5-Aza-2′-Deoxycytidine (5-Aza-dC, Decitabine) Inhibits Collagen Type I and III Expression in TGF-β1-Treated Equine Endometrial Fibroblasts
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Culture of Fibroblasts
2.2. Preliminary Studies
2.3. Treatment of Cultured Fibroblasts
2.4. Total RNA Isolation, cDNA Synthesis and qPCR
2.5. Collagen Protein Quantification
2.6. Statistical Analysis
3. Results
3.1. TGF-β1 Upregulated Collagen Type I, III and α-SMA Expression in Endometrial Fibroblasts
3.2. TGF-β1 Upregulated DNMT3A Expression in Endometrial Fibroblasts
3.3. 5-aza-dC Downregulated Collagen Type I and III Expression Induced by TGF-β1 in Endometrial Fibroblasts
3.4. 5-aza-dC Downregulated DNMT3A Expression in TGF-β1-Treated Endometrial Fibroblasts
3.5. 5-aza-dC Down-Regulated COL1A1 and Upregulated α-SMA Expression at 96 h
3.6. 5-aza-dC Downregulated DNMT1, DNMT3A and DNMT3B Expression
3.7. TGF-β1 Induced Collagen Type I and III, and DNMT3A Expression in Equine Endometrial Fibroblasts and These Effects Were Reversed by 5-aza-dC
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Walter, I.; Klein, M.; Handler, J.; Aurich, J.E.; Reifinger, M.; Aurich, C. Lectin binding patterns of uterine glands in mares with chronic endometrial degeneration. Am. J. Veter. Res. 2001, 62, 840–845. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, C.; Ellenberger, C.; Mattos, R.C.; Aupperle, H.; Dhein, S.; Stief, B.; Schoon, H.-A. The equine endometrosis: New insights into the pathogenesis. Anim. Reprod. Sci. 2009, 111, 261–278. [Google Scholar] [CrossRef] [PubMed]
- De Amorim, M.D.; Khan, F.A.; Chenier, T.S.; Scholtz, E.L.; Hayes, M.A. Analysis of the uterine flush fluid proteome of healthy mares and mares with endometritis or fibrotic endometrial degeneration. Reprod. Fertil. Dev. 2020, 32, 572–581. [Google Scholar] [CrossRef] [PubMed]
- Kenney, R.M. Cyclic and pathological changes of the mare endometrium as detected by biopsy, with a note on early embryonic death. J. Am. Vet. Med. Assoc. 1978, 172, 241–262. [Google Scholar]
- Gray, C.A.; Bartol, F.F.; Tarleton, B.J.; Wiley, A.A.; Johnson, G.A.; Bazer, F.W.; Spencer, T.E. Developmental Biology of Uterine Glands1. Biol. Reprod. 2001, 65, 1311–1323. [Google Scholar] [CrossRef]
- Allen, W.R.; Wilsher, S. A Review of Implantation and Early Placentation in the Mare. Placenta 2009, 30, 1005–1015. [Google Scholar] [CrossRef]
- Lehmann, J.; Ellenberger, C.; Hoffmann, C.; Bazer, F.W.; Klug, J.; Allen, W.R.; Sieme, H.; Schoon, H.-A. Morpho-functional studies regarding the fertility prognosis of mares suffering from equine endometrosis. Theriogenology 2011, 76, 1326–1336. [Google Scholar] [CrossRef]
- Yang, L.; Pang, Y.; Moses, H.L. TGF-β and immune cells: An important regulatory axis in the tumor microenvironment and progression. Trends Immunol. 2010, 31, 220–227. [Google Scholar] [CrossRef]
- Ueha, S.; Shand, F.H.W.; Matsushima, K. Cellular and Molecular Mechanisms of Chronic Inflammation-Associated Organ Fibrosis. Front. Immunol. 2012, 3, 71. [Google Scholar] [CrossRef]
