Supplementation of Schisandrin B in Semen Extender Improves Quality and Oxidation Resistance of Boar Spermatozoa Stored at 4 °C
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Chemicals
2.2. Collection and Processing of the Ejaculates
2.3. Experimental Designs
2.3.1. Experiment I: Effects of Different Concentrations of Sch B on Sperm Quality Parameters
2.3.2. Experiment II: Effects of Sch B on Antioxidant Capacity of Boar Sperm after Low Temperature Preservation
2.3.3. Experiment III: Effects of 10 μmol/L Sch B Supplementation to Boar Semen Dilution on Sperm Quality after Sperm Capacitation
2.4. Methods
2.4.1. Motility, Abnormal Sperm Morphology, Average Movement Velocity and Wobbility Analyzed with Computer-Assisted Semen Analysis (CASA)
2.4.2. Plasma Membrane Integrity of Spermatozoa by HOST
2.4.3. Acrosome Integrity of Sperm by Coomassie Brilliant Blue
2.4.4. Detection of Sperm DNA Damage Rate
2.4.5. MMP in Spermatozoa
2.4.6. Measurement of Oxidant-Antioxidant Status in Boar Sperm
2.4.7. Quantitative Real-Time PCR Analysis for SOD, CAT, GPx and Adhesion Protein Gene in Spermatozoa
2.4.8. Measurement of Sperm Free Ca2+ Influx
2.4.9. Lactic Acid Content in Spermatozoa
2.4.10. Assessment of PKA and PKG in Boar Sperm by ELISA
2.4.11. Sperm Capacitation
2.4.12. Data Analysis
3. Results
3.1. Experiment I
3.1.1. Effects of Sch B on the Motility, Abnormal Sperm Morphology, Average Movement Velocity and Wobbility of Boar Sperm after Chilling
3.1.2. Effects of Sch B on the Acrosome Integrity and Plasma Membrane Integrity of Boars Sperm
3.1.3. Effects of Sch B on the DNA Damage Rate and MMP Changes of Boars Sperm
3.2. Experiment II
3.2.1. Effects of Sch B on the SOD, CAT and GPx mRNAs Expression of Boar Sperm
3.2.2. Effects of Sch B on the MDA, ROS and T-AOC Level of Boar Sperm
3.2.3. Effects of Sch B on The Ca2+ and Lactic Acid Content of Boars Sperm
3.2.4. Effects of Sch B on the mRNA Expression of AWM, AQN1, AQN3, PSP-I and PSP-II of Boar Sperm
3.2.5. Effects of Sch B on PKA and PKG Levels of Boar Sperm
3.3. Experiment III
3.3.1. Effects of Sch B on Ca2+ and Lactic Acid Content in Capacitated Boar Sperm
3.3.2. Effect of Sch B on mRNA Expression of AWM, AQN1, AQN3, PSP-I, and PSP-II in Capacitated Boar Sperm
3.3.3. Effects of Sch B on PKA and PKG Levels in Capacitated Boar Sperm
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sarıözkan, S.; Bucak, M.N.; Tuncer, P.B.; Ulutaş, P.A.; Bilgen, A. The influence of cysteine and taurine on microscopic–oxidative stress parameters and fertilizing ability of bull semen following cryopreservation. Cryobiology 2009, 58, 134–138. [Google Scholar] [CrossRef]
- Bilodeau, J.-F.; Blanchette, S.; Gagnon, C.; Sirard, M.-A. Thiols prevent H2O2-mediated loss of sperm motility in cryopreserved bull semen. Theriogenology 2001, 56, 275–286. [Google Scholar] [CrossRef] [PubMed]
