Influence of Maternal Dietary Protein during Late Gestation on Performance of Black Bengal Does and Their Kids
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Place of Experiment
2.2. Housing and Management Practices
2.3. Design of Experiments
2.4. Formulation of Experimental Diets
2.5. Feeding of Does
2.6. Kid Management
2.7. Live Weight Measurement
2.8. Milk Production Record
2.9. Body Measurements of Kids
2.10. Blood Parameter Analysis of Kids
2.11. Carcass Parameters and Meat Composition
2.12. Expression of H-FABP Gene
2.13. Statistical Analysis
3. Results
3.1. Live Weight Changes of Does
3.2. Milk Production Performance of Does
3.3. Lactation Length, Post-Partum Anestrus of Does and Birth Type, and Sex and Birth Weight of Kids
3.4. Growth Performance of Kids
3.5. Body Parameters of Kids
3.6. Blood Parameter Analysis in Kids
3.7. Survivability of Kids
3.8. Carcass Characteristics and Meat Composition
3.9. Expression of Heart Fatty Acid-Binding Protein (H-FABP) mRNA
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Monteiro, A.; Costa, J.M.; Lima, M.J. Goat System Productions: Advantages and Disadvantages to the Animal, Environment and Farmer. Goat Science Sándor Kukovics; IntechOpen: London, UK, 2018. [Google Scholar]
- Mahmoud, A.A. Present Status of the World Goat Populations and their Productivity. Lohman Inf. 2010, 45, 42–52. [Google Scholar]
- Sinn, R.; Rudenberg, P. Raising Goats for Milk and Meat; Heifer International: Little Rock, AR, USA, 2008. [Google Scholar]
- Husain, S.S.; Islam, A.B.M.M.; Horst, P. Effects of different factors on pre-weaning survivability of Black Bengal kids. Small Rumin. Res. 1995, 18, 1–5. [Google Scholar] [CrossRef] [Scilit]
- Banchero, G.E.; Milton, J.T.B.; Lindsay, D.R.; Martin, G.B.; Quintans, G. Colostrum production in ewes: A review of regulation mechanisms and of energy supply. Animal 2015, 9, 831–837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robinson, J.J.; Sinclair, K.D.; McEvoy, T.G. Nutritional effects on foetal growth. Anim. Sci. 1999, 68, 315–331. [Google Scholar] [CrossRef] [Scilit]
- Chellapandian, M. Effect of Concentrate Supplementation on the Growth Performance and Economics of Kilakarsal Sheep. Glob. J. Res. Anal. 2016, 5, 37–38. [Google Scholar]
- Nar, G. Nutritional Requirements of Different Classes of Meat Goats. Prog. Agri. Work. J. 2020, 6, 10. Available online: https://tuspubs.tuskegee.edu/pawj/vol6/iss3/10 (accessed on 20 January 2020).
- National Research Council (NRC). Nutrient Requirements of Small Ruminants: Sheep, Goats, Cervids and New World Camelids; National Research Council, National Academy of Science: Washington, DC, USA, 2007. [Google Scholar]
- Shahjalal, M.; Bishwas, M.A.; Tareque, A.M.M.; Dohi, H. Growth and carcass characteristics of goats given diets varying protein concentration and feeding level. Asian Australas. J. Anim. Sci. 2000, 13, 613–618. [Google Scholar] [CrossRef] [Scilit]
- Chowdhury, S.A.; Bhuiyan, M.S.A.; Faruk, S. Rearing Black Bengal Goat under Semi-Intensive Management 1. Physiological and Reproductive Performances. Asian Australas. J. Anim. Sci. 2002, 15, 477–484. [Google Scholar] [CrossRef] [Scilit]
- Banerjee, G.C. Feeds and Principles of Animal Nutrition; Oxford and IBH Publishing Company: New Delhi, India, 1978. [Google Scholar]
- Ranjan, S.K. Animal Nutrition in the Tropics; Vikas publishing house Pvt. Ltd.: Ghajiabod, India, 1980; pp. 163–167. [Google Scholar]
- Khan, J.; Wangehuk, K.; Sampath, K.T.; Poadyal, S.M.; Habib, G.; Samarasinghe, K. Best Practices in Animal Feed Production and Management in SAARC Countries; SAARC Agriculture Centre: Dhaka, Bangladesh, 2008. [Google Scholar]
- Heuzé, V.; Tran, G.; Giger-Reverdin, S.; Lebas, F. Feedipedia, a Programme by INRAE, CIRAD, AFZ and FAO. 2017. Available online: https://www.feedipedia.org (accessed on 26 April 2017).
