Dietary Supplementation with Lysozyme–Cinnamaldehyde Conjugates Enhances Feed Conversion Efficiency by Improving Intestinal Health and Modulating the Gut Microbiota in Weaned Piglets Infected with Enterotoxigenic Escherichia coli
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Experimental Design
2.2. Bacteria Preparation and Oral Challenge
2.3. Fecal Score and Rectal Temperature
2.4. Production Performance
2.5. Sample Collection
2.6. Measurement of Inflammatory Factor
2.7. Intestinal Section
2.8. Real-Time Fluorescence Quantitative PCR Detection
2.9. Western Blotting Analysis
2.10. 16S rDNA Sequencing
2.11. Statistical Analysis
3. Results
3.1. Production Performance, Fecal Scores, and Rectal Temperature
3.2. Inflammatory Cytokines
3.3. Gut Morphology
3.4. Intestinal Tight Junctions
3.5. Mucin and β-Defensin
3.6. Abundance of Genes Related to NF-κB/MAPK Signal Pathway
3.7. Gut Microbiome
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Correction Statement
References
- Gan, Z.; Wei, W.; Li, Y.; Wu, J.; Zhao, Y.; Zhang, L.; Wang, T.; Zhong, X. Curcumin and Resveratrol Regulate Intestinal Bacteria and Alleviate Intestinal Inflammation in Weaned Piglets. Molecules 2019, 24, 1220. [Google Scholar] [CrossRef]
- Zhang, R.; Huang, G.; Ren, Y.; Wang, H.; Ye, Y.; Guo, J.; Wang, M.; Zhu, W.; Yu, K. Effects of Dietary Indole-3-carboxaldehyde Supplementation on Growth Performance, Intestinal Epithelial Function, and Intestinal Microbial Composition in Weaned Piglets. Front. Nutr. 2022, 9, 896815. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Ma, X.; Jiang, X. Effects of Immobilized Antimicrobial Peptides on Growth Performance, Serum Biochemical Index, Inflammatory Factors, Intestinal Morphology, and Microbial Community in Weaning Pigs. Front. Immunol. 2022, 13, 872990. [Google Scholar] [CrossRef]
- Xu, L.; Wan, F.; Fu, H.; Tang, B.; Ruan, Z.; Xiao, Y.; Luo, Q. Emergence of Colistin Resistance Gene mcr-10 in Enterobacterales Isolates Recovered from Fecal Samples of Chickens, Slaughterhouse Workers, and a Nearby Resident. Microbiol. Spectr. 2022, 10, 599. [Google Scholar] [CrossRef]
- Morris, D.O.; Loeffler, A.; Davis, M.F.; Guardabassi, L.; Weese, J.S. Recommendations for approaches to meticillin-resistant staphylococcal infections of small animals: Diagnosis, therapeutic considerations and preventative measures. Vet. Dermatol. 2017, 28, 304. [Google Scholar] [CrossRef] [PubMed]
- Huo, Y.; Liu, Z.; Xuan, H.; Lu, C.; Yu, L.; Bao, W.; Zhao, G. Effects of bamboo vinegar powder on growth performance and mRNA expression levels of interleukin-10, interleukin-22, and interleukin-25 in immune organs of weaned piglets. Anim. Nutr. 2016, 2, 111–118. [Google Scholar] [CrossRef]
- Callewaert, L.; Michiels, C.W. Lysozymes in the animal kingdom. J. Biosci. 2010, 35, 127–160. [Google Scholar] [CrossRef] [PubMed]
- Oliver, W.T.; Wells, J.E. Lysozyme as an alternative to growth promoting antibiotics in swine production. J. Anim. Sci. Biotechnol. 2015, 6, 35. [Google Scholar] [CrossRef]