- Çoyan, K.; Başpınar, N.; Bucak, M.N.; Akalın, P.P.; Ataman, M.B.; Ömür, A.D.; Güngör, S.; Küçükgünay, S.; Özkalp, B.; Sarıözkan, S. Influence of methionine and dithioerythritol on sperm motility, lipid peroxidation and antioxidant capacities during liquid storage of ram semen. Res. Veter. Sci. 2010, 89, 426–431. [Google Scholar] [CrossRef] [PubMed]
- Sariozkan, S.; Bucak, M.N.; Tuncer, P.B.; Tasdemir, U.; Kinet, H.; Ulutas, P.A. Effects of different extenders and centrifuga-tion/washing on postthaw microscopic-oxidative stress parameters and fertilizing ability of Angora buck sperm. Theriogenology 2010, 73, 316–323. [Google Scholar] [CrossRef] [PubMed]
- Tuncer, P.B.; Bucak, M.N.; Sarıözkan, S.; Sakin, F.; Yeni, D.; Çiğerci, H.; Ateşşahin, A.; Avdatek, F.; Gündoğan, M.; Büyükleblebici, O. The effect of raffinose and methionine on frozen/thawed Angora buck (Capra hircus ancryrensis) semen quality, lipid peroxidation and antioxidant enzyme activities. Cryobiology 2010, 61, 89–93. [Google Scholar] [CrossRef] [PubMed]
- Nakagata, N.; Okamoto, M.; Ueda, O.; Suzuki, H. Positive Effect of Partial Zona-Pellucida Dissection on the in Vitro Fertilizing Capacity of Cryopreserved C57BL/6J Transgenic Mouse Spermatozoa of Low Motility. Biol. Reprod. 1997, 57, 1050–1055. [Google Scholar] [CrossRef]
- Ran, J.; Ma, C.; Xu, K.; Xu, L.; He, Y.; Moqbel, S.A.A.; Hu, P.; Jiang, L.; Chen, W.; Bao, J.; et al. Schisandrin B ame-liorated chondrocytes inflammation and osteoarthritis via suppression of NF-kappaB and MAPK signal pathways. Drug Des. Devel. Ther. 2018, 12, 1195–1204. [Google Scholar] [CrossRef]
- Shi, H.; Tang, H.; Ai, W.; Zeng, Q.; Yang, H.; Zhu, F.; Wei, Y.; Feng, R.; Wen, L.; Pu, P.; et al. Corrigendum: Schisandrin B Antagonizes Cardiotoxicity Induced by Pirarubicin by Inhibiting Mitochondrial Permeability Transition Pore (mPTP) Opening and Decreasing Cardiomyocyte Apoptosis. Front. Pharmacol. 2021, 12, 733805. [Google Scholar] [CrossRef]
- Min, H.-Y.; Park, E.-J.; Hong, J.-Y.; Kang, Y.-J.; Kim, S.-J.; Chung, H.-J.; Woo, E.-R.; Hung, T.M.; Youn, U.J.; Kim, Y.S.; et al. Antiproliferative effects of dibenzocyclooctadiene lignans isolated from Schisandra chinensis in human cancer cells. Bioorg. Med. Chem. Lett. 2008, 18, 523–526. [Google Scholar] [CrossRef]
- Wu, Y.; Li, Z.C.; Yao, L.Q.; Li, M.; Tang, M. Schisandrin B alleviates acute oxidative stress via modulation of the Nrf2/Keap1-mediated antioxidant pathway. Appl. Physiol. Nutr. Metab. 2019, 44, 1–6. [Google Scholar] [CrossRef]
- Zou, D.; Meng, X.; Xie, Y.; Liu, R.; Duan, J.; Bao, C.; Liu, Y.; Du, Y.; Xu, J.; Luo, Q.; et al. Schisandrin B for the treatment of male infertility. Clin. Transl. Med. 2021, 11, e333. [Google Scholar] [CrossRef] [PubMed]
