Growth Performance, Rumen Fermentation and Inflammatory Response on Holstein Growing Cattle Treated with Low and High Non-Fibrous Carbohydrate to Neutral Detergent Fiber Ratio Pelleted Total Mixed Ration
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Processing Requirement of Pelleted TMR
2.2. Animals and Treatments
2.3. Sample Collection and Analysis
2.4. Determination of the Expression Levels of Inflammatory Factors in BRECs by qRT-PCR
2.5. Statistical Analysis
3. Results
3.1. Effects of Low and High NFC to NDF Ratio Pelleted TMR on Growth Performance and Apparent Digestibility of Holstein Growing Cattle
3.2. Effects of Low and High NFC to NDF Ratio Pelleted TMR on Apparent Digestibility of Holstein Growing Cattle
3.3. Effects of Low and High NFC to NDF Ratio Pelleted TMR on Rumination Behavior of Holstein Growing Cattle
3.4. Effects of Low and High NFC to NDF Ratio Pelleted TMR on Rumen Fermentation of Holstein Growing Cattle
3.5. Effects of Low and High NFC to NDF Ratio Pelleted TMR on mRNA Level of Pro-inflammatory Cytokines in BRECs
3.6. Effects of Low and High NFC to NDF Ratio Pelleted TMR on mRNA Level of Chemokines in BRECs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wei, Z.; Zhang, B.; Liu, J. Effects of the dietary non-fiber carbohydrate content on lactation performance, rumen fermentation, and nitrogen utilization in mid-lactation dairy cows receiving corn stover. J. Anim. Sci. Biotechnol. 2018, 9, 20. [Google Scholar] [CrossRef] [PubMed]
 - Steele, M.A.; Greenwood, S.L.; Croom, J. An increase in dietary non-structural carbohydrates alters the structure and metabolism of the rumen epithelium in lambs. Can. J. Plant Sci. 2012, 92, 123–130. [Google Scholar] [CrossRef]
 - Xie, B.; Huang, W.Q.; Zhang, C.X. Influences of starter NDF level on growth performance and rumen development in lambs fed isocaloric and isonitrogenous diets. J. Anim. Sci. 2020, 98, skaa093. [Google Scholar] [CrossRef] [PubMed]
 - Agle, M.; Hristov, A.N.; Zaman, S. Effect of dietary concentrate on rumen fermentation, digestibility, and nitrogen losses in dairy cows. J. Dairy Sci. 2010, 93, 4211–4222. [Google Scholar] [CrossRef] [PubMed]
 - Ohtaki, T.; Ogata, K.; Kajikawa, H. Effect of high-concentrate corn grain diet-induced elevated ruminal lipopolysaccharide levels on dairy cow liver function. J. Vet. Med. Sci. 2020, 82, 20–0117. [Google Scholar] [CrossRef] [PubMed]
 - Pi, Z.; Wu, Y.; Liu, J. Effect of pretreatment and pelletization on nutritive value of rice straw-based TMR, and growth performance and meat quality of growing Boer goats fed on TMR. Small Rumin. Res. 2005, 56, 81–88. [Google Scholar] [CrossRef]
 - Salmon, R. Effects of pelleting, added sodium bentonite and fat in a Soybean-based diet on performance and carcass characteristics of small white turkeys. Anim. Feed Sci. Technol. 1985, 12, 223–232. [Google Scholar] [CrossRef]
 - Zhong, R.; Zhao, C.; Feng, P. Effects of feeding ground versus pelleted total mixed ration on digestion, rumen function and milk production performance of dairy cows. Int. J. Dairy Technol. 2019, 73, 22–30. [Google Scholar] [CrossRef]