- Zeisberg, M.; Kalluri, R. Cellular Mechanisms of Tissue Fibrosis. 1. Common and organ-specific mechanisms associated with tissue fibrosis. Am. J. Physiol.–Cell Physiol. 2013, 304, C216–C225. [Google Scholar] [CrossRef]
- Seki, E.; Brenner, D.A. Recent advancement of molecular mechanisms of liver fibrosis. J. Hepato-Biliary-Pancreat. Sci. 2015, 22, 512–518. [Google Scholar] [CrossRef]
- Ganjam, V.K.; Evans, T.J. Equine endometrial fibrosis correlates with 11β-HSD2, TGF-β1 and ACE activities. Mol. Cell. Endocrinol. 2006, 248, 104–108. [Google Scholar] [CrossRef]
- Szóstek-Mioduchowska, A.Z.; Lukasik, K.; Skarzynski, D.J.; Okuda, K. Effect of transforming growth factor -β1 on α-smooth muscle actin and collagen expression in equine endometrial fibroblasts. Theriogenology 2018, 124, 9–17. [Google Scholar] [CrossRef]
- Goteri, G.; Altobelli, E.; Tossetta, G.; Zizzi, A.; Avellini, C.; Licini, C.; Lorenzi, T.; Castellucci, M.; Ciavattini, A.; Marzioni, D. High Temperature Requirement A1, Transforming Growth Factor Beta 1, phosphoSmad2 and Ki67 in Eutopic and Ectopic Endometrium of Women with Endometriosis. Eur. J. Histochem. 2015, 59, 2570. [Google Scholar] [CrossRef]
- Buczkowska, J.; Kozdrowski, R.; Nowak, M.; Ra, A.; Mrowiec, J. Endometrosis–significance for horse reproduction, pathogenesis, diagnosis, and proposed therapeutic methods. Pol. J. Vet. Sci. 2014, 17, 547–554. [Google Scholar] [CrossRef]
- Viganò, P.; Ottolina, J.; Bartiromo, L.; Bonavina, G.; Schimberni, M.; Villanacci, R.; Candiani, M. Cellular Components Contributing to Fibrosis in Endometriosis: A Literature Review. J. Minim. Invasive Gynecol. 2020, 27, 287–295. [Google Scholar] [CrossRef]
- Smith, E.R.; Wigg, B.; Holt, S.G.; Hewitson, T.D. TGF-β1 modifies histone acetylation and acetyl-coenzyme A metabolism in renal myofibroblasts. Am. J. Physiol.-Ren. Physiol. 2019, 316, F517–F529. [Google Scholar] [CrossRef]
- Ronnov-Jessen, L.; Petersen, O.W. Induction of alpha-smooth muscle actin by transforming growth factor-beta 1 in quiescent human breast gland fibroblasts. Implications for myofibroblast generation in breast neoplasia. Lab. Investig. J. Tech. Methods Pathol. 1993, 68, 696–707. [Google Scholar]
- Hewitson, T.D.; Holt, S.G.; Tan, S.-J.; Wigg, B.; Samuel, C.S.; Smith, E.R. Epigenetic Modifications to H3K9 in Renal Tubulointerstitial Cells after Unilateral Ureteric Obstruction and TGF-β1 Stimulation. Front. Pharmacol. 2017, 8, 307. [Google Scholar] [CrossRef]
- Dees, C.; Pötter, S.; Zhang, Y.; Bergmann, C.; Zhou, X.; Luber, M.; Wohlfahrt, T.; Karouzakis, E.; Ramming, A.; Gelse, K.; et al. TGF-β–induced epigenetic deregulation of SOCS3 facilitates STAT3 signaling to promote fibrosis. J. Clin. Investig. 2020, 130, 2347–2363. [Google Scholar] [CrossRef]
- Duong, T.E.; Hagood, J.S. Epigenetic Regulation of Myofibroblast Phenotypes in Fibrosis. Curr. Pathobiol. Rep. 2018, 6, 79–96. [Google Scholar] [CrossRef] [PubMed]