- National Research Council (NRC). Nutrient Requirements of Goats; National Academy of Science: Washington, DC, USA, 1981. [Google Scholar]
- Rajpoot, R.L. Energy and Protein in Goat Nutrition. Ph.D. Dissertation, Raja Balwant Singh College, Bichpuri, India, 1979. [Google Scholar]
- AOAC. Official Methods of Analysis of the AOAC, 18th ed.; Association of Official Analytical Chemists: Washington, DC, USA, 2005. [Google Scholar]
- Sahlu, T.; Fernandez, J.M.; Lu, C.D.; Manning, R. Influence of dietary protein on performance of dairy goats during pregnancy. J. Dairy Sci. 1992, 75, 220–227. [Google Scholar] [CrossRef] [Scilit]
- Phengvichith, V.; Ledin, I. Effect of a diet high in energy and protein on growth, carcase characteristics and parasite resistance in goats. Trop. Anim. Health Prod. 2007, 39, 59–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Negesse, T.; Rodehutscord, M.; Pfeffer, E. The effect of dietary crude protein level on intake, growth, protein retention and utilization of growing male Saanen kids. Small Rumin. Res. 2001, 39, 243–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmed, M.H.; Salem, A.Z.M.; Olafadehan, O.A.; Kholif, A.E.; Rivero, N.; Mariezcurrena, M.A.; Camacho, L.M.; Elghandour, M.M.Y.; Alonso, M.U.; Almaz, A.H.A. Effect of pre-and post-partum dietary crude protein level on the performance of ewes and their lambs. Small Rumin. Res. 2016, 136, 221–226. [Google Scholar] [CrossRef] [Scilit]
- Sahlu, T.; Hart, S.P.; Letrong, T.; Jia, Z.; Dawson, L.; Gipson, T.; Teh, T.H. Influence of prepartum protein and energy concentrations for dairy goats during pregnancy and early lactation. J. Dairy Sci. 1995, 78, 378–387. [Google Scholar] [CrossRef] [Scilit]
- Gül, S.; Keskin, M.; Göçmez, Z.; Gündüz, Z. Effects of supplemental feeding on performance of Kilis goats kept on pasture condition. Ital. J. Anim. Sci. 2016, 15, 110–115. [Google Scholar] [CrossRef] [Scilit]
- Saha, N.G.; Alam, M.R.; Rahman, M.M. Effect of feed supplementation on reproduction, lactation and growth performance of Black Bengal goats grazed on native pasture. Bang. J. Anim. Sci. 2012, 41, 41–46. [Google Scholar] [CrossRef] [Scilit]
- Cressman, S.G.; Grieve, D.G.; Macleod, G.K.; Elizabeth Wheeler, E.; Young, L.G. Influence of Dietary Protein Concentration on Milk Production by Dairy Cattle in Early Lactation. J. Dairy Sci. 1980, 63, 1839–1847. [Google Scholar] [CrossRef] [Scilit]
- Robinson, J.J.; Forbes, T.J. The effect of protein intake during gestation on ewe and lamb performance. Anim. Prod. 1968, 10, 297–309. [Google Scholar] [CrossRef] [Scilit]
- National Research Council (NRC). Nutrient Requirements of Dairy Cattle, 6th ed.; National Academy of Science: Washington, DC, USA, 1989. [Google Scholar]
- Dunn, T.G.; Kaltenbach, C.C. Nutrition and the postpartum interval of the ewe, sow and cow. J. Anim. Sci. 1980, 2, 29–39. [Google Scholar] [PubMed]