- Park, J.H.; Sureshkumar, S.; Kim, I.H. Effects of dietary lysozyme supplementation on growth performance, nutrient digestibility, intestinal microbiota, and blood profiles of weanling pigs challenged with Escherichia coli. J. Anim. Sci. Technol. 2021, 63, 501–509. [Google Scholar] [CrossRef]
- Long, Y.; Lin, S.; Zhu, J.; Pang, X.; Fang, Z.; Lin, Y.; Che, L.; Xu, S.; Li, J.; Huang, Y.; et al. Effects of dietary lysozyme levels on growth performance, intestinal morphology, non-specific immunity and mRNA expression in weanling piglets. Anim. Sci. J. 2016, 87, 411–418. [Google Scholar] [CrossRef]
- Deng, B.; Pan, H.; Wu, J.; Hua, W.; Li, Y.; Pan, H.; Xu, Z. Effects of dietary lysozyme on immune response and fecal microflora in both sows and their offspring. Rev. Bras. Zootec. 2021, 50. [Google Scholar] [CrossRef]
- Wu, T.; Huang, J.; Jiang, Y.; Hu, Y.; Ye, X.; Liu, D.; Chen, J. Formation of hydrogels based on chitosan/alginate for the delivery of lysozyme and their antibacterial activity. Food Chem. 2018, 240, 361–369. [Google Scholar] [CrossRef] [PubMed]
- Huang, G.; Li, X.; Lu, D.; Liu, S.; Suo, X.; Li, Q.; Li, N. Lysozyme improves gut performance and protects against enterotoxigenic Escherichia coli infection in neonatal piglets. Vet. Res. 2018, 49, 20. [Google Scholar] [CrossRef] [PubMed]
- Fedyn, J.; Piska, K.; Gunia-Krzyżak, A.; Pękala, E. Animal Enterotoxigenic Escherichia coli. Farm Policy 2020, 7, 619–627. [Google Scholar]
- Qi, L.; Mao, H.; Lu, X.; Shi, T.; Wang, J. Cinnamaldehyde Promotes the Intestinal Barrier Functions and Reshapes Gut Microbiome in Early Weaned Rats. Front. Nutr. 2021, 8, 748503. [Google Scholar] [CrossRef] [PubMed]
- Marquardt, R.R.; Jin, L.Z.; Kim, J.W.; Fang, L.; Frohlich, A.A.; Baidoo, S.K. Passive protective effect of egg-yolk antibodies against enterotoxigenic Escherichia coli K88+ infection in neonatal and early-weaned piglets. Fems. Immunol. Med. Microbiol. 1999, 4, 283–288. [Google Scholar] [CrossRef]
- Rodas, C.; Mamani, R.; Blanco, J.; Blanco, J.E.; Wiklund, G.; Svennerholm, A.-M.; Sjöling, A.; Iniguez, V. Enterotoxins, colonization factors, serotypes and antimicrobial resistance of enterotoxigenic Escherichia coli (ETEC) strains isolated from hospitalized children with diarrhea in Bolivia. Braz. J. Infect. Dis. 2011, 15, 132–137. [Google Scholar]
- Zhang, Y.; Tan, P.; Zhao, Y.; Ma, X. Enterotoxigenic Escherichia coli: Intestinal pathogenesis mechanisms and colonization resistance by gut microbiota. Gut Microbes 2022, 14, 2055943. [Google Scholar] [CrossRef]
- Valenta, C.; Bernkop-Schnürch, A.; Schwartz, M. Modification of lysozyme with cinnamaldehyde: A strategy for constructing novel preservatives for dermatics. Int. J. Pharm. 1997, 148, 131–137. [Google Scholar] [CrossRef]
- Tripathy, N.; Ahmad, R.; Bang, S.H.; Min, J.; Hahn, Y. Tailored lysozyme–ZnO nanoparticle conjugates as nanoantibiotics. Chem. Commun. 2014, 50, 9298–9301. [Google Scholar] [CrossRef]
- Shen, S.; Zhang, T.; Yuan, Y.; Lin, S.; Xu, J.; Ye, H. Effects of cinnamaldehyde on Escherichia coli and Staphylococcus aureus membrane. Food Control 2015, 47, 196–202. [Google Scholar] [CrossRef]