 - Song, B.; Wu, T.; You, P. Dietary Supplementation of Yeast Culture Into Pelleted Total Mixed Rations Improves the Growth Performance of Fattening Lambs. Front. Vet. Sci. 2021, 8, 387. [Google Scholar] [CrossRef]
 - Khan, M.T.; Nazir, A.K. The nutritional value of peanut hay (Arachis hypogaea L.) as an alternate forage source for sheep. Trop. Anim. Health Prod. 2013, 45, 849–853. [Google Scholar] [CrossRef]
 - Nb, A.; Man, A. Effects of Soybean straw particle size as a free-choice provision on growth performance and feeding behaviors of dairy calves. Animal 2020, 15, 100128. [Google Scholar]
 - Iskalieva, A.; Yimmou, B.M.; Gogate, P.R.; Horvath, M.; Horvath, P.G.; Csoka, L. Cavitation assisted delignification of Soybean straw: A review. Ultrason. Sonochemistry 2012, 19, 984–993. [Google Scholar] [CrossRef] [PubMed]
 - Seta, F.R.; Tamagno, B.E. Trichloramine-nitrite reaction for determination of blood ammonia. Anal. Chem. 1970, 42, 1443–1445. [Google Scholar] [CrossRef] [PubMed]
 - Guo, W.; Schaefer, D.; Guo, X. Use of nitrate-nitrogen as a sole dietary nitrogen source to inhibit ruminal methanogenesis and to improve microbial nitrogen synthesis in vitro. Asian-Australas. J. Anim. Sci. 2009, 22, 542–549. [Google Scholar] [CrossRef]
 - Hall, M.B.; Herejk, C. Differences in yields of microbial crude protein from in vitro fermentation of carbohydrates. J. Dairy Sci. 2001, 84, 2486–2493. [Google Scholar] [CrossRef]
 - Zhan, K.; Gong, X.; Chen, Y.; Jiang, M.; Yang, T.; Zhao, G. Short-Chain Fatty Acids Regulate the Immune Responses via G Protein-Coupled Receptor 41 in Bovine Rumen Epithelial Cells. Front. Immunol. 2019, 10, 2042. [Google Scholar] [CrossRef]
 - Broderick, G.A. Effects of varying dietary protein and energy levels on the production of lactating dairy cows. J. Dairy Sci. 2003, 86, 1370–1381. [Google Scholar] [CrossRef]
 - Krajcarski-Hunt, H.; Plaizier, J.C.; Walton, J.P. Short Communication: Effect of Subacute Ruminal Acidosis on In Situ Fiber Digestion in Lactating Dairy Cows. J. Dairy Sci. 2002, 85, 570–573. [Google Scholar] [CrossRef]
 - Song, S.D.; Chen, G.J.; Guo, C.H. Effects of exogenous fibrolytic enzyme supplementation to diets with different NFC/NDF ratios on the growth performance, nutrient digestibility and ruminal fermentation in Chinese domesticated black goats. Anim. Feed Sci. Technol. 2018, 236, 170–177. [Google Scholar] [CrossRef]
 - Li, B.; Sun, X.; Huo, Q. Pelleting of a Total Mixed Ration Affects Growth Performance of Fattening Lambs. Front. Vet. Sci. 2021, 8, 100. [Google Scholar] [CrossRef]
 - Okine, E.K.; Mathison, G.W. Effects of feed intake on particle distribution, passage of digesta, and extent of digestion in the gastrointestinal tract of cattle. J. Anim. Sci. 1991, 8, 3435–3445. [Google Scholar] [CrossRef] [PubMed] [Green Version]
 - Wang, H.R.; Chen, Q.; Chen, L.M. Effects of dietary physically effective neutral detergent fiber content on the feeding behavior, digestibility and growth of 8 to 10-month-old Holstein replacement heifers. J. Dairy Sci. 2016, 100, 1161–1169. [Google Scholar] [CrossRef] [PubMed]
