Next Article in Journal
IgY Antibodies from Birds: A Review on Affinity and Avidity
Next Article in Special Issue
Deep Sequencing of Porcine Reproductive and Respiratory Syndrome Virus ORF7: A Promising Tool for Diagnostics and Epidemiologic Surveillance
Previous Article in Journal
Nighttime Lighting Influences on the Plankton Feeding and Growth of Juvenile Pacific Bluefin Tuna, Thunnus orientalis
Previous Article in Special Issue
Triplex-Loop-Mediated Isothermal Amplification Combined with a Lateral Flow Immunoassay for the Simultaneous Detection of Three Pathogens of Porcine Viral Diarrhea Syndrome in Swine
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 19
10.3390/ani13193129
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Epidemiologic and Genomic Characterizations of Porcine Kobuviruses in Diarrheic and Healthy Pigs

by
Yu Zang
1,†,
Binghui Feng
1,†,
Zitao Huang
2,
Dashi Zhao
1,
Wenhao Qi
1,
Yuejia Qiu
1,
Ming Qiu
1,
Chen Li
1,
Hong Lin
1,
Wanglong Zheng
1,
Jianzhong Zhu
1,3,4,5,6 and
Nanhua Chen
1,3,4,5,6,7,8,*
1
College of Veterinary Medicine, Yangzhou University, Yangzhou 225009, China
2
Animal Health Supervision Institute of Fengxi District, Chaozhou 521031, China
3
Joint International Research Laboratory of Agriculture and Agri-Product Safety, Yangzhou 225009, China
4
International Research Laboratory of Prevention and Control of Important Animal Infectious Diseases and Zoonotic Diseases of Jiangsu Higher Education Institutions, Yangzhou 225009, China
5
Comparative Medicine Research Institute, Yangzhou University, Yangzhou 225009, China
6
Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou University, Yangzhou 225009, China
7
Key Laboratory of Animal Pathogen Infection and Immunology of Fujian Province, Fuzhou 350002, China
8
Fujian Provincial Key Laboratory for Prevention and Control of Animal Infectious Diseases and Biotechnology, Longyan University, Longyan 364012, China
*
Author to whom correspondence should be addressed.
†
These authors contribute equally to this work.
Animals 2023, 13(19), 3129; https://doi.org/10.3390/ani13193129
Submission received: 29 August 2023 / Revised: 30 September 2023 / Accepted: 6 October 2023 / Published: 7 October 2023
(This article belongs to the Special Issue Prevalence and Diagnosis of Viral Diseases in Pig Production)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Enteric diseases pose huge threats to the global swine industry. Porcine kobuvirus (PKV) is a newly emerging enteric virus, but the role of PKV in causing enteric diseases is unclear. Here, we evaluated the up-to-date prevalence and evolution of PKV in both diarrheic and healthy pigs. Our results showed that PKV was highly prevalent in Chinese swine herds during 2018–2022. In addition, PKV is frequently co-infected with porcine epidemic diarrhea virus (PEDV). Most PKV and PEDV double-positive pigs were clinically diseased, while most PKV-positive but PEDV-negative pigs were clinically healthy, suggesting that PKV is unlikely to be a direct gastroenteritis-causing virus but a potential opportunistic pathogen. Furthermore, three PKV genomes were obtained and submitted for evolutionary evaluation. The results indicated that Chinese PKV has evolved into three groups, and SH-W-CHN-like viruses are predominant. Moreover, even though mutations frequently occurred during the evolution of PKV in China, large amounts of them are nonsense and strong negative selection seems to play a critical role in maintaining the antigenic stability. Overall, this study not only provides an epidemiological clue on the role of PKV in enteric diseases, but also the evolutionary status of PKV in both diarrheic and healthy pigs in China.

Abstract

Porcine kobuvirus (PKV) is an enteric virus commonly detected in both diarrheic and healthy pigs. Little is known about the role of PKV in enteric diseases. In this study, an epidemiological investigation based on 324 intestinal samples collected from six provinces of China during the period of 2018 to 2022 was performed, and showed that PKV has an overall 65.43% (212/324) positive rate. Noticeably, 89.47% (17/19) of PKV and porcine epidemic diarrhea virus (PEDV) double-positive pigs were clinically diseased, while 91.71% (177/193) of PKV-positive but PEDV-negative pigs were clinically healthy, suggesting that PKV infection in itself is unlikely to cause enteric diseases. In addition, three PKV genomes were obtained from both diseased and healthy pigs. Phylogenetic analysis showed that Chinese PKV strains could be divided into three groups (SH-W-CHN-like, S-1-HUN-like and JXAT2015-like strains). All three obtained PKV genomes belong to SH-W-CHN-like strains and JSYZ1806-158 was detected as a recombinant virus. Furthermore, multiple comparisons showed that nucleotide similarities are clearly lower than amino acid similarities for PKV polyproteins. Selective pressure analysis indicated that Chinese PKV polyproteins are predominantly under negative selection. Overall, this study provided new insights into the prevalence and evolution of PKV in both diarrheic and healthy pigs in China.

