTCTAAAC | 18 | |
lh-CDS-F | CGACGGCGGGTAAAGGAA | 18 | 491 |
lh-CDS-R | AGCGGGAAGGTGAAGTGGG | 19 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xiao, K.; Huang, H.; Shi, X.; Shu, T.; Cheng, X.; Du, H.; Yang, J. The Effects of Tachykinin1 Gene Products on Prepubertal Dabry’s Sturgeon (Acipenser dabrynus) Pituitary Hormone Secretion and Gene Expression. Animals 2024, 14, 227. https://doi.org/10.3390/ani14020227
Xiao K, Huang H, Shi X, Shu T, Cheng X, Du H, Yang J. The Effects of Tachykinin1 Gene Products on Prepubertal Dabry’s Sturgeon (Acipenser dabrynus) Pituitary Hormone Secretion and Gene Expression. Animals. 2024; 14(2):227. https://doi.org/10.3390/ani14020227
Chicago/Turabian StyleXiao, Kan, Hongtao Huang, Xuetao Shi, Tingting Shu, Xu Cheng, Hejun Du, and Jing Yang. 2024. "The Effects of Tachykinin1 Gene Products on Prepubertal Dabry’s Sturgeon (Acipenser dabrynus) Pituitary Hormone Secretion and Gene Expression" Animals 14, no. 2: 227. https://doi.org/10.3390/ani14020227
APA StyleXiao, K., Huang, H., Shi, X., Shu, T., Cheng, X., Du, H., & Yang, J. (2024). The Effects of Tachykinin1 Gene Products on Prepubertal Dabry’s Sturgeon (Acipenser dabrynus) Pituitary Hormone Secretion and Gene Expression. Animals, 14(2), 227. https://doi.org/10.3390/ani14020227