- Du, J.; Johnson, L.M.; Jacobsen, S.E.; Patel, D.J. DNA methylation pathways and their crosstalk with histone methylation. Nat. Rev. Mol. Cell Biol. 2015, 16, 519–532. [Google Scholar] [CrossRef] [PubMed]
- Hermann, A.; Goyal, R.; Jeltsch, A. The Dnmt1 DNA-(cytosine-C5)-methyltransferase Methylates DNA Processively with High Preference for Hemimethylated Target Sites. J. Biol. Chem. 2004, 279, 48350–48359. [Google Scholar] [CrossRef]
- Egger, G.; Liang, G.; Aparicio, A.; Jones, P.A. Epigenetics in human disease and prospects for epigenetic therapy. Nature 2004, 429, 457–463. [Google Scholar] [CrossRef]
- Cheng, Y.; He, C.; Wang, M.; Ma, X.; Mo, F.; Yang, S.; Han, J.; Wei, X. Targeting epigenetic regulators for cancer therapy: Mechanisms and advances in clinical trials. Signal Transduct. Target. Ther. 2019, 4, 62. [Google Scholar] [CrossRef] [PubMed]
- Kaminskas, E.; Farrell, A.T.; Wang, Y.-C.; Sridhara, R.; Pazdur, R. FDA Drug Approval Summary: Azacitidine (5-azacytidine, Vidaza™) for Injectable Suspension. Oncologist 2005, 10, 176–182. [Google Scholar] [CrossRef] [PubMed]
- Marks, P.A. Discovery and development of SAHA as an anticancer agent. Oncogene 2007, 26, 1351–1356. [Google Scholar] [CrossRef]
- Barbarotta, R.L.M.; Hurley, R.K.; MaydenMSN, F.K.D.; Larson, M.P.; Geiger, M.D.; Watson, H. Romidepsin for the Treatment of Peripheral T-Cell Lymphoma. J. Adv. Pract. Oncol. 2015, 6, 22. [Google Scholar] [CrossRef]
- Laubach, J.P.; Moreau, P.; San-Miguel, J.F.; Richardson, P.G. Panobinostat for the Treatment of Multiple Myeloma. Clin. Cancer Res. 2015, 21, 4767–4773. [Google Scholar] [CrossRef]
- Sanaei, M.; Kavoosi, F. Effect of Zebularine in Comparison to and in Combination with Trichostatin A on CIP/KIP Family (p21Cip1/Waf1/Sdi1, p27Kip1, and p57Kip2), DNMTs (DNMT1, DNMT3a, and DNMT3b), Class I HDACs (HDACs 1, 2, 3) and Class II HDACs (HDACs 4, 5, 6) Gene Expression, Cell Growth Inhibition and Apoptosis Induction in Colon Cancer LS 174T Cell Line. Asian Pac. J. Cancer Prev. 2020, 21, 2131–2139. [Google Scholar] [CrossRef]
- Nepali, K.; Liou, J.-P. Recent developments in epigenetic cancer therapeutics: Clinical advancement and emerging trends. J. Biomed. Sci. 2021, 28, 1–58. [Google Scholar] [CrossRef]
- Hu, B.; Gharaee-Kermani, M.; Wu, Z.; Phan, S.H. Epigenetic Regulation of Myofibroblast Differentiation by DNA Methylation. Am. J. Pathol. 2010, 177, 21–28. [Google Scholar] [CrossRef]
- Constantinides, P.G.; Taylor, S.M.; Jones, P.A. Phenotypic conversion of cultured mouse embryo cells by aza pyrimidine nucleosides. Dev. Biol. 1978, 66, 57–71. [Google Scholar] [CrossRef]
- Santi, D.V.; Norment, A.; Garrett, C.E. Covalent bond formation between a DNA-cytosine methyltransferase and DNA containing 5-azacytosine. Proc. Natl. Acad. Sci. USA 1984, 81, 6993–6997. [Google Scholar] [CrossRef]
- Stresemann, C.; Lyko, F. Modes of action of the DNA methyltransferase inhibitors azacytidine and decitabine. Int. J. Cancer 2008, 123, 8–13. [Google Scholar] [CrossRef]