 - Voelker, J.A.; Allen, M.S. Pelleted beet pulp substituted for high-moisture corn: 3. Effects on ruminal fermentation, pH, and microbial protein efficiency in lactating dairy cows. J. Dairy Sci. 2003, 86, 3562–3570. [Google Scholar] [CrossRef]
 - Castrillo, C.; Mota, M.; Van Laar, H.; Martín-Tereso, J.; Gimeno, A.; Fondevila, M.; Guada, J.A. Effect of compound feed pelleting and die diameter on rumen fermentation in beef cattle fed high concentrate diets. Anim. Feed. Technol. 2013, 180, 34–43. [Google Scholar] [CrossRef]
 - Liang, J. Study on the Determination of NH_4~+-N Content in Microbial Fermentation Liquor by Indophenol Blue Spectrophotometric Method. Food Ferment. Ind. 2006, 32, 134. [Google Scholar]
 - Plaizier, J.C.; Krause, D.O.; Gozho, G.N. Subacute ruminal acidosis in dairy cows: The physiological causes, incidence and consequences. Vet. J. 2008, 176, 21–31. [Google Scholar] [CrossRef] [PubMed]
 - James, C.M.; Jan, C.P.; Michael, A.S. Butyrate-mediated genomic changes involved in non-specific host defenses, matrix remodeling and the immune response in the rumen epithelium of cows afflicted with subacute ruminal acidosis. Am. J. Anim. Vet. Sci. 2013, 128, 89–115. [Google Scholar]
 - Penner, G.B.; Steele, M.A. Molecular adaptation of ruminal epithelia to highly fermentable diets. J. Anim. Sci. 2011, 89, 1108. [Google Scholar] [CrossRef] [Green Version]
 - Dai, H.; Ma, N.N.; Chang, G. Long-term high-concentrate diet feeding induces apoptosis of rumen epithelial cells and inflammation of rumen epithelium in dairy cows. Anim. Biotechnol. 2020, 33, 289–296. [Google Scholar] [CrossRef]
 - Hehlgans, T.; Pfeffer, K. The intriguing biology of the tumour necrosis factor/tumour necrosis factor receptor superfamily: Players, rules and the games. Insect Sci. 2010, 115, 1–20. [Google Scholar] [CrossRef]
 - Nomiyama, H.; Osada, N.; Yoshie, O. The evolution of mammalian chemokine genes. Cytokine Growth Factor Rev. 2010, 21, 253–262. [Google Scholar] [CrossRef] [PubMed]
 - Paul, C.; Michelle, L. Epithelial chemokine CXCL14 synergizes with CXCL12 via allosteric modulation of CXCR4. The FASEB Journal 2017, 31, 3084–3097. [Google Scholar]
 - Hu, Z.X.; Miao, L.; Zhan, K. Effect of Tea Tree Oil on the Expression of Genes Involved in the Innate Immune System in Goat Rumen Epithelial Cells. Animals 2021, 11, 2460. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, R.; Zhu, W.; Mao, S. High-concentrate feeding upregulates the expression of inflammation-related genes in the ruminal epithelium of dairy cattle. J. Anim. Sci. Biotechnol. 2016, 7, 42. [Google Scholar] [CrossRef] [Green Version]
 




| Ingredients (DM %) | LPT | HPT | 
|---|---|---|
| Ground corn | 23.5 | 38.5 | 
| Wheat bran | 5.0 | 9.0 | 
| Soybean meal (46%) | 8.0 | 6.0 | 
| Corn germ meal | 3.0 | 4.0 | 
| DDGS (corn) | 3.0 | 6.0 | 
| Peanut hay | 27.0 | 15.0 | 
| Soybean straw | 24.0 | 15.0 | 
| Calcium carbonate | 1.5 | 1.5 | 