1. Introduction

Kobuviruses are positive-sense single-stranded RNA viruses belonging to the genus of Kobuvirus in the family of Piconaviridae [1]. The genomes of kobuviruses are ~8.2–8.4 kb and contain a 5′ untranslated region (UTR), a single open reading frame (ORF), a 3′ UTR and a polyA tail [2]. The ORF encodes a polyprotein consisting of a leader protein (L), three structural capsid proteins (VP0, VP3 and VP1) and seven non-structural proteins (2A, 2B, 2C, 3A, 3B, 3C and 3D) [3,4]. Kobuviruses can be divided into three species: Aichivirus A, Aichivirus B and Aichivirus C [5]. The prototype isolates of these three species are human Aichivirus A846/88 strain [6], bovine kobuvirus U-1 strain [7] and porcine kobuvirus (PKV) S-1-HUN strain [1], respectively.
Kobuviruses have a wide range of hosts, including human, cattle, pig, sheep, goat, dog, cat, rabbit, bird, ferret, rodent and bat [8,9,10]. An epidemiological investigation in Vietnam indicated that frequent cross-species transmission of Kobuviruses could be detected both within and among mammalian species [11]. But PKV is only found in pigs [12]. PKV was first discovered in Hungary in 2007 [1] and subsequently found in countries all around the world, including China [13], Thailand [14], Japan [15], South Korea [16], Brazil and The Netherlands [17], Italy [18], the United States [19], the Czech Republic [20], Kenya [21], Vietnam [22], Slovakia [23], Ireland [24], Denmark [25], Belgium [26], Hungary [27], Serbia [8], Mexico [28] and India [29]. Besides the wide spread of PKV all around the world, its prevalence rate is also high, ranging from 13% to 99% in domestic pigs [8,9,14,21].
However, the pathogenic capability of PKV in pigs is still questioned. A statistical analysis showed that 84.5% (71/84) of samples from diarrheic pigs were PKV-positive, but only 19.3% (16/83) samples from control pigs were PKV-positive, suggesting that PKV infection is closely correlated with gastrointestinal diseases in pigs [30]. In contrast, another study showed that samples from control pigs (33.8%, 49/145) have an even higher PKV-positive rate than samples from diarrheic pigs (24.7%, 59/239) [27]. Therefore, whether PKV is a directly causative virus for gastrointestinal diseases in young pigs deserves further investigation.
Several swine enteric viruses, such as porcine epidemic diarrhea virus (PEDV) and transmissible gastroenteritis virus (TGEV), have been confirmed as direct causative pathogens for diarrhea in neonatal piglets [31]. PKV is also an enteric virus, but its exact role in diarrheic diseases is still unclear. Our previous metagenomic and pathogenic analyses showed that PKV is the most abundant virus (58.33%), followed by PEDV (34.45%) in several diarrheic neonatal piglets [32]. Furthermore, significant in vivo replications of PKV and PEDV are concurrent with diarrheic diseases in neonatal piglets. Organ distribution analysis also showed that intestinal tissues have the highest virus loads of PKV and PEDV, suggesting that PKV and PEDV are closely associated with neonatal diarrheic diseases.
To determine the prevalence of PKV in China, here, we performed an epidemiological investigation based on 324 intestinal samples (64 from diarrheic piglets < 10 days old and 260 from pigs > one month old without enteric diseases) collected from six provinces of China in 2018–2022. The correlations between PKV infection, PEDV infection and clinical diseases were also evaluated. To evaluate the evolution of PKV in Chinese swine herds, three nearly complete genomes were obtained from diarrheic and healthy pigs and submitted for phylogenetic analysis, multiple comparison, recombination detection and selective pressure analysis.

2. Materials and Methods

2.1. Clinical Sample Collection

A total of 324 intestinal samples (duodenum or jejunum based on the availability of clinical samples) were submitted to our laboratory from six provinces of China (Shandong, Henan, Jiangsu, Fujian, Guangdong and Xinjiang) from April 2018 to February 2022. Out of 324 samples, 64 were collected from clinically diseased piglets up to the age of 10 days old. Their symptoms mainly included diarrhea, anorexia, vomiting and death. The other 260 samples were collected from pigs (>one month old) without enteric diseases. This study did not deal with live animals and did not require animal ethics approval.

2.2. Real-Time PCR Detection and Genomic Sequencing

To analyze the infection rate of PKV and PEDV in Chinese swine herds in recent years, total RNAs were extracted from these clinically intestinal samples using TRIpure Reagent (Aidlab, Beijing, China) according to the manufacturer’s instructions. cDNAs were produced via reverse transcription using HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper, Vazyme, Nanjing, China). The obtained sample cDNAs were tested using our previously described PKV and PEDV real-time RT-PCR (qPCR) assays [32] using StepOne Plus Real-time PCR System (Thermo Fisher Scientific, Waltham, MA, USA) and Q711-00 hamQ Universal SYBR qPCR Master Mix (Vazyme, China). In addition, all PKV qPCR amplicons were further confirmed through Sanger sequencing (Genewiz, Suzhou, China). Three PKV-positive samples from three cities of three provinces (Yangzhou city of Jiangsu province, Kashi city of Xinjiang province, Chaozhou city of Guangdong province) and from the period of 2018 to 2022 were selected as representative samples and submitted for genome sequencing (Table 1). The PKV genome amplification of a representative sample (GDCZ2202-1606) containing seven overlapping fragments is shown in Figure 1.

2.3. Sequence Alignment and Phylogenetic Analysis

To evaluate the up-to-date evolution of Chinese PKV, multiple sequence alignment was performed using ClustalX 2.0 (Conway Institute, University College Dublin, UK) based on three PKV polyprotein sequences obtained in this study, thirty available Chinese PKV polyprotein sequences, and three representative polyprotein sequences from Archiviruses A, B and C. The phylogenetic tree was constructed based on the aligned sequences using MEGA 6.06 (Pennsylvania State University, State College, PA, USA) with neighbor-joining method and maximum composite likelihood model, which included transitions and transversions, substitutions, homogeneous patterns among lineages and uniform rates among sites [33]. The robustness of the phylogenetic tree was evaluated through bootstrapping with 1000 replicates.

2.4. Recombination Detection and Selective Pressure Analysis

Recombination events within PKV polyprotein-encoding sequences were detected using RDP4, as we have previously reported [34]. Briefly, seven methods embedded in RDP version 4 software, RDP, GENECONV, BootScan, MaxChi, Chimaera, SiScan and 3Seq, were utilized to detect recombination events and breakpoints. The default settings were used for all seven methods. The highest acceptable p-value was set at 0.05, as described previously [35]. The potential recombination events detected using RDP4 were further evaluated using SimPlot 3.5.1 (Johns Hopkins University, Baltimore, MD, USA).
Selective pressure analysis was performed based on all available Chinese PKV polyprotein-encoding sequences. The selective pressure was evaluated through the ratio of dN/dS, as previously described [36]. When the dN/dS ratio was higher, equal to or lower than 1, it was considered positive, neutral, and negative selection, respectively. The alignment was evaluated for selection using the single-likelihood ancestor counting (SLAC), fixed effects likelihood (FEL) and a fast, unconstrained Bayesian approximation for inferring selection (FUBAR) methods, provided by the Data-Monkey Web Server (http://www.datamonkey.org, accessed on 15 August 2023) [37]. Sites were considered under selective pressure only when detected by at least two methods. The significance level was set at p < 0.05 for SLAC and FEL and a posterior probability higher than 0.95 for FUBAR as previously described [38].

3. Results

3.1. PKV Is Highly Prevalent in Chinese Swine Herds

Real-time RT-PCR results showed that the overall PKV-positive rate is 65.43% (212/324) (Table 2). In addition, PKV could be detected in all six provinces, with positive rates from 21.43% to 82.14%. Meanwhile, PKV could be detected every year from 2018 to 2022, with positive rates of 25.00–87.29%. Furthermore, retrospective analysis based on our results and Chinese PKV sequences available from GenBank suggested that PKV has been detected in at least 26 provinces/cities of China (Figure 2).