- Ratnani, H.; Suprayogi, T.W.; Sardjito, T.; Susilowati, S.; Azura, S. Alpha-tocopherol improves sperm quality by regulate intracellular Ca2+ intensity (in-flux/efflux) of Simmental bull cattle sperm. Infect. Dis. Rep. 2020, 12, 8721. [Google Scholar] [CrossRef] [PubMed]
- Simpson, A.M.; Swan, M.A.; White, I.G. Susceptibility of epididymal boar sperm to cold shock and protective action of phosphatidylcholine. Gamete Res. 1987, 17, 355–373. [Google Scholar] [CrossRef] [PubMed]
- Ge, C.; Feng, N.; Hu, C.; Tang, Y.; Li, X.; Wang, X. Transwell isolation and difference analysis of capacitated boar sperm proteins based on the iTRAQ technique. Theriogenology 2021, 168, 13–24. [Google Scholar] [CrossRef] [PubMed]
- Cai, N.-N.; Wang, Z.-Z.; Zhu, X.-C.; Jiang, Y.; Zhu, W.-Q.; Yang, R.; Zhang, X.-M. Schisandrin A and B enhance the dentate gyrus neurogenesis in mouse hippocampus. J. Chem. Neuroanat. 2020, 105, 101751. [Google Scholar] [CrossRef]
- Zhang, W.; Wang, W.; Shen, C.; Wang, X.; Pu, Z.; Yin, Q. Network pharmacology for systematic understanding of Schisandrin B reduces the epithelial cells injury of colitis through regulating pyroptosis by AMPK/Nrf2/NLRP3 inflammasome. Aging 2021, 13, 23193–23209. [Google Scholar] [CrossRef]
- Li, Y.-J.; Liu, H.-T.; Xue, C.-J.; Xing, X.-Q.; Dong, S.-T.; Wang, L.-S.; Ding, C.-Y.; Meng, L.; Dong, Z.-J. The synergistic anti-tumor effect of schisandrin B and apatinib. J. Asian Nat. Prod. Res. 2019, 22, 839–849. [Google Scholar] [CrossRef]
- Yan, L.-S.; Zhang, S.-F.; Luo, G.; Cheng, B.C.-Y.; Zhang, C.; Wang, Y.-W.; Qiu, X.-Y.; Zhou, X.-H.; Wang, Q.-G.; Song, X.-L.; et al. Schisandrin B mitigates hepatic steatosis and promotes fatty acid oxidation by inducing autophagy through AMPK/mTOR signaling pathway. Metabolism 2022, 131, 155200. [Google Scholar] [CrossRef]
- Thandavarayan, R.A.; Giridharan, V.V.; Arumugam, S.; Suzuki, K.; Ko, K.M.; Krishnamurthy, P.; Watanabe, K.; Konishi, T. Schisandrin B Prevents Doxorubicin Induced Cardiac Dysfunction by Modulation of DNA Damage, Oxidative Stress and Inflammation through Inhibition of MAPK/p53 Signaling. PLoS ONE 2015, 10, e0119214. [Google Scholar] [CrossRef]
- Chiu, P.Y.; Leung, H.Y.; Ko, K.M. Schisandrin B Enhances Renal Mitochondrial Antioxidant Status, Functional and Structural Integrity, and Protects against Gentamicin-Induced Nephrotoxicity in Rats. Biol. Pharm. Bull. 2008, 31, 602–605. [Google Scholar] [CrossRef]
- Bansal, A.K.; Bilaspuri, G.S. Impacts of Oxidative Stress and Antioxidants on Semen Functions. Veter. Med. Int. 2011, 2011, 686137. [Google Scholar] [CrossRef] [PubMed]
- Jiang, E.-P.; Li, H.; Yu, C.-R.; Jing, S.; Sun, H.-X.; Wang, C.-M.; Fan, X.-T.; Chen, J.-G.; Wang, S. Schisandrin B protects PC12 cells against oxidative stress of neurodegenerative diseases. Neuroreport 2015, 26, 360–366. [Google Scholar] [CrossRef]