- De Feu, M.A.; Evans, A.C.O.; Lonergan, P.; Butler, S.T. The effect of dry period duration and dietary energy density on milk production, bioenergetic status, and postpartum ovarian function in Holstein-Friesian dairy cows. J. Dairy Sci. 2009, 92, 6011–6022. [Google Scholar] [CrossRef] [Scilit]
- Butler, W.R.; Smith, R.D. Interrelationships between energy balance and postpartum reproductive function in dairy cattle. J. Dairy Sci. 1989, 72, 767–783. [Google Scholar] [CrossRef] [Scilit]
- Firoozi, R.; Teimouri, Y.A.; Dirandeh, E. Effects of energy and protein levels of maternal diets at late gestation on growth, health and performance of goat kids. Iran. J. Appl. Anim. Sci. 2017, 7, 611–620. [Google Scholar]
- Radunz, A.E.; Fluharty, F.L.; Susin, I.; Felix, T.L.; Zerby, H.N.; Loerch, S.C. Winter-feeding systems for gestating sheep II: Effects on feedlot performance, glucose tolerance, and carcass composition of lamb progeny. J. Anim. Sci. 2011, 89, 478–488. [Google Scholar] [CrossRef] [Scilit]
- Dorantes-Coronado, E.J.; Torres-Hernández, G.; Hernández-Mendo, O.; Rojo-Rubio, R. Zoometric measures and their utilization in prediction of live weight of local goats in southern México. SpringerPlus 2015, 4, 695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Francisco, A.E.; Janíček, M.; Dentinho, T.; Portugal, A.P.V.; Almeida, J.M.; Alves, S.P.; Fialho, L.; Jerónimo, E.; Bessa, R.J.B.; Santos-Silva, J. Effects of alfalfa particle size and starch content in diets on feeding behaviour, intake, rumen parameters, animal performance and meat quality of growing lambs. Meat Sci. 2020, 161, 107964. [Google Scholar] [CrossRef] [Scilit]
- Qin, X.; Zhang, T.; Cao, Y.; Deng, B.; Zhang, J.; Zhao, J. Effects of dietary sea buckthorn pomace supplementation on skeletal muscle mass and meat quality in lambs. Meat Sci. 2020, 166, 108141. [Google Scholar] [CrossRef] [Scilit]
- Gómez, R.S.; Lewis, A.J.; Miller, P.S.; Chen, H.Y.; Diedrichsen, R.M. Body composition and tissue accretion rates of barrows fed corn-soybean meal diets or low-protein, amino acid-supplemented diets at different feeding levels. J. Anim. Sci. 2002, 80, 654–662. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Xu, T.; Zhang, X.; Geng, Y.; Kang, S.; Xu, S. Effects of Dietary Protein Levels on Growth Performance, Carcass Traits, Serum Metabolites, and Meat Composition of Tibetan Sheep during the Cold Season on the Qinghai-Tibetan Plateau. Animals 2020, 10, 801. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Jiang, Y.; Khan, M.; Xue, B.; Zhao, X.; Fu, B.; Li, W.; Danzeng, B.; Ni, X.; Shao, Q.; et al. Dietary Energy and Protein Levels Influence the Mutton Quality and Metabolomic Profile of the Yunshang Black Goat. Foods 2024, 13, 2271. [Google Scholar] [CrossRef] [Scilit]