- Moore, L.D.; Le, T.; Fan, G. DNA Methylation and Its Basic Function. Neuropsychopharmacology 2013, 38, 23–38. [Google Scholar] [CrossRef]
- Jones, P.A.; Ohtani, H.; Chakravarthy, A.; De Carvalho, D.D. Epigenetic therapy in immune-oncology. Nat. Rev. Cancer 2019, 19, 151–161. [Google Scholar] [CrossRef]
- Nunes, S.P.; Henrique, R.; Jerónimo, C.; Paramio, J.M. DNA Methylation as a Therapeutic Target for Bladder Cancer. Cells 2020, 9, 1850. [Google Scholar] [CrossRef]
- Li, X.; Mei, Q.; Nie, J.; Fu, X.; Han, W. Decitabine: A promising epi-immunotherapeutic agent in solid tumors. Expert Rev. Clin. Immunol. 2015, 11, 363–375. [Google Scholar] [CrossRef] [PubMed]
- Takeshima, H.; Yoda, Y.; Wakabayashi, M.; Hattori, N.; Yamashita, S.; Ushijima, T. Low-dose DNA demethylating therapy induces reprogramming of diverse cancer-related pathways at the single-cell level. Clin. Epigenetics 2020, 12, 142. [Google Scholar] [CrossRef] [PubMed]
- Henderson, N.C.; Rieder, F.; Wynn, T.A. Fibrosis: From mechanisms to medicines. Nature 2020, 587, 555–566. [Google Scholar] [CrossRef] [PubMed]
- Weiskirchen, R.; Weiskirchen, S.; Tacke, F. Organ and tissue fibrosis: Molecular signals, cellular mechanisms and translational implications. Mol. Asp. Med. 2019, 65, 2–15. [Google Scholar] [CrossRef]
- O’Reilly, S. Epigenetics in fibrosis. Mol. Asp. Med. 2017, 54, 89–102. [Google Scholar] [CrossRef]
- Felisbino, M.B.; McKinsey, T.A. Epigenetics in Cardiac Fibrosis: Emphasis on inflammation and fibroblast activation. JACC: Basic Transl. Sci. 2018, 3, 704–715. [Google Scholar] [CrossRef]
- Bartczak, K.; Białas, A.J.; Kotecki, M.J.; Górski, P.; Piotrowski, W.J. More than a Genetic Code: Epigenetics of Lung Fibrosis. Mol. Diagn. Ther. 2020, 24, 665–681. [Google Scholar] [CrossRef]
- Alpoim-Moreira, J.; Fernandes, C.; Rebordão, M.R.; Amaral, A.; Pinto-Bravo, P.; Bliebernicht, M.; Skarzynski, D.J.; Ferreira-Dias, G. Collagens and DNA methyltransferases in mare endometrosis. Reprod. Domest. Anim. 2019, 54, 46–52. [Google Scholar] [CrossRef]
- Alpoim-Moreira, J.; Fernandes, C.; Pimenta, J.; Bliebernicht, M.; Rebordão, M.R.; Castelo-Branco, P.; Szóstek-Mioduchowska, A.; Skarzynski, D.J.; Ferreira-Dias, G. Metallopeptidades 2 and 9 genes epigenetically modulate equine endometrial fibrosis. Front. Veter- Sci. 2022, 9, 970003. [Google Scholar] [CrossRef] [PubMed]
- Da Costa, R.P.R.; Serrão, P.M.; Monteiro, S.; Pessa, P.; Silva, J.R.; Ferreira-Dias, G. Caspase-3-mediated apoptosis and cell proliferation in the equine endometrium during the oestrous cycle. Reprod. Fertil. Dev. 2007, 19, 925–932. [Google Scholar] [CrossRef]
- Kenney, R.M.; Doig, P.A. Equine endometrial biopsy. In Current Therapy in Theriogenology; Morrow, D.A., Ed.; W.B. Saunders: Philadelphia, PA, USA, 1986; pp. 723–729. [Google Scholar]
- Szóstek-Mioduchowska, A.Z.; Baclawska, A.; Okuda, K.; Skarzynski, D.J. Effect of proinflammatory cytokines on endometrial collagen and metallopeptidase expression during the course of equine endometrosis. Cytokine 2019, 123, 154767. [Google Scholar] [CrossRef]