3.2. PKV Is Unlikely to Be a Direct Causative Pathogen for Enteric Diseases

To evaluate the correlations of PKV infection, PEDV infection and clinical diseases, we also detected PEDV infection in these 324 intestinal samples. The results showed that 9.88% (32/324) of the intestinal samples were PEDV-positive (Table 3). Most (90.63%, 29/32) of the PEDV-positive samples were from clinically diarrheic piglets. Noticeably, 89.47% (17/19) of the PKV and PEDV double-positive pigs were clinically diseased. Meanwhile, 88.01% (257/292) of PEDV-negative pigs did not present enteric diseases, while 91.71% (177/193) of only PKV-positive but PEDV-negative pigs were also clinically healthy. In addition, only 11.98% (35/292) of PEDV-negative pigs were clinically diseased and only 8.29% (16/193) of PKV-positive but PEDV-negative pigs were from the group of diarrheic piglets. These results suggested that PKV infection in itself is less likely to cause enteric diseases.

3.3. PKV Strains Are Rapidly Evolving in Chinese Swine Herds

To analyze the dynamic evolution of PKV in Chinese swine herds, three representative PKV-positive samples were submitted for genome sequencing, and the obtained nearly complete genomes were submitted to GenBank with the accession numbers OR364986, ON007233 and OR364987 (Table 4). Due to incomplete 5′UTR and 3′UTR sequences of available PKV genomes, the entire polyprotein-encoding sequences were used for multiple comparisons and phylogenetic analysis. Multiple sequence alignment showed that Chinese PKV strains contain an amino acid (aa) insertion at position 1023 of the polyprotein within the VP1 region compared with the S-1-HUN strain. In addition, the unique 30-aa-deletion in 3B was detected in the JSYZ1806-158 and GDCZ2202-1606 strains but not in the XJ1904-34 strain (Figure 3). Phylogenetic analysis showed that Chinese PKV isolates can be clustered into three groups: SH-W-CHN-like strains, S-1-HUN-like strains and JXAT2015-like strains, respectively. All three PKV genomes obtained in this study were grouped with SH-W-CHN-like strains, which are currently predominant in China (Figure 4). Polyprotein comparisons showed that our PKV strains share low nucleotide similarities (87.69~88.18%), but obviously higher aa identities (94.42~94.94%) when comparing with the representative SH-W-CHN isolate (Table 5). Selective pressure analysis showed that the polyproteins of Chinese PKV strains were predominantly under negative selection, while only one to five positive selection sites were detected via three methods (Table 6). Moreover, JSYZ1806-158 was detected as a recombinant virus from JX-2 and AH-42 strains using both RDP4 (Table 7) and SimPlot (Figure 5).

4. Discussion

Diarrheic diseases are huge threats to the global swine industry. Several enteric viruses including PEDV and TGEV have been identified as direct causative pathogens for diarrhea in piglets [31]. PKV is another commonly found enteric virus in both healthy and diseased piglets [1,14]. However, the role of PKV in clinical diarrheic diseases is still unclarified. A previous study speculated that PKV inoculation not only caused clinical signs including diarrhea, emaciation and nausea, but also resulted in pathological lesions including interstitial pneumonia, nephrosis and gastroenteritis in piglets [39]. The digestive tract of PKV-infected and diarrheic piglets showed obvious extravasated blood from the stomach, with mononuclear phagocytes and lymphocytes infiltrating the submucosa. However, there is a lack of good evidence supporting the idea that PKV causes gastrointestinal disease [40]. Even though PKV was commonly detected in non-diarrheic pigs, this is not evidence that PKV is not a gastrointestinal-disease-causing virus. It could indicate that PKV is not a sufficient cause of gastroenteritis in itself. Our previous study showed that PKV is the most abundant virus, followed by PEDV, in severely diarrheic neonatal piglets [32]. In addition, in vivo replications of PKV and PEDV are coincidental with the development of neonatal diarrheic diseases. Moreover, PKV and PEDV are both mainly distributed in intestinal samples [2]. All these results suggest that both PKV and PEDV are closely associated with diarrheic diseases in piglets. To further evaluate the prevalence of PKV in Chinese swine herds in recent years and explore the correlation of PKV and PEDV infection with clinical diseases, in this study, we determined the PKV and PEDV singular and coinfection statuses in intestinal samples collected from six provinces of China between 2018 and 2022. In addition, the evolution of Chinese PKV in diarrheic and healthy pigs was also explored.
The prevalence of PKV has been widely evaluated all around the world. PKV-positive rates have been found to range from 13.1% (33/251) to 99% (97/98) [14,21]. In China, the first PKV study showed that the PKV-positive rate is 30.12% (97/322) in fecal samples collected during 2006–2007 from <15-day-old piglets [13]. The epidemiological studies in Sichuan province showed that the positive rate of PKV is 57.02% (207/363), using stool samples collected from 2011 to 2015 [41,42]. A 2016 report showed that the PKV infection rate is 62.1% (126/203) in Gansu province [43]. A recent study based on 483 fecal samples collected in 2020 showed that PKV is the most prevalent virus, with a positive rate of 51.1% (247/483) [44]. In this study, we showed that the PKV-positive rate is 65.43% (212/324), using intestinal samples collected from six provinces between 2018 and 2022. Our up-to-date epidemiological results are consistent with previous studies showing that PKV is highly prevalent in different regions of China.
The coinfection of PKV with other enteric viruses is more common than singular PKV infection. The coinfection of distinct enteric viruses is frequently associated with severe clinical disease [23,45]. Previous studies have confirmed that PKV is commonly co-infected with PEDV, TGEV, porcine deltacoronavirus (PDCoV), porcine astroviruses (PAstVs), porcine rotavirus A (PRV-A), porcine sapovirus (PSaV) and porcine encephalomyocarditis virus (EMCV) [32,44,46,47]. In this study, we also showed that PKV is frequently co-infected with PEDV. Even though PKV could be detected in pigs with or without enteric diseases, our results provided a first clue that most of the PKV and PEDV double-positive pigs are clinically diarrheic, whilst most of the PKV-positive but PEDV-negative pigs are clinically healthy (Table 3). Taken together with our previous results that the dynamics of significant PKV and PEDV in vivo replications are concurrent with the development of diarrheic diseases in piglets [32], all these findings support that PKV is unlikely a direct gastroenteritis-causing virus but a potential opportunistic pathogen in enteric diseases.
To evaluate the evolution of PKV in Chinese swine herds, three representative PKV genomes were determined and submitted for phylogenetic analysis. Our phylogenetic tree based on all available Chinese PKV polyproteins first showed that Chinese PKV strains have evolved into three groups, while SH-W-CHN-like strains are predominant. Multiple sequence alignment showed that the 30 aa deletions in 2B could be identified in PKV strains from both diarrheic (JSYZ1806-158) and healthy (GDCZ2202-1606) pigs, suggesting that the unique deletion in 2B is unlikely a virulent determinant. Recombination events occurring in viral genomes could negatively impact viral phylogenetic reconstruction. A previous study indicated that more than half of the PKV genomes were detected as being recombinant, while the nucleotide position 2762-3759 was detected as a frequent recombination fragment [48]. Recombination analysis showed that JSYZ1806-158 is an inter-group recombinant from the SH-W-CHN-like JX-2 strain and the JXAT2015-like AH-42 strain. The potential cross-over region (3175-3517) of JSYZ1806-158 was also consistent with the previous study, which supported the hypothesis that recombination plays a critical role in the evolution of PKV in China [48]. All these results indicated that PKV is rapidly evolving in Chinese swine herds.
Even though the origin of PKV cannot be determined, a recent study deduced the origin of PKV using Bayesian stochastic variable selection (BSSVS) analysis [48]. They showed that Kobuvirus is an ancient virus that can be traced back to ~1500 years, while PKV is an emerging virus with a divergence time of ~1900 years. Their results suggested that PKV has been circulating and evolving for a long period of time. Noticeably, each fragment or entire polyprotein comparisons showed that our PKV strains share low nucleotide similarities with a Chinese representative strain but obviously higher aa identities, indicating that many mutations occurring in Chinese PKV polyproteins are nonsense mutations. Selective pressure analysis showed that Chinese PKV polyproteins are predominantly under purifying (negative) selection. These results supported that even though PKV is rapidly evolving in Chinese swine herds, the strong purifying selection might help maintain the antigenic stability of PKV. Considering the characteristics of PKV, including its long evolving history, stable antigenicity, and existence within both diarrheic and healthy pigs, we hypothesize that PKV seems to have found a balance between virus and host interaction for fitness of survival.