- Garas, L.C.; Cooper, C.A.; Dawson, M.W.; Wang, J.; Murray, J.D.; Maga, E.A. Young Pigs Consuming Lysozyme Transgenic Goat Milk Are Protected from Clinical Symptoms of Enterotoxigenic Escherichia coli Infection. J. Nutr. 2017, 147, 2050–2059. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Luo, Y.; Yu, B.; Zheng, P.; Yu, J.; Huang, Z.; Mao, X.; Luo, J.; Yan, H.; He, J. Agrobacterium sp. ZX09 β-Glucan Attenuates Enterotoxigenic Escherichia coli-Induced Disruption of Intestinal Epithelium in Weaned Pigs. Int. J. Mol. Sci. 2022, 23, 10290. [Google Scholar] [CrossRef]
- Boudry, G.L.; Ron, V.P.; Le Hue Rou-Luron, I.; Lallès, J.P.; Sève, B. Weaning Induces Both Transient and Long-Lasting Modifications of Absorptive, Secretory, and Barrier Properties of Piglet Intestine. J. Nutr. 2004, 134, 2256–2262. [Google Scholar] [CrossRef]
- Mo, K.; Yu, W.; Li, J.; Zhang, Y.; Xu, Y.; Huang, X.; Ni, H. Dietary supplementation with a microencapsulated complex of thymol, carvacrol, and cinnamaldehyde improves intestinal barrier function in weaning piglets. J. Sci. Food Agr. 2023, 103, 1994–2003. [Google Scholar] [CrossRef]
- Han, F.; Zhang, H.; Xia, X.; Xiong, H.; Song, D.; Zong, A.Y.W.X. Porcine β-Defensin 2 Attenuates Inammation and Mucosal Lesions in Dextran Sodium Sulfate—Induced Colitis. J. Immunol. 2015, 194, 1882–1893. [Google Scholar] [CrossRef]
- Al-Sayeqh, A.F.; Loughlin, M.F.; Dillon, E.; Mellits, K.H.; Connerton, I.F. Campylobacter jejuni activates NF-κB independently of TLR2, TLR4, Nod1 and Nod2 receptors. Microb. Pathog. 2010, 49, 294–304. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Wang, Y.; Zou, J.; Long, F.; Yan, H.; Zeng, L.; Chen, Y. Bifidobacterium adolescentis protects against necrotizing enterocolitis and upregulates TOLLIP and SIGIRR in premature neonatal rats. BMC Pediatr. 2017, 17, 1. [Google Scholar] [CrossRef]
- Lorenz, I.; Vogt, S. Investigations on the Association of D-lactate Blood Concentrations with the Outcome of Therapy of Acidosis, and with Posture and Demeanour in Young Calves with Diarrhoea. J. Vet. Med. Ser. A 2006, 53, 490–494. [Google Scholar] [CrossRef]
- Tamburini, S.; Shen, N.; Wu, H.C.; Clemente, J.C. The microbiome in early life: Implications for health outcomes. Nat. Med. 2016, 22, 713–722. [Google Scholar] [CrossRef]
- Wang, T.; Yao, W.; Li, J.; Shao, Y.; He, Q.; Xia, J.; Huang, F. Dietary garcinol supplementation improves diarrhea and intestinal barrier function associated with its modulation of gut microbiota in weaned piglets. J. Anim. Sci. Biotechnol. 2020, 11, 12. [Google Scholar] [CrossRef] [PubMed]
- Tan, F.H.P.; Liu, G.; Lau, S.Y.A.; Jaafar, M.H.; Park, Y.-H.; Azzam, G.; Li, Y.; Liong, M.-T. Lactobacillus probiotics improved the gut microbiota profile of a Drosophila melanogaster Alzheimer’s disease model and alleviated neurodegeneration in the eye. Benef. Microbes 2020, 11, 79–89. [Google Scholar] [CrossRef] [PubMed]
- Toscano, M.; De Grandi, R.; Miniello, V.L.; Mattina, R.; Drago, L. Ability of Lactobacillus kefiri LKF01 (DSM32079) to colonize the intestinal environment and modify the gut microbiota composition of healthy individuals. Digest Liver Dis. 2017, 49, 261–267. [Google Scholar] [CrossRef]
- Anderson, R.C.; Cookson, A.L.; McNabb, W.C.; Park, Z.; McCann, M.J.; Kelly, W.J.; Roy, N.C. Lactobacillus plantarum MB452 enhances the function of the intestinal barrier by increasing the expression levels of genes involved in tight junction formation. Bmc. Microbiol. 2010, 10, 316. [Google Scholar] [CrossRef]
- Cario, E.; Gerken, G.; Podolsky, D.K. Toll-like receptor 2 enhances ZO-1-associated intestinal epithelial barrier integrity via protein kinase C. Gastroenterology 2004, 127, 224–238. [Google Scholar] [CrossRef] [PubMed]
- Foysal, M.J.; Fotedar, R.; Siddik, M.; Tay, A. Lactobacillus acidophilus and L. plantarum improve health status, modulate gut microbiota and innate immune response of marron (Cherax cainii). Sci. Rep. 2020, 10, 5916. [Google Scholar] [CrossRef]
- Liu, H.; Hou, C.; Wang, G.; Jia, H.; Yu, H.; Zeng, X.; Thacker, P.A.; Zhang, G.; Qiao, S. Lactobacillus reuteri I5007 Modulates Intestinal Host Defense Peptide Expression in the Model of IPEC-J2 Cells and Neonatal Piglets. Nutrients 2017, 9, 559. [Google Scholar] [CrossRef]
Ingredient Composition | Content (%) | Calculated Nutrient Profile b | Content |
---|---|---|---|
corn (7.4%, CP) | 22.16 | Digestible energy (MJ/kg) | 14.83 |
broken rice (7.6%, CP) | 31.09 | Crude protein (%) c | 17.98 |
soybean meal (43%, CP) | 16.0 | Crude fat (%) c | 5.18 |
extruded soybean (35%, CP) | 3.00 | Dry matter (%) c | 89.51 |
fermented soybean (50%, CP) | 5.00 | Crude fiber (%) c | 2.17 |
Peruvian fish meal (65%, CP) | 3.50 | Ash (%) c | 5.55 |
whey (3%, CP) | 7.50 | Calcium (%) c | 0.80 |
glucose | 1.25 | Phosphorus (%) c | 0.68 |
sucrose | 3.50 | Available phosphorus (%) c | 0.48 |
soybean oil | 2.60 | Lysine (%) c | 1.39 |
calcium hydrophosphate | 1.20 | Digestible lysine (%) c | 1.25 |
acidifier | 0.20 | Digestible methionine + Cystine (%) c | 0.69 |
limestone | 0.60 | Digestible threonine (%) c | 0.74 |
salt | 0.30 | Digestible tryptophan (%) c | 0.21 |
zinc oxide (78%, Zn) | 0.20 | ||
choline chloride (50%) | 0.10 | ||
L-lysine HCl (98.5%) | 0.25 | ||
DL-methionine (99%) | 0.28 | ||
L-threonine (98.5%) | 0.22 | ||
L-tryptophan (98.5%) | 0.05 | ||
premix a | 1.00 |
Genes | Accession | Direction | Sequences (5′–3′) |
---|---|---|---|
TLR4 | NM_001113039.1 | Forward | GCCATCGCTGCTAACATCATC |
Reverse | CTCATACTCAAAGATACACCATCGG | ||
MyD88 | NM_001099923.1 | Forward Reverse | TGGTAGTGGTTGTCTCTGATGA TGGAGAGAGGCTGAGTGCAA |
IKKα | NM_001114279.1 | Forward Reverse | TCTTGATCCTCGGAAACCAG TGCTTCGGCCCATACTTTAC |
IKKβ | NM_001099935.1 | Forward Reverse | CCTCACCTTGCTGAGTGACA TCCCCACAAAGGAGGTACAG |
IκB | EU399817.1 | Forward Reverse | CTGCTCGGCAATAACACTGA GAGAGGAGACCGTTGGTGAG |
TRAF-6 | XM_013990069.2 | Forward Reverse | GCTGCATCTATGGCATTTGAAG CCACAGATAACATTTGCCAAAGG |
TAK1 | NM_001114280.1 | Forward Reverse | CATGTGGGCTGTTCATAACG GAGTTGCTCTGGCCTTCATC |
SIGIRR | NM_001315689.1 | Forward Reverse | ACCTGGGCTCCCGAAACTAC GTCATCTTCTGACACCAGGCAAT |
TOLLIP | NM_001315800.1 | Forward Reverse | CCCGCGCTGGAATAAGG CATCAAAGATCTCCAGGTAGAAGGA |
PBD-1 | NM_213838.1 | Forward Reverse | ACCGCCTCCTCCTTGTATTC CACAGGTGCCGATCTGTTTC |
pBD-2 | NM_214442.2 | Forward Reverse | ATTAACCTGCTTACGGGTCTTGGC CCACTGTAACAGGTCCCTTCAATCC |
pBD-3 | XM_021074698.1 | Forward Reverse | TCTTCTTGTTCCTGATGCCTCTTCC GCCACTCACAGAACAGCTACCTATC |
MUC1 | XM_021089730.1 | Forward Reverse | TTCTTCGGGCTGTTGCTACT ACTGTCTTGGAAGGCCAGAA |
MUC2 | NM_010843.1 | Forward Reverse | CTCCATCCGCTTCAGAAAAG ACTACCTGGGGCCTCTGAAT |
MUC4 | XM_021068274.1 | Forward Reverse | CCTCCCAAGCAGATGTCAAT CTGGGATAAGAATGCCTCCA |
β-Actin | XM_021086047.1 | Forward Reverse | GATCTGGCACCACACCTTCTACAAC TCATCTTCTCACGGTTGGCTTTGG |
Names | Company | Cat. No. | Dilution Multiple |
---|---|---|---|
Claudin-1 | Abcam (Cambridge, UK) | ab15098 | 1:1000 |
Occludin | Abcam (Cambridge, UK) | ab31721 | 1:1000 |
ZO-1 | Abcam (Cambridge, UK) | ab31721 | 1:1000 |
β-actin | Bioss (Beijing, China) | bs-0061R | 1:5000 |
Second antibody (Goat anti-rabbit) | ZenBio (Chengdu, China) | 511203 | 1:5000 |
Items | Treatments | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|
CON | CON + ETEC | ATB + ETEC | LC | LC + ETEC | |||
Average body weight (kg) | |||||||
0 d | 7.10 | 7.09 | 7.08 | 7.06 | 7.11 | 0.06 | 1.00 |
7 d | 8.75 | 8.71 | 8.81 | 8.80 | 8.85 | 0.05 | 0.91 |
14 d | 10.97 | 10.58 | 10.85 | 11.05 | 10.86 | 0.10 | 0.40 |
Pre-challenge (0–7 d) | |||||||
ADFI (g) | 322.27 | 318.19 | 339.28 | 339.17 | 341.74 | 7.48 | 0.81 |
ADG (g) | 235.24 | 231.43 | 246.43 | 248.57 | 248.33 | 5.42 | 0.80 |
F/G | 1.37 | 1.38 | 1.38 | 1.36 | 1.38 | 0.03 | 0.44 |
Post-challenge (7–14 d) | |||||||
ADFI (g) | 481.97 | 460.28 | 452.41 | 486.27 | 444.69 | 11.24 | 0.74 |
ADG (g) | 319.24 | 267.03 | 290.95 | 321.91 | 284.12 | 7.75 | 0.06 |
F/G | 1.51 b | 1.72 a | 1.55 b | 1.50 b | 1.57 b | 0.02 | 0.00 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, Z.; Chen, J.; Lin, T.; Zhu, J.; Gan, H.; Chen, F.; Zhang, S.; Guan, W. Dietary Supplementation with Lysozyme–Cinnamaldehyde Conjugates Enhances Feed Conversion Efficiency by Improving Intestinal Health and Modulating the Gut Microbiota in Weaned Piglets Infected with Enterotoxigenic Escherichia coli. Animals 2023, 13, 3497. https://doi.org/10.3390/ani13223497
Tian Z, Chen J, Lin T, Zhu J, Gan H, Chen F, Zhang S, Guan W. Dietary Supplementation with Lysozyme–Cinnamaldehyde Conjugates Enhances Feed Conversion Efficiency by Improving Intestinal Health and Modulating the Gut Microbiota in Weaned Piglets Infected with Enterotoxigenic Escherichia coli. Animals. 2023; 13(22):3497. https://doi.org/10.3390/ani13223497
Chicago/Turabian StyleTian, Zhezhe, Jiaming Chen, Tongbin Lin, Junhua Zhu, Haoyang Gan, Fang Chen, Shihai Zhang, and Wutai Guan. 2023. "Dietary Supplementation with Lysozyme–Cinnamaldehyde Conjugates Enhances Feed Conversion Efficiency by Improving Intestinal Health and Modulating the Gut Microbiota in Weaned Piglets Infected with Enterotoxigenic Escherichia coli" Animals 13, no. 22: 3497. https://doi.org/10.3390/ani13223497
APA StyleTian, Z., Chen, J., Lin, T., Zhu, J., Gan, H., Chen, F., Zhang, S., & Guan, W. (2023). Dietary Supplementation with Lysozyme–Cinnamaldehyde Conjugates Enhances Feed Conversion Efficiency by Improving Intestinal Health and Modulating the Gut Microbiota in Weaned Piglets Infected with Enterotoxigenic Escherichia coli. Animals, 13(22), 3497. https://doi.org/10.3390/ani13223497