| Calcium phosphate | 0.5 | 0.5 | 
| Molasses | 2.0 | 2.0 | 
| Salt | 0.5 | 0.5 | 
| Premix (1) | 2.0 | 2.0 | 
| Nutrient Composition | ||
| Metabolic energy (MJ/Kg) (2) | 9.6 | 11.5 | 
| Dry matter (%) | 88.2 | 87.5 | 
| Crude protein (%DM) | 13.5 | 13.4 | 
| Crude ash (%DM) | 11.6 | 11.8 | 
| Ether extract (%DM) | 2.8 | 2.8 | 
| Neutral detergent fiber (%DM) | 34.7 | 26.6 | 
| Acid detergent fiber (%DM) | 25.8 | 17.8 | 
| Non-fibrous carbohydrate (%DM) | 37.4 | 45.4 | 
| NFC/NDF ratio | 1.07 | 1.71 | 
| Calcium (%DM) | 1.20 | 1.20 | 
| Phosphate (%DM) | 0.59 | 0.59 | 
| Symbol | Primer Sequence, 5′ to 3′ | Source | Size (bp) | 
|---|---|---|---|
| GAPDH | 
                Sense: GGGTCATCATCTCTGCACCT Anti-sense: GGTCATAAGTCCCTCCACGA  | NM_001034034 | 176 | 
| IL-1β | Sense: CAGTGCCTACGCACATGTCT Anti-sense: AGAGGAGGTGGAGAGCCTTC  | NM_174093 | 209 | 
| IL-6 | Sense: CACCCCAGGCAGACTACTTC Anti-sense: TCCTTGCTGCTTTCACACTC  | NM_173923 | 129 | 
| TNF-α | Sense: GCCCTCTGGTTCAGACACTC Anti-sense: AGATGAGGTAAAGCCCGTCA  | NM_173966 | 192 | 
| IL-12 | 
                Sense: TCTTTTCGGGACTGTTGACC Anti-sense: AAAATCCCCCATCCAAGGTAG  | NM_174355 | 224 | 
| IL32 | Sense: TCAAGAGAACAGTCCCGAAACC Anti-sense: AGCGTACTTCTTGCTGTGCTTC  | NM_005224639 | 71 | 
| TGF-β | Sense: CTGCTGTGTTCGTCAGCTCT Anti-sense: TCCAGGCTCCAGATGTAAGG  | NM_001166068 | 123 | 
| CCL2 | 
                Sense: GCTCGCTCAGCCAGATGCAA Anti-sense: GGACACTTGCTGCTGGTGACTC  | NM_174006 | 171 | 
| CCL5 | 
                Sense: CTGCCTTCGCTGTCCTCCTGATG Anti-sense: TTCTCTGGGTTGGCGCACACCTG  | NM_ 175827 | 152 | 
| CCL20 | Sense: TTCGACTGCTGTCTCCGATA Anti-sense: GCACAACTTGTTTCACCCACT  | NM_174263 | 172 | 
| CCL28 | Sense: GCTTCTGGAAAGAGTGACAACGT Anti-sense: AGGATGACAGCAGCCAAGTC  | NM_001101163 | 72 | 
| CXCL2 | Sense: CCCGTGGTCAACGAACTGCGCTGC Anti-sense: CTAGTTTAGCATCTTATCGATGATT  | NM_174299 | 204 | 
| CXCL3 | 
                Sense: CCCGTGGTCAACGAACTGCGCTGC Anti-sense: AGTTGGTGCTGCCCTTGTTTAG  | NM_001046513 | 217 | 
| CXCL5 | Sense: CCCGTGGTCAACGAACTGCGCTGC Anti-sense: AGTTGGTGCTGCCCTTGTTTAG  | NM_001046513 | 193 | 
| CXCL9 | 
                Sense: ACTGGAGTTCAAGGAGTTCCAGCA Anti-sense: TCTCACAAGAAGGGCTTGGAGCAA  | NM_001113172 | 129 | 
| CXCL14 | Sense: AAGCTGGAAATGAAGCCAAA Anti-sense: GTTCCAGGCGTTGTACCATT  | NM_001034410.2 | 153 | 
| Growth Parameters | Treatments | SEM | p-Value | |
|---|---|---|---|---|
| LPT | HPT | |||
| BW Initial (kg) | 301.0 | 301.0 | 11.50 | 0.45 | 
| BW Final (kg) | 383.0 | 369.0 | 12.35 | p < 0.05 | 
| ADFI (kg/d) | 11.10 | 10.5 | 0.56 | p < 0.05 | 
| ADG (kg/d) | 1.46 | 1.23 | 0.09 | p < 0.05 | 
| FI/G | 7.60 | 8.53 | 0.32 | p < 0.01 | 
| Feed cost (RMB/head/d) | 21.5 | 24.8 | 1.50 | p < 0.01 | 
| WH: Initial (cm) | 130.40 | 131.20 | 12.80 | 0.81 | 
| Final (cm) | 135.20 | 136.50 | 12.30 | 0.57 | 
| Change (cm/d) | 0.09 | 0.07 | 0.01 | p < 0.05 | 
| BL: Initial (cm) | 135.80 | 137.3 | 11.3 | 0.18 | 
| Final (cm) | 151.60 | 150.5 | 13.50 | 0.35 | 
| Change (cm/d) | 0.28 | 0.24 | 0.02 | p < 0.05 | 
| CG: Initial(cm) | 164.05 | 165.40 | 14.02 | 0.36 | 