5. Conclusions

This study provides an up-to-date epidemiological clue that PKV is likely an opportunistic pathogen rather than a direct causative virus in enteric diseases. In addition, our results also supported that PKV is rapidly evolving in Chinese swine herds, but strong negative selection helps to maintain the antigenic stability of PKV.

Author Contributions

Conceptualization, N.C. and J.Z.; methodology, Y.Z., B.F. and D.Z.; software, N.C. and J.Z.; validation, N.C., Y.Z. and B.F.; formal analysis, N.C. and Y.Z.; investigation, Y.Z. and B.F.; resources, N.C. and Z.H.; data curation, Y.Z., B.F., Z.H., W.Q., Y.Q., M.Q. and C.L.; writing—original draft preparation, N.C. and H.L.; writing—review and editing, N.C., J.Z., W.Z. and H.L.; visualization, N.C. and Y.Z.; supervision, N.C., J.Z. and W.Z.; project administration, N.C.; funding acquisition, N.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Natural Science Foundation for Excellent Young Scholars of Jiangsu Province (BK202111603), National Natural Science Foundation of China (31802172), the Open Project Program of International Research Laboratory of Prevention and Control of Important Animal Infectious Diseases and Zoonotic Diseases of Jiangsu Higher Education Institutions (No. 3), the Open Project Program of Fujian Provincial Key Laboratory for Prevention and Control of Animal Infectious Diseases and Biotechnology (ZDSYS2022001), the Open Project Program of Key Laboratory of animal pathogen infection and Immunology of Fujian Province (KLAPII202202), the Applied Basic Research Program of Liaoning Province (2023JH2/10160052), the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD) and the 111 Project D18007. Nanhua Chen is supported by the High Talent Supporting Program of Yangzhou University.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Three obtained nearly complete PKV genomes have been submitted to GenBank with accession numbers OR364986, ON007233 and OR364987.