- Costa, T.C.; Du, M.; Nascimento, K.B.; Galvão, M.C.; Meneses, J.A.M.; Schultz, E.B.; Gionbelli, M.P.; Duarte, M.D.S. Skeletal Muscle Development in Postnatal Beef Cattle Resulting from Maternal Protein Restriction during Mid-Gestation. Animals 2021, 11, 860. [Google Scholar] [CrossRef] [Scilit]
- Owens, F.N.; Gardner, B.A. A review of the impact of feedlot management and nutrition on carcass measurements of feedlot cattle. J. Anim. Sci. 2000, 77, 1–18. [Google Scholar] [CrossRef] [Scilit]
- Jeong, J.; Seong, N.I.; Hwang, I.K.; Lee, S.B.; Yu, M.S.; Nam, I.S.; Lee, M.I. Effects of level of CP and TDN in the concentrate supplement on growth performances and carcass characteristics in Hanwoo steers during final fattening period. J. Anim. Sci. Technol. 2010, 52, 305–312. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.J.; Liu, Y.Q.; Song, J.; Cheng, S.Y.; Dong, L.X. Effects of dietary energy level on the transcription of the H-FABP gene in different tissues of sheep. Small Rumin. Res. 2013, 39, 137–144. [Google Scholar] [CrossRef] [Scilit]
- Brandstetter, A.M.; Pfaffl, M.W.; Hocquette, J.F.; Gerrard, D.E.; Picard, B.; Geay, Y.; Sauerwein, H. Effects of muscle type, castration, age, and compensatory growth rate on androgen receptor mRNA expression in bovine skeletal muscle. J. Anim. Sci. 2000, 78, 629–637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hyun, Y.; Ellis, M.; McKeith, F.K.; Baker, D.H. Effect of dietary leucine level on growth performance, and carcass and meat quality in finishing pigs. Can. J. Anim. Sci. 2003, 83, 315–318. [Google Scholar] [CrossRef] [Scilit]
- Katsumata, M.; Kyoya, T.; Kobayashi, H.; Ishida, A.; Ashihara, A.; Nakashima, K. Mechanisms of Regulation of Intramuscular Fat Deposition in Porcine Muscle by Dietary Lysine Content. Energy and Protein Metabolism and Nutrition in Sustainable Animal Production; Wageningen Academic Publishers: Wageningen, The Netherlands, 2013; pp. 253–259. [Google Scholar] [CrossRef] [Scilit]
- Duarte, M.S.; Gionbelli, M.P.; Paulino, P.V.R.; Serão, N.V.L.; Nascimento, C.S.; Botelho, M.E.; Martins, T.S.; Filho, S.C.V.; Dodson, M.V.; Guimarães, S.E.F.; et al. Maternal overnutrition enhances mRNA expression of adipogenic markers and collagen deposition in skeletal muscle of beef cattle fetuses. J. Anim. Sci. 2014, 92, 3846–3854. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Ingredients (Kg) | Protein Levels | ||
|---|---|---|---|
| High (18% CP) | Medium (14% CP) | Low (10% CP) | |
| German grass | 55.58 | 52.66 | 45.47 |
| Wheat bran | 10.32 | 14.92 | 8.63 |
| Maize crushed | 10.95 | 20.15 | 42.74 |
| Soybean meal | 22.15 | 11.27 | 2.16 |
| Common salt | 0.5 | 0.5 | 0.5 |
| Dicalcium phosphate | 0.5 | 0.5 | 0.5 |
| Total | 100 | 100 | 100 |
| Chemical composition | |||
| Estimated CP (%) | 18 | 14 | 10 |