- Szóstek-Mioduchowska, A.Z.; Shiotani, H.; Yamamoto, Y.; Sadowska, A.; Wójtowicz, A.; Kozai, K.; Hojo, T.; Kimura, K.; Skarzynski, D.J.; Okuda, K. Effects of cortisol on prostaglandin F2α secretion and expression of genes involved in the arachidonic acid metabolic pathway in equine endometrium–In vitro study. Theriogenology 2021, 173, 221–229. [Google Scholar] [CrossRef]
- Szóstek, A.Z.; Siemieniuch, M.J.; Lukasik, K.; Galvão, A.M.; Ferreira-Dias, G.M.; Skarzynski, D.J. mRNA transcription of prostaglandin synthases and their products in the equine endometrium in the course of fibrosis. Theriogenology 2012, 78, 768–776. [Google Scholar] [CrossRef]
- Smith, E.R.; Tan, S.-J.; Holt, S.G.; Hewitson, T.D. FGF23 is synthesised locally by renal tubules and activates injury-primed fibroblasts. Sci. Rep. 2017, 7, 3345. [Google Scholar] [CrossRef]
- Pan, X.; Chen, Z.; Huang, R.; Yao, Y.; Ma, G. Transforming Growth Factor β1 Induces the Expression of Collagen Type I by DNA Methylation in Cardiac Fibroblasts. PLoS ONE 2013, 8, e60335. [Google Scholar] [CrossRef] [PubMed]
- Yonemura, H.; Futakuchi, A.; Inoue-Mochita, M.; Fujimoto, T.; Takahashi, E.; Tanihara, H.; Inoue, T. DNA methyltransferase inhibitor suppresses fibrogenetic changes in human conjunctival fibroblasts. Mol. Vis. 2019, 25, 382–390. [Google Scholar]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Rebordão, M.R.; Amaral, A.; Lukasik, K.; Szóstek-Mioduchowska, A.; Pinto-Bravo, P.; Galvão, A.; Skarzynski, D.J.; Ferreira-Dias, G. Constituents of neutrophil extracellular traps induce in vitro collagen formation in mare endometrium. Theriogenology 2018, 113, 8–18. [Google Scholar] [CrossRef]
- Zhao, S.; Fernald, R.D.; Bylund, J.B.; Trinh, L.T.; Awgulewitsch, C.P.; Paik, D.T.; Jetter, C.; Jha, R.; Zhang, J.; Nolan, K.; et al. Comprehensive Algorithm for Quantitative Real-Time Polymerase Chain Reaction. J. Comput. Biol. 2005, 12, 1047–1064. [Google Scholar] [CrossRef]
- Watson, C.J.; Horgan, S.; Neary, R.; Glezeva, N.; Tea, I.; Corrigan, N.; McDonald, K.; Ledwidge, M.; Baugh, J. Epigenetic Therapy for the Treatment of Hypertension-Induced Cardiac Hypertrophy and Fibrosis. J. Cardiovasc. Pharmacol. Ther. 2016, 21, 127–137. [Google Scholar] [CrossRef]
- Neveu, W.A.; Mills, S.T.; Staitieh, B.S.; Sueblinvong, V. TGF-β1 epigenetically modifies Thy-1 expression in primary lung fibroblasts. Am. J. Physiol.-Cell Physiol. 2015, 309, C616–C626. [Google Scholar] [CrossRef]
- Alpoim-Moreira, J.; Fernandes, C.; Rebordão, M.R.; Costa, A.L.; Bliebernicht, M.; Nunes, T.; Szóstek-Mioduchowska, A.; Skarzynski, D.J.; Ferreira-Dias, G. Collagen Type III as a Possible Blood Biomarker of Fibrosis in Equine Endometrium. Animals 2022, 12, 1854. [Google Scholar] [CrossRef]
- Massague, J. The Transforming Growth Factor-beta Family. Annu. Rev. Cell Biol. 1990, 6, 597–641. [Google Scholar] [CrossRef] [PubMed]
- Busilacchi, E.M.; Costantini, A.; Mancini, G.; Tossetta, G.; Olivieri, J.; Poloni, A.; Viola, N.; Butini, L.; Campanati, A.; Goteri, G.; et al. Nilotinib Treatment of Patients Affected by Chronic Graft-versus-Host Disease Reduces Collagen Production and Skin Fibrosis by Downmodulating the TGF-β and p-SMAD Pathway. Biol. Blood Marrow Transplant. 2020, 26, 823–834. [Google Scholar] [CrossRef] [PubMed]
- Tossetta, G.; Paolinelli, F.; Avellini, C.; Salvolini, E.; Ciarmela, P.; Lorenzi, T.; Emanuelli, M.; Toti, P.; Giuliante, R.; Gesuita, R.; et al. IL-1β and TGF-β weaken the placental barrier through destruction of tight junctions: An in vivo and in vitro study. Placenta 2014, 35, 509–516. [Google Scholar] [CrossRef] [PubMed]
- Sanders, Y.Y.; Ambalavanan, N.; Halloran, B.; Zhang, X.; Liu, H.; Crossman, D.K.; Bray, M.; Zhang, K.; Thannickal, V.J.; Hagood, J.S. Altered DNA Methylation Profile in Idiopathic Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med. 2012, 186, 525–535. [Google Scholar] [CrossRef] [PubMed]
- Xiao, D.; Dasgupta, C.; Chen, M.; Zhang, K.; Buchholz, J.; Xu, Z.; Zhang, L. Inhibition of DNA methylation reverses norepinephrine-induced cardiac hypertrophy in rats. Cardiovasc. Res. 2014, 101, 373–382. [Google Scholar] [CrossRef]
- Park, J.-H.; Shin, J.-M.; Yang, H.-W.; Park, I.-H. DNMTs Are Involved in TGF-β1-Induced Epithelial–Mesenchymal Transitions in Airway Epithelial Cells. Int. J. Mol. Sci. 2022, 23, 3003. [Google Scholar] [CrossRef]
- Bechtel, W.; McGoohan, S.; Zeisberg, E.M.; Müller, G.A.; Kalbacher, H.; Salant, D.J.; Müller, C.A.; Kalluri, R.; Zeisberg, M. Methylation determines fibroblast activation and fibrogenesis in the kidney. Nat. Med. 2010, 16, 544–550. [Google Scholar] [CrossRef]
- Watson, C.J.; Collier, P.; Tea, I.; Neary, R.; Watson, J.A.; Robinson, C.; Phelan, D.; Ledwidge, M.T.; McDonald, K.M.; McCann, A.; et al. Hypoxia-induced epigenetic modifications are associated with cardiac tissue fibrosis and the development of a myofibroblast-like phenotype. Hum. Mol. Genet. 2014, 23, 2176–2188. [Google Scholar] [CrossRef]
- Zhang, B.; Zhou, Y.; Lin, N.; Lowdon, R.F.; Hong, C.; Nagarajan, R.P.; Cheng, J.B.; Li, D.; Stevens, M.; Lee, H.J.; et al. Functional DNA methylation differences between tissues, cell types, and across individuals discovered using the M&M algorithm. Genome Res. 2013, 23, 1522–1540. [Google Scholar] [CrossRef]
- Pushpakumar, S.; Kundu, S.; Narayanan, N.; Sen, U. DNA hypermethylation in hyperhomocysteinemia contributes to abnormal extracellular matrix metabolism in the kidney. FASEB J. 2015, 29, 4713–4725. [Google Scholar] [CrossRef]
- Russell-Hallinan, A.; Neary, R.; Watson, C.J.; Baugh, J.A. Repurposing from Oncology to Cardiology: Low-Dose 5-Azacytidine Attenuates Pathological Cardiac Remodeling in Response to Pressure Overload Injury. J. Cardiovasc. Pharmacol. Ther. 2021, 26, 375–385. [Google Scholar] [CrossRef]
- Robinson, C.M.; Neary, R.; Levendale, A.; Watson, C.J.; Baugh, J.A. Hypoxia-induced DNA hypermethylation in human pulmonary fibroblasts is associated with Thy-1 promoter methylation and the development of a pro-fibrotic phenotype. Respir. Res. 2012, 13, 74. [Google Scholar] [CrossRef]