Acknowledgments

The authors would like to thank Yajie Zhou and Xilin Yan for their assistance in clinical sample collections.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Reuter, G.; Boldizsar, A.; Kiss, I.; Pankovics, P. Candidate new species of Kobuvirus in porcine hosts. Emerg. Infect. Dis. 2008, 14, 1968–1970. [Google Scholar] [CrossRef] [PubMed]
  2. Li, Y.; Liang, J.; Wu, S.; Yan, Z.; Zhang, W. Complete genomic sequence analysis and intestinal tissue localization of a porcine Kobuvirus variant in China. Infect. Genet. Evol. 2022, 104, 105362. [Google Scholar] [CrossRef] [PubMed]
  3. Reuter, G.; Boldizsar, A.; Pankovics, P. Complete nucleotide and amino acid sequences and genetic organization of porcine kobuvirus, a member of a new species in the genus Kobuvirus, family Picornaviridae. Arch. Virol. 2009, 154, 101–108. [Google Scholar] [CrossRef]
  4. Yamashita, T.; Sakae, K.; Tsuzuki, H.; Suzuki, Y.; Ishikawa, N.; Takeda, N.; Miyamura, T.; Yamazaki, S. Complete nucleotide sequence and genetic organization of Aichi virus, a distinct member of the Picornaviridae associated with acute gastroenteritis in humans. J. Virol. 1998, 72, 8408–8412. [Google Scholar] [CrossRef]
  5. Reuter, G.; Boros, A.; Pankovics, P. Kobuviruses—A comprehensive review. Rev. Med. Virol. 2011, 21, 32–41. [Google Scholar] [CrossRef] [PubMed]
  6. Yamashita, T.; Kobayashi, S.; Sakae, K.; Nakata, S.; Chiba, S.; Ishihara, Y.; Isomura, S. Isolation of cytopathic small round viruses with BS-C-1 cells from patients with gastroenteritis. J. Infect. Dis. 1991, 164, 954–957. [Google Scholar] [CrossRef] [PubMed]
  7. Yamashita, T.; Ito, M.; Kabashima, Y.; Tsuzuki, H.; Fujiura, A.; Sakae, K. Isolation and characterization of a new species of kobuvirus associated with cattle. J. Gen. Virol. 2003, 84 Pt 11, 3069–3077. [Google Scholar] [CrossRef]
  8. Milicevic, V.; Kureljusic, B.; Maksimovic-Zoric, J.; Savic, B.; Spalevic, L.; Zutic, J. Molecular detection and characterization of Porcine Kobuvirus in domestic pigs and wild boars in Serbia. Res. Vet. Sci. 2020, 132, 404–406. [Google Scholar] [CrossRef]
  9. Nantel-Fortier, N.; Lachapelle, V.; Letellier, A.; L’Homme, Y.; Brassard, J. Kobuvirus shedding dynamics in a swine production system and their association with diarrhea. Vet. Microbiol. 2019, 235, 319–326. [Google Scholar] [CrossRef]
  10. Zhai, S.L.; Zhang, H.; Lin, T.; Chen, S.N.; Zhou, X.; Chen, Q.L.; Lv, D.H.; Wen, X.H.; Zhou, X.R.; Jia, C.L.; et al. A novel porcine kobuvirus emerged in piglets with severe diarrhoea in China. Transbound. Emerg. Dis. 2017, 64, 1030–1036. [Google Scholar] [CrossRef]
  11. Lu, L.; Van Dung, N.; Ivens, A.; Bogaardt, C.; O’Toole, A.; Bryant, J.E.; Carrique-Mas, J.; Van Cuong, N.; Anh, P.H.; Rabaa, M.A.; et al. Genetic diversity and cross-species transmission of kobuviruses in Vietnam. Virus Evol. 2018, 4, vey002. [Google Scholar] [CrossRef] [PubMed]
  12. Khamrin, P.; Maneekarn, N.; Okitsu, S.; Ushijima, H. Epidemiology of human and animal kobuviruses. Virusdisease 2014, 25, 195–200. [Google Scholar] [CrossRef] [PubMed]
  13. Yu, J.M.; Jin, M.; Zhang, Q.; Li, H.Y.; Li, D.D.; Xu, Z.Q.; Li, J.S.; Cui, S.X.; Yang, S.H.; Liu, N.; et al. Candidate porcine Kobuvirus, China. Emerg. Infect. Dis. 2009, 15, 823–825. [Google Scholar] [CrossRef]
  14. Khamrin, P.; Maneekarn, N.; Kongkaew, A.; Kongkaew, S.; Okitsu, S.; Ushijima, H. Porcine kobuvirus in piglets, Thailand. Emerg. Infect. Dis. 2009, 15, 2075–2076. [Google Scholar] [CrossRef]
  15. Khamrin, P.; Maneekarn, N.; Hidaka, S.; Kishikawa, S.; Ushijima, K.; Okitsu, S.; Ushijima, H. Molecular detection of kobuvirus sequences in stool samples collected from healthy pigs in Japan. Infect. Genet. Evol. 2010, 10, 950–954. [Google Scholar] [CrossRef] [PubMed]
  16. An, D.J.; Jeoung, H.Y.; Jeong, W.; Lee, H.S.; Park, J.Y.; Kim, B. Porcine kobuvirus from pig stool in Korea. Virus Genes 2011, 42, 208–211. [Google Scholar] [CrossRef] [PubMed]
  17. Barry, A.F.; Ribeiro, J.; Alfieri, A.F.; van der Poel, W.H.; Alfieri, A.A. First detection of kobuvirus in farm animals in Brazil and the Netherlands. Infect. Genet. Evol. 2011, 11, 1811–1814. [Google Scholar] [CrossRef] [PubMed]
  18. Di Profio, F.; Ceci, C.; Di Felice, E.; Marsilio, F.; Di Martino, B. Molecular detection of porcine kobuviruses in Italian swine. Res. Vet. Sci. 2013, 95, 782–785. [Google Scholar] [CrossRef]
  19. Verma, H.; Mor, S.K.; Abdel-Glil, M.Y.; Goyal, S.M. Identification and molecular characterization of Porcine kobuvirus in U. S. swine. Virus Genes 2013, 46, 551–553. [Google Scholar] [CrossRef]
  20. Dufkova, L.; Scigalkova, I.; Moutelikova, R.; Malenovska, H.; Prodelalova, J. Genetic diversity of porcine sapoviruses, kobuviruses, and astroviruses in asymptomatic pigs: An emerging new sapovirus GIII genotype. Arch. Virol. 2013, 158, 549–558. [Google Scholar] [CrossRef]
  21. Amimo, J.O.; Okoth, E.; Junga, J.O.; Ogara, W.O.; Njahira, M.N.; Wang, Q.; Vlasova, A.N.; Saif, L.J.; Djikeng, A. Molecular detection and genetic characterization of kobuviruses and astroviruses in asymptomatic local pigs in East Africa. Arch. Virol. 2014, 159, 1313–1319. [Google Scholar] [CrossRef]
  22. Van Dung, N.; Anh, P.H.; Van Cuong, N.; Hoa, N.T.; Carrique-Mas, J.; Hien, V.B.; Sharp, C.; Rabaa, M.; Berto, A.; Campbell, J.; et al. Large-scale screening and characterization of enteroviruses and kobuviruses infecting pigs in Vietnam. J. Gen. Virol. 2016, 97, 378–388. [Google Scholar] [CrossRef] [PubMed]
  23. Jackova, A.; Sliz, I.; Mandelik, R.; Salamunova, S.; Novotny, J.; Kolesarova, M.; Vlasakova, M.; Vilcek, S. Porcine kobuvirus 1 in healthy and diarrheic pigs: Genetic detection and characterization of virus and co-infection with rotavirus A. Infect. Genet. Evol. 2017, 49, 73–77. [Google Scholar] [CrossRef] [PubMed]