| Estimated ME (MJ/kg DM) | 10.0 | 10.0 | 10.0 |
| NDF (%) | 46.16 | 46.18 | 40.31 |
| ADF (%) | 29.59 | 28.42 | 24.34 |
| Ca (%) | 0.43 | 0.39 | 0.33 |
| P (%) | 0.53 | 0.52 | 0.44 |
| Primer Name | Primer Sequence (5′-3′) | Gene Bank Accession Number |
|---|---|---|
| H-FABP | FWD: GGTGGCCAATATGACCAAACC REV: TCAAGCTGGGAGTCGAGTTC | AY_466498.1 |
| β-actin | FWD: CTCCCTGGAGAAGAGCTACG REV: GCAGGATTCCATGCCCAGG | NM_001314342.1 |
| Parameter | Protein Level | ||
|---|---|---|---|
| High (18% CP) | Medium (14% CP) | Low (10% CP) | |
| Initial live weight (kg) | 19.38 ± 1.58 | 19.45 ± 1.46 | 19.43 ± 2.28 |
| Final live weight (kg) | 22.45 ± 2.34 | 20.33 ± 1.53 | 19.53 ± 1.58 |
| Live weight gain (kg) | 3.08 a ± 0.30 | 0.88 b ± 0.68 | 0.10 b ± 0.00 |
| Average daily feed intake (g/d) | 980.59 ± 50.31 | 906.90 ± 18.53 | 886.21 ± 17.55 |
| Parameter | Protein Level | ||
|---|---|---|---|
| High (18% CP) | Medium (14% CP) | Low (10% CP) | |
| Number of does | 4 | 4 | 4 |
| Litter size (kids) | 1.75 ± 0.25 | 1.50 ± 0.29 | 2.00 ± 0.00 |
| Birth type (%) | |||
| Single birth | 25 | 50 | - |
| Twin birth | 75 | 50 | 100 |
| Gender (%) | |||
| Male kids | 3 (42.86) | 3 (50.00) | 3 (37.50) |
| Female kids | 4 (57.14) | 3 (50.00) | 5 (62.50) |
| Birth weight of kids (kg) | |||
| Male kids | 1.50 ± 0.06 | 1.23 ± 0.03 | 1.30 ± 0.06 |
| Female kids | 1.02 ± 0.17 | 1.13 ± 0.03 | 0.94 ± 0.16 |
| Lactation length of does (d) | 99.00 a ± 3.19 | 83.75 b ± 0.85 | 62.00 c ± 1.22 |
| Post-partum heat period (d) | 86.50 b ± 0.50 | 88.00 ab ± 0.71 | 89.67 a ± 1.45 |
| Parameters | Diet (n = 5 per Group) | Gender of Kids Male (n = 3 per Group) and Female (n = 2 per Group) | Diet and Sex Interaction | |||||
|---|---|---|---|---|---|---|---|---|
| High (18% CP) | Medium (14% CP) | Low (10% CP) | p-Value | Male | Female | p-Value | p-Value | |
| Weaning weight (kg) | 5.74 a | 5.20 ab | 4.10 b | 0.039 | 5.36 a | 4.35 b | 0.034 | 0.271 |
| Final live weight (kg) | 8.72 a | 7.82 b | 6.98 c | 0.002 | 8.97 a | 6.15 b | 0.000 | 0.354 |
| Total live weight gain (kg) | 7.16 a | 6.38 b | 5.66 c | 0.003 | 7.51 a | 4.73 b | 0.000 | 0.656 |
| Average daily gain (g/d) | 31.61 a | 28.48 a | 24.07 b | 0.002 | 33.5 a | 19.84 b | 0.000 | 0.524 |
| Parameter | Protein Level | ||
|---|---|---|---|
| High (18% CP) | Medium (14% CP) | Low (10% CP) | |
| Glucose (mmol/L) | 3.60 ± 0.03 | 3.59 ± 0.32 | 3.58 ± 0.23 |
| Total protein (g/dL) | 7.85 ± 0.30 | 7.70 ± 0.17 | 7.58 ± 0.24 |
| Albumin (g/dL) | 3.91 ± 0.15 | 3.81 ± 0.20 | 3.90 ± 0.15 |
| Globulin (g/dL) | 3.95 ± 0.24 | 3.89 ± 0.14 | 3.68 ± 0.21 |
| Triglyceride (mg/dL) | 22.58 ± 2.31 | 24.61 ± 1.94 | 26.68 ± 5.68 |
| Parameter | Protein Level | ||
|---|---|---|---|
| High (18% CP) | Medium (14% CP) | Low (10% CP) | |
| Glucose (mmol/L) | 3.71 ± 0.05 | 3.70 ± 0.31 | 3.69 ± 0.31 |
| Total protein (g/dL) | 8.18 ± 0.35 | 7.90 ± 0.16 | 7.73 ± 0.22 |
| Albumin (g/dL) | 3.99 ± 0.18 | 3.91 ± 0.21 | 3.96 ± 0.16 |
| Globulin (g/dL) | 4.19 ± 0.29 | 3.99 ± 0.12 | 3.77 ± 0.19 |
| Triglyceride (mg/dL) | 24.19 ± 2.26 | 26.30 ± 2.30 | 29.15 ± 6.50 |
| Parameter | Protein Level | ||
|---|---|---|---|
| High (18% CP) | Medium (14% CP) | Low (10% CP) | |
| No. of does | 4 | 4 | 4 |
| No. of kids born | 7 | 6 | 8 |
| No. of kids died | 2 | 1 | 3 |
| No. of kids survived | 5 | 5 | 5 |
| Survivability (%) | 71 | 83 | 62 |
| Parameter | Protein Level | ||
|---|---|---|---|
| High (18% CP) | Medium (14% CP) | Low (10% CP) | |
| Slaughter weight (kg) | 10.07 a ± 0.15 | 8.80 b ± 0.35 | 8.03 b ± 0.12 |
| Hot carcass weight (kg) | 4.70 a ± 0.31 | 3.87 b ± 0.15 | 3.27 b ± 0.07 |
| Dressing percentage (%) | 46.63 a ± 2.42 | 43.98 ab ± 1.25 | 40.67 b ± 0.59 |
| Offal | |||
| Heart (kg) | 0.05 ± 0.01 | 0.04 ± 0.00 | 0.04 ± 0.00 |
| Liver (kg) | 0.26 ± 0.00 | 0.25 ± 0.01 | 0.25± 0.01 |
| Kidney (kg) | 0.05 ± 0.00 | 0.05 ± 0.00 | 0.04 ± 0.00 |
| Lung (kg) | 0.17 ± 0.01 | 0.16 ± 0.01 | 0.16 ± 0.00 |
| Spleen (kg) | 0.03 ± 0.00 | 0.03 ± 0.00 | 0.029 ± 0.00 |
| Stomach (kg) | 2.87 ± 0.07 | 2.77 ± 0.03 | 2.83 ± 0.03 |
| Empty gut (kg) | 1.43 ± 0.07 | 1.41 ± 0.04 | 1.36 ± 0.06 |
| Gut fill (kg) | 1.37 ± 0.12 | 1.33 ± 0.03 | 1.53 ± 0.09 |
| Parameter (%) | Protein Level | ||
|---|---|---|---|
| High (18% CP) | Medium (14% CP) | Low (10% CP) | |
| Dry matter | 25.24 ± 0.92 | 25.13 ± 0.83 | 24.62 ± 2.14 |
| Crude protein | 23.77 ± 0.84 | 23.16 ± 0.59 | 21.92 ± 1.52 |
| Ether extract | 2.51 a ± 0.12 | 1.75 b ± 0.23 | 1.46 b ± 0.06 |
| Ash | 1.01 ± 0.10 | 0.98 ± 0.19 | 1.10 ± 0.15 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Arafath, M.S.; Hasan, M.; Sultana, J.; Alam, M.H.; Khatun, A.; Moniruzzaman, M. Influence of Maternal Dietary Protein during Late Gestation on Performance of Black Bengal Does and Their Kids. Animals 2024, 14, 2783. https://doi.org/10.3390/ani14192783
Arafath MS, Hasan M, Sultana J, Alam MH, Khatun A, Moniruzzaman M. Influence of Maternal Dietary Protein during Late Gestation on Performance of Black Bengal Does and Their Kids. Animals. 2024; 14(19):2783. https://doi.org/10.3390/ani14192783
Chicago/Turabian StyleArafath, Md Sayaduzzaman, Mahadi Hasan, Jakia Sultana, Md Hasanur Alam, Asma Khatun, and Mohammad Moniruzzaman. 2024. "Influence of Maternal Dietary Protein during Late Gestation on Performance of Black Bengal Does and Their Kids" Animals 14, no. 19: 2783. https://doi.org/10.3390/ani14192783
APA StyleArafath, M. S., Hasan, M., Sultana, J., Alam, M. H., Khatun, A., & Moniruzzaman, M. (2024). Influence of Maternal Dietary Protein during Late Gestation on Performance of Black Bengal Does and Their Kids. Animals, 14(19), 2783. https://doi.org/10.3390/ani14192783