- Leong, P.K.; Chen, N.; Ko, K.M. Mitochondrial decay in ageing: Qi-invigorating schisandrin B as a hormetic agent for mitigating age-related diseases. Clin. Exp. Pharmacol. Physiol. 2011, 39, 256–264. [Google Scholar] [CrossRef] [PubMed]
- Del Prete, C.; Stout, T.; Montagnaro, S.; Pagnini, U.; Uccello, M.; Florio, P.; Ciani, F.; Tafuri, S.; Palumbo, V.; Pasolini, M.P.; et al. Combined addition of superoxide dismutase, catalase and glutathione peroxidase improves quality of cooled stored stallion semen. Anim. Reprod. Sci. 2019, 210, 106195. [Google Scholar] [CrossRef] [PubMed]
- Del Prete, C.; Ciani, F.; Tafuri, S.; Pasolini, M.P.; Della Valle, G.; Palumbo, V.; Abbondante, L.; Calamo, A.; Barbato, V.; Gualtieri, R.; et al. Effect of superoxide dismutase, catalase, and glutathione peroxidase supplementation in the extender on chilled semen of fertile and hypofertile dogs. J. Veter. Sci. 2018, 19, 667–675. [Google Scholar] [CrossRef]
- Donà, G.; Fiore, C.; Tibaldi, E.; Frezzato, F.; Andrisani, A.; Ambrosini, G.; Fiorentin, D.; Armanini, D.; Bordin, L.; Clari, G. Endogenous reactive oxygen species content and modulation of tyrosine phosphorylation during sperm capacitation. Int. J. Androl. 2010, 34, 411–419. [Google Scholar] [CrossRef]
- Romero, A.; Romão, M.J.; Varela, P.F.; Kölln, I.; Dias, J.M.; Carvalho, A.L.; Sanz, L.; Töpfer-Petersen, E.; Calvete, J.J. The crystal structures of two spermadhesins reveal the CUB domain fold. Nat. Struct. Biol. 1997, 4, 783–788. [Google Scholar] [CrossRef]
- Vadnais, M.L.; Roberts, K.P. Effects of Seminal Plasma on Cooling-Induced Capacitative Changes in Boar Sperm. J. Androl. 2006, 28, 416–422. [Google Scholar] [CrossRef]
- Lehti, M.S.; Sironen, A. Formation and function of sperm tail structures in association with sperm motility defects†. Biol. Reprod. 2017, 97, 522–536. [Google Scholar] [CrossRef]
- González-Cadavid, V.; Martins, J.A.M.; Moreno, F.B.; Andrade, T.S.; Santos, A.C.L.; Monteiro-Moreira, A.C.; Moreira, R.D.A.; Moura, A.A. Seminal plasma proteins of adult boars and correlations with sperm parameters. Theriogenology 2014, 82, 697–707. [Google Scholar] [CrossRef]
- Centurion, F.; Vazquez, J.M.; Calvete, J.; Roca, J.; Sanz, L.; Parrilla, I.; Garcia, E.M.; Martinez, E.A. Influence of Porcine Spermadhesins on the Susceptibility of Boar Spermatozoa to High Dilution1. Biol. Reprod. 2003, 69, 640–646. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.; Pang, W.-K.; Ryu, D.-Y.; Song, W.-H.; Rahman, S.; Park, Y.-J.; Pang, M.-G. Porcine seminal protein-I and II mRNA expression in boar spermatozoa is significantly correlated with fertility. Theriogenology 2019, 138, 31–38. [Google Scholar] [CrossRef] [PubMed]
- De Lazari, F.L.; Sontag, E.R.; Schneider, A.; Moura, A.A.A.; Vasconcelos, F.R.; Nagano, C.S.; Mattos, R.C.; Jobim, M.I.M.; Bustamante-Filho, I.C. Seminal plasma proteins and their relationship with sperm motility and morphology in boars. Andrologia 2019, 51, e13222. [Google Scholar] [CrossRef] [PubMed]