  24. Collins, P.J.; McMenamy, M.J.; McClintock, J.; Lagan-Tregaskis, P.; McCabe, L.; Doherty, S.; O’Shea, H.; Welsh, M.; McKillen, J. Molecular detection of kobuviruses in livestock in Northern Ireland and the Republic of Ireland. Arch. Virol. 2017, 162, 1275–1279. [Google Scholar] [CrossRef] [PubMed]
  25. Goecke, N.B.; Hjulsager, C.K.; Kongsted, H.; Boye, M.; Rasmussen, S.; Granberg, F.; Fischer, T.K.; Midgley, S.E.; Rasmussen, L.D.; Angen, O.; et al. No evidence of enteric viral involvement in the new neonatal porcine diarrhoea syndrome in Danish pigs. BMC Vet. Res. 2017, 13, 315. [Google Scholar] [CrossRef] [PubMed]
  26. Theuns, S.; Vanmechelen, B.; Bernaert, Q.; Deboutte, W.; Vandenhole, M.; Beller, L.; Matthijnssens, J.; Maes, P.; Nauwynck, H.J. Nanopore sequencing as a revolutionary diagnostic tool for porcine viral enteric disease complexes identifies porcine kobuvirus as an important enteric virus. Sci. Rep. 2018, 8, 9830. [Google Scholar] [CrossRef]
  27. Valko, A.; Marosi, A.; Csagola, A.; Farkas, R.; Ronai, Z.; Dan, A. Frequency of diarrhoea-associated viruses in swine of various ages in Hungary. Acta Vet. Hung. 2019, 67, 140–150. [Google Scholar] [CrossRef]
  28. Garcia-Hernandez, M.E.; Trujillo-Ortega, M.E.; Alcaraz-Estrada, S.L.; Lozano-Aguirre-Beltran, L.; Sandoval-Jaime, C.; Taboada-Ramirez, B.I.; Sarmiento-Silva, R.E. Molecular Detection and Characterization of Porcine Epidemic Diarrhea Virus and Porcine Aichivirus C Coinfection in Mexico. Viruses 2021, 13, 738. [Google Scholar] [CrossRef]
  29. Malik, Y.S.; Bhat, S.; Sircar, S.; Verma, A.K.; Barman, N.N.; Deka, P.J.; Ghosh, S.; Reuter, G.; Dhama, K. Kobuvirus Detection in the Critically Endangered Pygmy Hog (Porcula salvania), India. J. Zoo Wildl. Med. 2021, 52, 343–347. [Google Scholar] [CrossRef]
  30. Park, S.J.; Kim, H.K.; Moon, H.J.; Song, D.S.; Rho, S.M.; Han, J.Y.; Nguyen, V.G.; Park, B.K. Molecular detection of porcine kobuviruses in pigs in Korea and their association with diarrhea. Arch. Virol. 2010, 155, 1803–1811. [Google Scholar] [CrossRef]
  31. Smolak, D.; Salamunova, S.; Jackova, A.; Harsanyova, M.; Budis, J.; Szemes, T.; Vilcek, S. Analysis of RNA virome in rectal swabs of healthy and diarrheic pigs of different age. Comp. Immunol. Microbiol. Infect. Dis. 2022, 90–91, 101892. [Google Scholar]
  32. Qiu, M.; Li, S.; Xiao, Y.; Li, J.; Zhang, Y.; Li, X.; Feng, B.; Li, C.; Lin, H.; Zhu, J.; et al. Pathogenic and metagenomic evaluations reveal the correlations of porcine epidemic diarrhea virus, porcine kobuvirus and porcine astroviruses with neonatal piglet diarrhea. Microb. Pathog. 2022, 170, 105703. [Google Scholar] [CrossRef] [PubMed]
  33. Chen, N.; Xiao, Y.; Ye, M.; Li, X.; Li, S.; Xie, N.; Wei, Y.; Wang, J.; Zhu, J. High genetic diversity of Chinese porcine reproductive and respiratory syndrome viruses from 2016 to 2019. Res. Vet. Sci. 2020, 131, 38–42. [Google Scholar] [CrossRef] [PubMed]
  34. Chen, N.; Ye, M.; Li, S.; Huang, Y.; Zhou, R.; Yu, X.; Tian, K.; Zhu, J. Emergence of a novel highly pathogenic recombinant virus from three lineages of porcine reproductive and respiratory syndrome virus 2 in China 2017. Transbound. Emerg. Dis. 2018, 65, 1775–1785. [Google Scholar] [CrossRef]
  35. Feng, B.; Li, C.; Qiu, Y.; Qi, W.; Qiu, M.; Li, J.; Lin, H.; Zheng, W.; Zhu, J.; Chen, N. Genomic Characterizations of Porcine Epidemic Diarrhea Viruses (PEDV) in Diarrheic Piglets and Clinically Healthy Adult Pigs from 2019 to 2022 in China. Animals 2023, 13, 1562. [Google Scholar] [CrossRef]
  36. Chen, N.H.; Trible, B.R.; Kerrigan, M.A.; Tian, K.G.; Rowland, R.R.R. ORF5 of porcine reproductive and respiratory syndrome virus (PRRSV) is a target of diversifying selection as infection progresses from acute infection to virus rebound. Infect. Genet. Evol. 2016, 40, 167–175. [Google Scholar] [CrossRef]
  37. Pond, S.L.; Frost, S.D. Datamonkey: Rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics 2005, 21, 2531–2533. [Google Scholar] [CrossRef]
  38. Li, J.X.; Xiao, Y.Z.; Qiu, M.; Li, X.S.; Li, S.B.; Lin, H.; Li, X.D.; Zhu, J.Z.; Chen, N.H. A Systematic Investigation Unveils High Coinfection Status of Porcine Parvovirus Types 1 through 7 in China from 2016 to 2020. Microbiol. Spectr. 2021, 9, e01294-21. [Google Scholar] [CrossRef]
  39. Yang, F.; Liu, X.; Zhou, Y.; Lyu, W.; Xu, S.; Xu, Z.; Zhu, L. Histopathology of Porcine kobuvirus in Chinese piglets. Virol. Sin. 2015, 30, 396–399. [Google Scholar] [CrossRef]
  40. Eriksen, E.O. A Systematic Review: Is Porcine Kobuvirus Causing Gastrointestinal Disease in Young Pigs? Vet. Sci. 2023, 10, 286. [Google Scholar] [CrossRef]
  41. Chen, L.; Zhu, L.; Zhou, Y.C.; Xu, Z.W.; Guo, W.Z.; Yang, W.Y. Molecular and phylogenetic analysis of the porcine kobuvirus VP1 region using infected pigs from Sichuan Province, China. Virol. J. 2013, 10, 281. [Google Scholar] [CrossRef]
  42. Liu, P.; Li, P.; Lyu, W.; Li, X.; Li, S.; Yang, F.; Huang, J.; Xu, Z.; Zhu, L. Epidemiological study and variation analysis of the porcine kobuvirus 3D gene in Sichuan province, China. Virol. Sin. 2015, 30, 460–463. [Google Scholar] [CrossRef]
  43. Wang, C.; Lan, X.; Yang, B. Molecular Epidemiological Investigation of Porcine kobuvirus and Its Coinfection Rate with PEDV and SaV in Northwest China. BioMed Res. Int. 2016, 2016, 7590569. [Google Scholar] [CrossRef]
  44. Werid, G.M.; Ibrahim, Y.M.; Chen, H.; Fu, L.; Wang, Y. Molecular Detection and Genetic Characterization of Potential Zoonotic Swine Enteric Viruses in Northern China. Pathogens 2022, 11, 417. [Google Scholar] [CrossRef]