| Final (cm) | 172.30 | 173.50 | 16.21 | 0.40 | 
| Change (cm/d) | 0.15 | 0.14 | 0.01 | 0.08 | 
| Nutrients | Treatments | SEM | p-Value | |
|---|---|---|---|---|
| LPT | HPT | |||
| DM (%) | 75.73 | 71.30 | 1.75 | p < 0.05 | 
| CP (%) | 78.56 | 79.25 | 4.13 | 0.16 | 
| NDF (%) | 69.20 | 66.37 | 1.10 | p < 0.05 | 
| ADF (%) | 61.03 | 56.50 | 1.56 | p < 0.01 | 
| Behavior Parameters | Treatments | SEM | p-Value | |
|---|---|---|---|---|
| LPT | HPT | |||
| NDFI (kg/d) | 3.85 | 2.79 | 0.45 | p < 0.05 | 
| FT (min/d) | 310.50 | 306.80 | 18.35 | 0.60 | 
| DM (min/kg) | 27.95 | 29.21 | 0.83 | p < 0.05 | 
| NDF (min/kg) | 80.65 | 109.90 | 10.12 | p < 0.05 | 
| RT (min/d) | 371.03 | 326.50 | 20.56 | p < 0.05 | 
| DM (min/kg) | 33.40 | 31.10 | 2.50 | 0.32 | 
| NDF (min/kg) | 96.35 | 117.02 | 8.61 | p < 0.05 | 
| CT (min/d) | 680.10 | 631.20 | 28.30 | p < 0.05 | 
| DM (min/kg) | 61.27 | 60.11 | 2.85 | 0.79 | 
| NDF (min/kg) | 176.60 | 226.20 | 18.50 | p < 0.05 | 
| Rumen Parameters | Treatments | SEM | p-Value | |
|---|---|---|---|---|
| LPT | HPT | |||
| NH3-N (mg/dL) | 11.73 | 12.06 | 0.26 | 0.53 | 
| Rumen pH | 6.33 | 5.87 | 0.09 | p < 0.05 | 
| MCP (mg/mL) | 3.45 | 3.02 | 0.18 | p < 0.05 | 
| Total VFA (mmol/L) | 115.38 | 130.95 | 5.64 | p < 0.05 | 
| Acetate (C2)/(mmol/L) | 59.41 | 71.05 | 4.93 | p < 0.05 | 
| Propionate (C3)/(mmol/L) | 23.15 | 35.35 | 3.65 | p < 0.05 | 
| Butyrate (C4)/(mmol/L) | 16.26 | 16.13 | 1.10 | 0.95 | 
| C2:C3 | 2.60 | 2.02 | 0.12 | p < 0.05 | 
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.  | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Gong, X.; Huang, Y.; Jiang, M.; Zhan, K.; Lin, M.; Zhao, G. Growth Performance, Rumen Fermentation and Inflammatory Response on Holstein Growing Cattle Treated with Low and High Non-Fibrous Carbohydrate to Neutral Detergent Fiber Ratio Pelleted Total Mixed Ration. Animals 2022, 12, 1036. https://doi.org/10.3390/ani12081036
Chen Y, Gong X, Huang Y, Jiang M, Zhan K, Lin M, Zhao G. Growth Performance, Rumen Fermentation and Inflammatory Response on Holstein Growing Cattle Treated with Low and High Non-Fibrous Carbohydrate to Neutral Detergent Fiber Ratio Pelleted Total Mixed Ration. Animals. 2022; 12(8):1036. https://doi.org/10.3390/ani12081036
Chicago/Turabian StyleChen, Yinyin, Xiaoxiao Gong, Yinghao Huang, Maocheng Jiang, Kang Zhan, Miao Lin, and Guoqi Zhao. 2022. "Growth Performance, Rumen Fermentation and Inflammatory Response on Holstein Growing Cattle Treated with Low and High Non-Fibrous Carbohydrate to Neutral Detergent Fiber Ratio Pelleted Total Mixed Ration" Animals 12, no. 8: 1036. https://doi.org/10.3390/ani12081036
APA StyleChen, Y., Gong, X., Huang, Y., Jiang, M., Zhan, K., Lin, M., & Zhao, G. (2022). Growth Performance, Rumen Fermentation and Inflammatory Response on Holstein Growing Cattle Treated with Low and High Non-Fibrous Carbohydrate to Neutral Detergent Fiber Ratio Pelleted Total Mixed Ration. Animals, 12(8), 1036. https://doi.org/10.3390/ani12081036
        
                                                