- Zhang, N.; Liu, K.; Wang, K.; Zhou, C.; Wang, H.; Che, S.; Liu, Z.; Yang, H. Dust induces lung fibrosis through dysregulated DNA methylation. Environ. Toxicol. 2019, 34, 728–741. [Google Scholar] [CrossRef]
- Mann, J.; Oakley, F.; Akiboye, F.; Elsharkawy, A.; Thorne, A.W.; Mann, D.A. Regulation of myofibroblast transdifferentiation by DNA methylation and MeCP2: Implications for wound healing and fibrogenesis. Cell Death Differ. 2007, 14, 275–285. [Google Scholar] [CrossRef]
- Movassagh, M.; Choy, M.-K.; Knowles, D.A.; Cordeddu, L.; Haider, S.; Down, T.; Siggens, L.; Vujic, A.; Simeoni, I.; Penkett, C.; et al. Distinct Epigenomic Features in End-Stage Failing Human Hearts. Circulation 2011, 124, 2411–2422. [Google Scholar] [CrossRef]
- Esteller, M. Epigenetic gene silencing in cancer: The DNA hypermethylome. Hum. Mol. Genet. 2007, 16, R50–R59. [Google Scholar] [CrossRef]
Gene (Acession Number) | Sequence 5′-3′ | Amplicon (Base Pairs) | |
---|---|---|---|
Forward | Reverse | ||
a-SMA XM_001503035.6 | TCAGCTTCCCTGAACACCAC | GCAAAGCCAGCCTTACAAAG | 151 |
COL1A1 XM_014736922.1 | TAAGGGTGACAGAGGCGATG | GGACCGCTAGGACCAGTTTC | 144 |
COL3A1 ENSECAT00000026771.3 | CAAAGGAGAGCCAGGAGCAC | CTCCAGGCGAACCATCTTTG | 98 |
DNMT1 (XM_023645449.1) | CAAGGCAAACAACCAGGCA | CTTCCTCCTCTTCCGTGTGTGT | 237 |
DNMT3A (XM_023619394.1) | GCCTCAATGTCACCCTGGAA | AAGAGGTCCACACATTCCACG | 206 |
DNMT3B (XM_023626333.1) | GAGCTGGCAAGACTTTCCCC | TTGGGTGGAGGGCAGTAGTC | 198 |
SDHA2 DQ402987.1 | GAGGAATGGTCTGGAATACTG | GCCTCTGCTCCATAAATCG | 91 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alpoim-Moreira, J.; Szóstek-Mioduchowska, A.; Słyszewska, M.; Rebordão, M.R.; Skarzynski, D.J.; Ferreira-Dias, G. 5-Aza-2′-Deoxycytidine (5-Aza-dC, Decitabine) Inhibits Collagen Type I and III Expression in TGF-β1-Treated Equine Endometrial Fibroblasts. Animals 2023, 13, 1212. https://doi.org/10.3390/ani13071212
Alpoim-Moreira J, Szóstek-Mioduchowska A, Słyszewska M, Rebordão MR, Skarzynski DJ, Ferreira-Dias G. 5-Aza-2′-Deoxycytidine (5-Aza-dC, Decitabine) Inhibits Collagen Type I and III Expression in TGF-β1-Treated Equine Endometrial Fibroblasts. Animals. 2023; 13(7):1212. https://doi.org/10.3390/ani13071212
Chicago/Turabian StyleAlpoim-Moreira, Joana, Anna Szóstek-Mioduchowska, Magda Słyszewska, Maria Rosa Rebordão, Dariusz J. Skarzynski, and Graça Ferreira-Dias. 2023. "5-Aza-2′-Deoxycytidine (5-Aza-dC, Decitabine) Inhibits Collagen Type I and III Expression in TGF-β1-Treated Equine Endometrial Fibroblasts" Animals 13, no. 7: 1212. https://doi.org/10.3390/ani13071212
APA StyleAlpoim-Moreira, J., Szóstek-Mioduchowska, A., Słyszewska, M., Rebordão, M. R., Skarzynski, D. J., & Ferreira-Dias, G. (2023). 5-Aza-2′-Deoxycytidine (5-Aza-dC, Decitabine) Inhibits Collagen Type I and III Expression in TGF-β1-Treated Equine Endometrial Fibroblasts. Animals, 13(7), 1212. https://doi.org/10.3390/ani13071212