  45. Zhou, P.; Fan, H.; Lan, T.; Yang, X.L.; Shi, W.F.; Zhang, W.; Zhu, Y.; Zhang, Y.W.; Xie, Q.M.; Mani, S.; et al. Fatal swine acute diarrhoea syndrome caused by an HKU2-related coronavirus of bat origin. Nature 2018, 556, 255–258. [Google Scholar] [CrossRef]
  46. Ding, G.; Fu, Y.; Li, B.; Chen, J.; Wang, J.; Yin, B.; Sha, W.; Liu, G. Development of a multiplex RT-PCR for the detection of major diarrhoeal viruses in pig herds in China. Transbound. Emerg. Dis. 2020, 67, 678–685. [Google Scholar] [CrossRef]
  47. Zhang, Q.; Hu, R.; Tang, X.; Wu, C.; He, Q.; Zhao, Z.; Chen, H.; Wu, B. Occurrence and investigation of enteric viral infections in pigs with diarrhea in China. Arch. Virol. 2013, 158, 1631–1636. [Google Scholar] [CrossRef]
  48. Cui, Y.; Li, J.; Guo, J.; Pan, Y.; Tong, X.; Liu, C.; Wang, D.; Xu, W.; Shi, Y.; Ji, Y.; et al. Evolutionary Origin, Genetic Recombination, and Phylogeography of Porcine Kobuvirus. Viruses 2023, 15, 240. [Google Scholar] [CrossRef]
Animals 13 03129 g001
Figure 1. PKV genome amplification. The PCR amplicons of GDCZ2202-1606 sample covering the PKV genome using primers in Table 1 are presented. The PKV genome was divided into seven overlapping fragments. The size of each amplicon is shown.
Figure 1. PKV genome amplification. The PCR amplicons of GDCZ2202-1606 sample covering the PKV genome using primers in Table 1 are presented. The PKV genome was divided into seven overlapping fragments. The size of each amplicon is shown.
Animals 13 03129 g001
Animals 13 03129 g002
Figure 2. Geographical distribution of PKV in China. Retrospective evaluation indicated that PKV has been detected in at least 26 provinces/cities of China. The six provinces with PKV-positive samples detected in this study are highlighted in dark blue, while the other provinces/cities with PKV sequences from GenBank are marked in light blue.
Figure 2. Geographical distribution of PKV in China. Retrospective evaluation indicated that PKV has been detected in at least 26 provinces/cities of China. The six provinces with PKV-positive samples detected in this study are highlighted in dark blue, while the other provinces/cities with PKV sequences from GenBank are marked in light blue.
Animals 13 03129 g002
Animals 13 03129 g003
Figure 3. Multiple sequence alignment of PKV polyproteins. The aligned sequences include representative S-1-HUN and SH-W-CHN isolates and three PKV strains identified in this study. The aa insertion in VP1 is highlighted in yellow, while the 30 aa deletion in 3B is marked in pink. The proteins derived from the polyprotein are presented in distinct colors.
Figure 3. Multiple sequence alignment of PKV polyproteins. The aligned sequences include representative S-1-HUN and SH-W-CHN isolates and three PKV strains identified in this study. The aa insertion in VP1 is highlighted in yellow, while the 30 aa deletion in 3B is marked in pink. The proteins derived from the polyprotein are presented in distinct colors.
Animals 13 03129 g003
Animals 13 03129 g004
Figure 4. Phylogenetic tree based on 36 polyprotein-encoding sequences. The three species of kobuviruses are shown in distinct colors. Chinese PKV strains were clustered into three groups: SH-W-CHN-like, S-1-HUN-like and JXAT2015-like strains, respectively. All three PKV strains identified in this study are highlighted with blue squares. Each virus is shown by its name, GenBank accession number, country and year of isolation.
Figure 4. Phylogenetic tree based on 36 polyprotein-encoding sequences. The three species of kobuviruses are shown in distinct colors. Chinese PKV strains were clustered into three groups: SH-W-CHN-like, S-1-HUN-like and JXAT2015-like strains, respectively. All three PKV strains identified in this study are highlighted with blue squares. Each virus is shown by its name, GenBank accession number, country and year of isolation.
Animals 13 03129 g004
Animals 13 03129 g005
Figure 5. Recombination event detected in JSYZ1806-158 using SimPlot. The cross-over region is shown in the dashed line box, which is consistent with the result from RDP4. JX-2 is the major parental virus, while AH-42 is the minor parental virus for JSYZ1806-158. The y axis shows the percentage of permutated trees employing a sliding window of 500 bp and a step size of 20 bp. Other options, including Kimura (2-parameter) distance model, 2.0 Ts/Tv ratio, neighbor-joining tree model and 1000 Bootstrap replicates, are used.
Figure 5. Recombination event detected in JSYZ1806-158 using SimPlot. The cross-over region is shown in the dashed line box, which is consistent with the result from RDP4. JX-2 is the major parental virus, while AH-42 is the minor parental virus for JSYZ1806-158. The y axis shows the percentage of permutated trees employing a sliding window of 500 bp and a step size of 20 bp. Other options, including Kimura (2-parameter) distance model, 2.0 Ts/Tv ratio, neighbor-joining tree model and 1000 Bootstrap replicates, are used.
Animals 13 03129 g005
Table 1. Primers used for PKV genome amplification in this study.
Table 1. Primers used for PKV genome amplification in this study.
PrimerSequence (5′-3′)Location 1Amplicon (bp)
PKV-F1TCGGCCCTCTCACCCTCTTTTC24-45 21368
PKV-R1GCAGCAGCAGGTTCCCACCA1372-1391
PKV-F2AATGGTTGGACTCCTACGGTGAACA1222-12461608
PKV-R2TCCAGTGAGTGGATTCATCACCCA2806-2829
PKV-F3CGCGGTACTTACACCGTGTGGGA2665-26871472
PKV-R3TGGACAACTTCAGGAGGAGCTTCAA4112-4136
PKV-F4TACTCTGCTACTAACAACTGCACCCACTTT3943-39721426
PKV-R4TGGAAGTGACCACAACTACCTGGGA5344-5368
PKV-F5CCGCCCAGAACCTGTTGTGATCTA5043-50661458
PKV-R5GCACCACAGAGACCCTGGAAGGT6478-6500
PKV-F6TTGACTGGGCGACCCTCCAA6236-62551562