- Novak, S.; Ruiz-Sánchez, A.; Dixon, W.T.; Foxcroft, G.R.; Dyck, M.K. Seminal Plasma Proteins as Potential Markers of Relative Fertility in Boars. J. Androl. 2009, 31, 188–200. [Google Scholar] [CrossRef] [PubMed]
- De Oliveira, R.V.; Dogan, S.; Belser, L.E.; Kaya, A.; Topper, E.; Moura, A.; Thibaudeau, G.; Memili, E. Molecular morphology and function of bull spermatozoa linked to histones and associated with fertility. Reproduction 2013, 146, 263–272. [Google Scholar] [CrossRef]
- Parks, J.E.; Lynch, D.V. Lipid composition and thermo-tropic phase behavior of boar bull stallion and rooster sperm membranes. Cryobiology 1992, 29, 255–266. [Google Scholar] [CrossRef]
- Matsuzaki, M.; Mizushima, S.; Hiyama, G.; Hirohashi, N.; Shiba, K.; Inaba, K.; Suzuki, T.; Dohra, H.; Ohnishi, T.; Sato, Y.; et al. Lactic acid is a sperm motility inactivation factor in the sperm storage tubules. Sci. Rep. 2015, 5, 17643. [Google Scholar] [CrossRef]
- Carr, D.W.; Usselman, M.C.; Acott, T.S. Effects of pH, lactate, and viscoelastic drag on sperm motility: A species comparison. Biol Reprod. 1985, 33, 588–595. [Google Scholar] [CrossRef]
- Stival, C.; Puga Molina, L.D.C.; Paudel, B.; Buffone, M.G.; Visconti, P.E.; Krapf, D. Sperm capacitation and acrosome reaction in mammalian sperm. Adv. Anat. Embryol. Cell Biol. 2016, 220, 93–106. [Google Scholar]
- Visconti, E.P.; Krapf, D.; de la Vega-Beltrán, J.L.; Acevedo, J.J.; Darszon, A. Ion channels, phosphorylation and mammalian sperm capacitation. Asian J. Androl. 2011, 13, 395–405. [Google Scholar] [CrossRef]
- Gadella, B.; Harrison, R. The capacitating agent bicarbonate induces protein kinase A-dependent changes in phospholipid transbilayer behavior in the sperm plasma membrane. Development 2000, 127, 2407–2420. [Google Scholar] [CrossRef]
- De La Vega-Beltran, J.L.; Sánchez-Cárdenas, C.; Krapf, D.; Hernandez-González, E.O.; Wertheimer, E.; Trevino, C.L.; Visconti, P.E.; Darszon, A. Mouse Sperm Membrane Potential Hyperpolarization Is Necessary and Sufficient to Prepare Sperm for the Acrosome Reaction. J. Biol. Chem. 2012, 287, 44384–44393. [Google Scholar] [CrossRef]
- Escoffier, J.; Navarrete, F.; Haddad, D.; Santi, C.M.; Darszon, A.; Visconti, P.E. Flow Cytometry Analysis Reveals That Only a Subpopulation of Mouse Sperm Undergoes Hyperpolarization During Capacitation1. Biol. Reprod. 2015, 92, 121. [Google Scholar] [CrossRef]
- Buffone, M.G.; Wertheimer, E.V.; Visconti, P.E.; Krapf, D. Central role of soluble adenylyl cyclase and cAMP in sperm physiology. Biochim. Biophys. Acta Mol. Basis Dis. 2014, 1842, 2610–2620. [Google Scholar] [CrossRef]
- Visconti, P.E.; Bailey, J.L.; Moore, G.D.; Pan, D.; Olds-Clarke, P.; Kopf, G.S. Capacitation of mouse spermatozoa. I. Cor-relation between the capacitation state and protein tyrosine phosphorylation. Development 1995, 121, 1129–1137. [Google Scholar] [CrossRef]
- Liu, W.; Zhao, C.; Huang, Y.; Liu, Y.; Lu, M. The efficacy and molecular mechanism of the effect of schisandrin b on the treatment of erectile dysfunction. Iran J. Basic Med. Sci. 2019, 22, 866–871. [Google Scholar] [CrossRef]
- Wu, K.; Mei, C.; Chen, Y.; Guo, L.; Yu, Y.; Huang, D. C-type natriuretic peptide regulates sperm capacitation by the cGMP/PKG signalling pathway via Ca2+ influx and tyrosine phosphorylation. Reprod. Biomed. Online 2019, 38, 289–299. [Google Scholar] [CrossRef]
- Zalazar, L.; Stival, C.; Nicolli, A.R.; De Blas, G.A.; Krapf, D.; Cesari, A. Male Decapacitation Factor SPINK3 Blocks Membrane Hyperpolarization and Calcium Entry in Mouse Sperm. Front. Cell Dev. Biol. 2020, 8, 575126. [Google Scholar] [CrossRef]
- Bi, Y.; Xu, W.-M.; Wong, H.Y.; Zhu, H.; Zhou, Z.-M.; Chan, H.C.; Sha, J.-H. NYD-SP27, a novel intrinsic decapacitation factor in sperm. Asian J. Androl. 2009, 11, 229–239. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequences |
---|---|
SOD2 | F:GCTGGAAGCCATCAAACG |
R:TTAGAACAAGCGGCAATCTG | |
CAT | F:TGCCCATACTTCCCGTCC |
R:GGTCCAGGTTACCGTCAG | |
GPx | F:CAGGTACAGCCGTCGCTTTC |
R:AAAATCCCGAGAGTAGCACT | |
AQN1 | F:GCTGCTCAGTACAGCTACAC |
R:ATTACCAGCACCTGGCAGTC | |
AWN | F:CAATACCGCCTCTCAACCTC |
R:GGCCTTCTGGATCAGCATAG | |
AQN3 | F:AACGGGCAGGACCTGATAAC |
R:CCCTCAGACACGAGTCTAAG | |
GAPDH | F:CCCCAACGTGTCGGTTGT |
R:CTCGGACGCCTGCTTCAC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, Y.; Chen, Z.; Wang, Y.; Peng, X.; Feng, N.; Wang, X.; Tang, Y.; Li, X.; Xu, C.; Hu, C. Supplementation of Schisandrin B in Semen Extender Improves Quality and Oxidation Resistance of Boar Spermatozoa Stored at 4 °C. Animals 2023, 13, 848. https://doi.org/10.3390/ani13050848
Xie Y, Chen Z, Wang Y, Peng X, Feng N, Wang X, Tang Y, Li X, Xu C, Hu C. Supplementation of Schisandrin B in Semen Extender Improves Quality and Oxidation Resistance of Boar Spermatozoa Stored at 4 °C. Animals. 2023; 13(5):848. https://doi.org/10.3390/ani13050848
Chicago/Turabian StyleXie, Yunfa, Zhiying Chen, Yanling Wang, Xiayun Peng, Ni Feng, Xiaoye Wang, Yinsheng Tang, Xun Li, Chunrong Xu, and Chuanhuo Hu. 2023. "Supplementation of Schisandrin B in Semen Extender Improves Quality and Oxidation Resistance of Boar Spermatozoa Stored at 4 °C" Animals 13, no. 5: 848. https://doi.org/10.3390/ani13050848
APA StyleXie, Y., Chen, Z., Wang, Y., Peng, X., Feng, N., Wang, X., Tang, Y., Li, X., Xu, C., & Hu, C. (2023). Supplementation of Schisandrin B in Semen Extender Improves Quality and Oxidation Resistance of Boar Spermatozoa Stored at 4 °C. Animals, 13(5), 848. https://doi.org/10.3390/ani13050848