PKV-R6TCGAATGTCATCAGGCACAAACCA7774-7797
PKV-F7TTTGGCAACGAGACGTATGAGATGATT7465-7491744
PKV-R7AATACAGAATAGAAAGTAAAGGACAGTCAGGGA8176-8208
1 The location was determined according to the S-1-HUN (NC011829) strain. 2 The primer was not designed from the beginning of genome due to a poly G structure at 5′UTR.
Table 2. PKV infection status in six provinces of China from 2018 to 2022.
Table 2. PKV infection status in six provinces of China from 2018 to 2022.
Year/LocationSample No.PKV-Positive No. 1PKV-Positive Percentages
Year
201811327.27%
2019372670.27%
20201427653.52%
202116425.00%
202211810387.29%
Total32421265.43%
Location
Jiangsu674364.18%
Xinjiang372670.27%
Guangdong321959.38%
Henan846982.14%
Shandong624674.19%
Fujian42921.43%
Total32421265.43%
1 PKV was detected via real-time PCR assay developed previously [32].
Table 3. The correlation of PKV and PEDV infection with enteric diseases.
Table 3. The correlation of PKV and PEDV infection with enteric diseases.
Infection Status 1Diarrheic Piglets
<10 Days Old		Pigs without Diarrhea
>1 Month Old		Total
PEDV+29 (90.63%)3 (9.37%)32
PEDV+ PKV+17 (89.47%)2 (10.53%)19
PEDV−35 (11.98%)257 (88.01%)292
PEDV− PKV+16 (8.29%)177 (91.71%)193
1 PKV and PEDV were detected via real-time RT-PCR assays [32].
Table 4. Background information for the representative PKV-positive samples used for genome sequencing.
Table 4. Background information for the representative PKV-positive samples used for genome sequencing.
No.NameRegion (City, Province)DateSampleAgeSymptomPEDV
1JSYZ1806-158Yangzhou, JiangsuJune 2018Intestine2 months oldDiarrheaNegative
2XJ1904-34Kashi, XinjiangApril 2019Intestine5 days oldDiarrhea, deathPositive
3GDCZ2202-1606Chaozhou, GuangdongFebruary 2022IntestineAdultClinically healthyNegative
Table 5. Polyprotein-encoding gene and protein comparisons of our three PKV strains and reference SH-W-CHN isolate.
Table 5. Polyprotein-encoding gene and protein comparisons of our three PKV strains and reference SH-W-CHN isolate.
RegionLength (nt)Nucleotide/Amino Acid Identities (%)
JSYZ1806-158 vs. SH-W-CHNXJ1904-34 vs. SH-W-CHNGDCZ2202-1606 vs. SH-W-CHNJSYZ1806-158 vs. XJ1904-34XJ1904-34 vs. GDCZ2202-1606JSYZ1806-158 vs. GDCZ2202-1606
L58589.23/96.4188.55/94.3689.06/93.8587.35/95.9086.84/94.3689.23/95.90
VP0109887.81/92.9086.99/92.9086.72/92.0887.80/97.8187.80/97.5488.07/98.63
VP366985.05/93.7284.16/93.2784.01/92.3886.40/96.8686.55/95.9691.03/98.65
VP176582.61/90.9886.14/91.7682.09/90.5983.01/92.1684.58/92.5588.76/98.82
Structural (VP0-VP3)253285.51/92.5485.99/92.6584.60/91.7185.98/95.8586.49/95.6289.06/98.70
2A40887.99/91.9189.71/94.1289.71/96.3289.95/90.4489.22/92.6591.42/92.65
2B495/585/495 174.36/83.0885.30/92.8275.90/83.0876.24/83.5976.41/83.5993.33/100
2C100591.74/99.1090.45/99.4091.34/97.6191.54/99.4091.24/97.9191.74/97.91
3A27090.37/98.8986.30/90.0092.59/98.8988.52/91.1187.78/91.1193.33/100
3B10291.18/97.0683.33/97.0686.27/97.0686.27/10088.24/10090.20/100
3C57685.94/94.7985.07/94.2790.28/98.4489.06/98.9686.46/94.2787.67/94.79
3D140793.46/98.7293.11/98.2994.39/98.7292.89/98.5093.46/98.9394.39/99.15
Nonstructural (2A-3D)4263/4353/4263 188.74/95.5289.41/96.3489.92/96.0789.13/95.5988.86/94.9792.28/97.82
Polyprotein7380/7470/738087.69/94.5888.18/94.9488.05/94.4287.93/95.7087.90/95.1490.93/97.97
1 Indicates the nucleotide length of JSYZ1806-158, XJ1904-34 and GDCZ2202-1606, respectively.
Table 6. Selection pressure analyses for Chinese PKVs.
Table 6. Selection pressure analyses for Chinese PKVs.
Test MethodGeneNo. of CodonsdN/dSPositive SelectionNegative SelectionCriteria
SLACPolyprotein 124890.18211134p-value threshold of 0.05
FELPolyprotein2489 51641p-value threshold of 0.05
FUBARPolyprotein2489 11856Posterior probability of 0.95
1 The selection pressure analysis is based on 33 polyprotein-encoding sequences from China.
Table 7. Potential recombination events in JSYZ1806-158 identified using RDP v.4.71.
Table 7. Potential recombination events in JSYZ1806-158 identified using RDP v.4.71.
Recombinant VirusParental VirusBreakpoint 1Score for the Seven Detection Methods Embedded in RDP4
MajorMinorRegionBeginEndRDPGENECONVBootScanMaxChiChimaeraSiScan3Seq
JSYZ1806-158JX-2 (MT125683)AH-42
(OM274026)		2A317535172.714 × 10−3- 21.696 × 10−38.341 × 10−69.6 × 10−61.324 × 10−2-
1 The breakpoint position in the JSYZ1806-158 polyprotein sequence. 2 “-” indicates that the recombination event is not significant. The p-value cut-off was set at 0.01.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zang, Y.; Feng, B.; Huang, Z.; Zhao, D.; Qi, W.; Qiu, Y.; Qiu, M.; Li, C.; Lin, H.; Zheng, W.; et al. Epidemiologic and Genomic Characterizations of Porcine Kobuviruses in Diarrheic and Healthy Pigs. Animals 2023, 13, 3129. https://doi.org/10.3390/ani13193129

AMA Style

Zang Y, Feng B, Huang Z, Zhao D, Qi W, Qiu Y, Qiu M, Li C, Lin H, Zheng W, et al. Epidemiologic and Genomic Characterizations of Porcine Kobuviruses in Diarrheic and Healthy Pigs. Animals. 2023; 13(19):3129. https://doi.org/10.3390/ani13193129

Chicago/Turabian Style

Zang, Yu, Binghui Feng, Zitao Huang, Dashi Zhao, Wenhao Qi, Yuejia Qiu, Ming Qiu, Chen Li, Hong Lin, Wanglong Zheng, and et al. 2023. "Epidemiologic and Genomic Characterizations of Porcine Kobuviruses in Diarrheic and Healthy Pigs" Animals 13, no. 19: 3129. https://doi.org/10.3390/ani13193129

APA Style

Zang, Y., Feng, B., Huang, Z., Zhao, D., Qi, W., Qiu, Y., Qiu, M., Li, C., Lin, H., Zheng, W., Zhu, J., & Chen, N. (2023). Epidemiologic and Genomic Characterizations of Porcine Kobuviruses in Diarrheic and Healthy Pigs. Animals, 13(19), 3129. https://doi.org/10.3390/ani13193129

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop