The Effect of Anthocyanins from Dioscorea alata L. on Antioxidant Properties of Perinatal Hainan Black Goats and Its Possible Mechanism in the Mammary Gland
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Reagent Preparation
2.3. Breeding and Management of Hainan Black Goats
2.4. Determination of Antioxidant Properties
2.5. Cell Culture
2.6. Measurement of Cell Relative Survival Rate
2.7. Measurement of LDH Activity and the Relative Content of ROS
2.8. Measurement of Antioxidant Ability
2.9. Measurement of Pre-Protection Capacity
2.10. RNA Extraction and qPCR
2.11. Western Blotting Analysis
2.12. Statistical Analysis
3. Results
3.1. The Effects of Experimental Feed on Antioxidant Capacity of Perinatal Hainan Black Goats and Newborn Kids
3.1.1. The Effect of Experimental Feed on Blood and Milk Antioxidant Capacity of Female Goats
3.1.2. The Effect of Experimental Feed on Fermentation Parameters in Rumen of Perinatal Female Goats
3.1.3. The Effect of Experimental Feed on Antioxidant Capacity in Blood of Newborn Kids
3.2. The Optimum Effect Condition of DAC on GMEC
3.2.1. The Effect of DAC on Relative Survival Rate of GMEC
3.2.2. The Effect of DAC on LDH Activity and ROS Relative Content
3.2.3. The Effect of DAC on Antioxidant Capacity of GMEC
3.3. The Effect of Pre-Protection and Mechanism of DAC on H2O2-Induced GMEC Oxidative Damage
3.3.1. Selection of VC Concentration
3.3.2. The Effect of Pre-Protection from DAC on Antioxidant Capacity of GMEC
3.3.3. The Effect of Pre-Protection from DAC on Key Genes of Nrf2 and MAPK-JNK Signaling Pathway in GMEC
3.3.4. The Effect of Pre-Protection from DAC on Key Proteins of MAPK-JNK Signaling Pathway in GMEC
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Celi, P.; Di Trana, A.; Claps, S. Effects of plane of nutrition on oxidative stress in goats during the peripartum period. Vet. J. 2010, 184, 95–99. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.Y.; Zhang, H.M. Perinatal Management Techniques of Dairy Goats. China Dairy 2021, 5, 34–37. [Google Scholar]
- Drackley, J.K. ADSA Foundation Scholar Award. Biology of dairy cows during the transition period: The final frontier? J. Dairy Sci. 1999, 82, 2259–2273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mavangira, V.; Sordillo, L.M. Role of lipid mediators in the regulation of oxidative stress and inflammatory responses in dairy cattle. Res. Vet. Sci. 2018, 116, 4–14. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, J.J.; Shen, G.X.; Wang, E.Q.; An, X.Z.; Yun, Q. The Monitoring of Some Blood Physiological and Biochemical Index of Cows During Perinatal Period. China Dairy Cattle 2014, 21, 27–31. [Google Scholar]
- Li, Y.; Ding, H.Y.; Wang, X.C.; Feng, S.B.; Li, X.B.; Wang, Z.; Liu, G.W. An association between the level of oxidative stress and the concentrations of NEFA and BHBA in the plasma of ketotic dairy cows. J. Anim. Physiol. Anim. Nutr. 2016, 100, 844–851. [Google Scholar] [CrossRef] [Scilit]
- Song, S.B.; Jang, S.-Y.; Kang, H.T.; Wei, B.; Jeoun, U.-W.; Yoon, G.S.; Hwang, E.S. Modulation of Mitochondrial Membrane Potential and ROS Generation by Nicotinamide in a Manner Independent of SIRT1 and Mitophagy. Mol. Cells 2017, 40, 503–514. [Google Scholar] [CrossRef] [Scilit]
- Filomeni, G.; De Zio, D.; Cecconi, F. Oxidative stress and autophagy: The clash between damage and metabolic needs. Cell Death Differ. 2015, 22, 377–388. [Google Scholar] [CrossRef] [Scilit]
- Jarisarapurin, W.; Kunchana, K.; Chularojmontri, L.; Wattanapitayakul, S.K. Unripe Carica papaya Protects Methylglyoxal-Invoked Endothelial Cell Inflammation and Apoptosis via the Suppression of Oxidative Stress and Akt/MAPK/NF-κB Signals. Antioxidants 2021, 10, 1158. [Google Scholar] [CrossRef] [Scilit]
- Kaulmann, A.; Bohn, T. Carotenoids, inflammation, and oxidative stress--implications of cellular signaling pathways and relation to chronic disease prevention. Nutr. Res. 2014, 34, 907–929. [Google Scholar] [CrossRef] [Scilit]
- Sordillo, L.M. Mammary Gland Immunobiology and Resistance to Mastitis. Vet. Clin. N. Am. Food Anim. Pract. 2018, 34, 507–523. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhao, X.; Ponchon, B.; Lanctôt, S.; Lacasse, P. Invited review: Accelerating mammary gland involution after drying-off in dairy cattle. J. Dairy Sci. 2019, 102, 6701–6717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y. The etiology, harm, symptoms, treatment and prevention of cow mastitis. Mod. Anim. Husb. Sci. Technol. 2020, 4, 86–87. [Google Scholar]
- Chen, T. Antioxidant Effect In Vitro and Anti-Inflammatory Effect on TNBS Induced Mice Colitis of Anthocyanins Dioscorea alata L. Master’s Thesis, Hainan University, Haikou, China, 2016. [Google Scholar]
- Wang, Y.Y. Study on Preprotection and Mechanism of Purple Sweet Potato Crude Extract Against H2O2-Inducedoxidative Damage in IPEC-J2 Cells. Master’s Thesis, Hainan University, Haikou, China, 2021. [Google Scholar]
- Huang, D.; Ou, B.; Prior, R.L. The Chemistry behind Antioxidant Capacity Assays. J. Agric. Food Chem. 2005, 53, 1841–1856. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mattioli, R.; Francioso, A.; Mosca, L.; Silva, P. Anthocyanins: A Comprehensive Review of Their Chemical Properties and Health Effects on Cardiovascular and Neurodegenerative Diseases. Molecules 2020, 25, 3809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ali, T.; Kim, T.; Rehman, S.U.; Khan, M.S.; Amin, F.U.; Khan, M.; Kim, M. Natural Dietary Supplementation of Anthocyanins via PI3K/Akt/Nrf2/HO-1 Pathways Mitigate Oxidative Stress, Neurodegeneration, and Memory Impairment in a Mouse Model of Alzheimer’s Disease. Mol. Neurobiol. 2018, 55, 6076–6093. [Google Scholar] [CrossRef] [Scilit]
- Côrtes, C.; Palin, M.-F.; Gagnon, N.; Benchaar, C.; Lacasse, P.; Petit, H.V. Mammary gene expression and activity of antioxidant enzymes and concentration of the mammalian lignan enterolactone in milk and plasma of dairy cows fed flax lignans and infused with flax oil in the abomasum. Br. J. Nutr. 2012, 108, 1390–1398. [Google Scholar] [CrossRef] [Scilit]
- Han, K.-H.; Sekikawa, M.; Shimada, K.-I.; Hashimoto, M.; Noda, T.; Tanaka, H.; Fukushima, M. Anthocyanin-rich purple potato flake extract has antioxidant capacity and improves antioxidant potential in rats. Br. J. Nutr. 2006, 96, 1125–1134. [Google Scholar] [CrossRef] [Scilit]
- Jeong, J.W.; Lee, W.S.; Shin, S.C.; Kim, G.Y.; Choi, B.T.; Choi, Y.H. Anthocyanins downregulate lipopolysaccharide-induced inflammatory responses in BV2 microglial cells by suppressing the NF-κB and Akt/MAPKs signaling pathways. Int. J. Mol. Sci. 2013, 14, 1502–1515. [Google Scholar] [CrossRef] [Scilit]
- Kaewmool, C.; Udomruk, S.; Phitak, T.; Pothacharoen, P.; Kongtawelert, P. Cyanidin-3-O-Glucoside Protects PC12 Cells Against Neuronal Apoptosis Mediated by LPS-Stimulated BV2 Microglial Activation. Neurotox. Res. 2020, 37, 111–125. [Google Scholar] [CrossRef] [Scilit]
- Surh, Y.J.; Na, H.K. NF-kappaB and Nrf2 as prime molecular targets for chemoprevention and cytoprotection with anti-inflammatory and antioxidant phytochemicals. Genes Nutr. 2008, 2, 313–317. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.Y. Effects of Body Condition on Follicular Development and Integration of Ewes and Kidlets during Lactation in Goats; Nanjing Agricultural University: Nanjing, China, 2019. [Google Scholar]
- Diao, Q.Y.; Ma, T. Research Advance of Nutrient Requirements of Meat-type Sheep in China. Feed. Ind. 2022, 43, 1–7. [Google Scholar]
- Jia, Z.; Yang, D.; Wang, W.W.; Jiang, C.; Liu, J.; Cheng, L. Effects of dietary non-fibrous carbohydrate to neutral detergent fiber ratio on growth performance, nutrient apparent digestibility and serum biochemical indices of goats. Chin. J. Anim. Nutr. 2022, 34, 5136–5145. [Google Scholar]
- Zhang, Y.X.; Wang, Y.Y.; Yun, Y.H.; Chen, J.P.; Shi, H.Y.; Wang, X.M. Establishment of oxidative damage model of goat mammary epithelial cells. China Anim. Husb. Vet. Med. 2022, 49, 1917–1925. [Google Scholar]
- Alba, D.F.; da Rosa, G.; Hanauer, D.; Saldanha, T.F.; Souza, C.F.; Baldissera, M.D.; Santos, D.D.S.D.; Piovezan, A.P.; Girardini, L.K.; Da Silva, A.S. Subclinical mastitis in Lacaune sheep: Causative agents, impacts on milk production, milk quality, oxidative profiles and treatment efficacy of ceftiofur. Microb. Pathog. 2019, 137, 103732. [Google Scholar] [CrossRef] [Scilit]
- Tsiplakou, E.; Mavrommatis, A.; Kalogeropoulos, T.; Chatzikonstantinou, M.; Koutsouli, P.; Sotirakoglou, K.; Labrou, N.; Zervas, G. The effect of dietary supplementation with rumen-protected methionine alone or in combination with rumen-protected choline and betaine on sheep milk and antioxidant capacity. J. Anim. Physiol. Anim. Nutr. 2017, 101, 1004–1013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weiss, G.A.; Hennet, T. Mechanisms and consequences of intestinal dysbiosis. Cell. Mol. Life Sci. 2017, 74, 2959–2977. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomasello, G.; Mazzola, M.; Leone, A.; Sinagra, E.; Zummo, G.; Farina, F.; Damiani, P.; Cappello, F.; Geagea, A.G.; Jurjus, A.; et al. Nutrition, oxidative stress and intestinal dysbiosis: Influence of diet on gut microbiota in inflammatory bowel diseases. Biomed. Pap. Med. Fac. Univ. Palacky Olomouc Czech Repub. 2016, 160, 461–466. [Google Scholar] [CrossRef] [Scilit]
- Bach, A.; López-García, A.; González-Recio, O.; Elcoso, G.; Fàbregas, F.; Chaucheyras-Durand, F.; Castex, M. Changes in the rumen and colon microbiota and effects of live yeast dietary supplementation during the transition from the dry period to lactation of dairy cows. J. Dairy Sci. 2019, 102, 6180–6198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jonker, A.; Gruber, M.Y.; Wang, Y.; Narvaez, N.; Coulman, B.; McKinnon, J.J.; A Christensen, D.; Azarfar, A.; Yu, P. Fermentation, degradation and microbial nitrogen partitioning for three forage colour phenotypes within anthocyanidin-accumulating Lc-alfalfa progeny. J. Sci. Food Agric. 2012, 92, 2265–2273. [Google Scholar] [CrossRef] [Scilit]
- Srivichai, S.; Hongsprabhas, P. Profiling Anthocyanins in Thai Purple Yams (Dioscorea alata L.). Int. J. Food Sci. 2020, 2020, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Guo, A.L.; Zhou, X.H.; Yao, Y.Y.; Zhao, G.M.; Liu, M.Y.; Zhou, C.X.; Li, H.J. Physicochemical properties and starch quality of different corn varieties. J. Chin. Cereals Oils 2022, 37, 39–47. [Google Scholar]
- Guo, T.; Wang, Z.L.; Guo, L.; Li, F.; Li, F. Effects of supplementation of nonforage fiber source in diets with different starch levels on growth performance, rumen fermentation, nutrient digestion, and microbial flora of Hu lambs. Transl. Anim. Sci. 2021, 5, txab065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hosoda, K.; Sasahara, H.; Matsushita, K.; Tamura, Y.; Miyaji, M.; Matsuyama, H. Anthocyanin and proanthocyanidin contents, antioxidant activity, and in situ degradability of black and red rice grains. Asian-Australas. J. Anim. Sci. 2018, 31, 1213–1220. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lazalde-Cruz, R.; Miranda-Romero, L.A.; Tirado-González, D.N.; Carrillo-Díaz, M.I.; Medina-Cuéllar, S.E.; Mendoza-Martínez, G.D.; Salem, A.Z. Potential Effects of Delphinidin-3-O-Sambubioside and Cyanidin-3-O-Sambubioside of Hibiscus sabdariffa L. on Ruminant Meat and Milk Quality. Animals 2021, 11, 2827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hayes, J.D.; Flanagan, J.U.; Jowsey, I.R. Glutathione transferases. Annu. Rev. Pharmacol. Toxicol. 2005, 45, 51–88. [Google Scholar] [CrossRef] [Scilit]
- Al-Qudah, K.M. Oxidant and antioxidant profile of hyperketonemic ewes affected by pregnancy toxemia. Vet. Clin. Pathol. 2011, 40, 60–65. [Google Scholar] [CrossRef] [Scilit]
- Xie, N.N.; Yan, S.P.; Zhang, C.H.; Cao, X.Y.; Zhang, Y.S. Effects of Phytoestrogen Daidzein on Proliferation and Cell Cycle of Bovine Mammary Epithelial Cells. Chin. J. Anim. Nutr. 2022, 34, 2645–2653. [Google Scholar]
- Padayatty, S.J.; Levine, M. Vitamin C: The known and the unknown and Goldilocks. Oral Dis. 2016, 22, 463–493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaźmierczak-Barańska, J.; Boguszewska, K.; Adamus-Grabicka, A.; Karwowski, B.T. Two Faces of Vitamin C—Antioxidative and Pro-Oxidative Agent. Nutrients 2020, 12, 1501. [Google Scholar] [CrossRef] [Scilit]
- Bai, X.; Lian, Y.; Hu, C.; Yang, S.; Pei, B.; Yao, M.; Li, Z. Cyanidin-3-glucoside protects against high glucose-induced injury in human nucleus pulposus cells by regulating the Nrf2/HO-1 signaling. J. Appl. Toxicol. 2022, 42, 1137–1145. [Google Scholar] [CrossRef] [Scilit]
- Su, M.; Chen, H.; Wei, C.; Chen, N.; Wu, W. Potential protection of vitamin C against liver-lesioned mice. Int. Immunopharmacol. 2014, 22, 492–497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sant, D.W.; Mustafi, S.; Gustafson, C.B.; Chen, J.; Slingerland, J.M.; Wang, G. Vitamin C promotes apoptosis in breast cancer cells by increasing TRAIL expression. Sci. Rep. 2018, 8, 5306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Wang, D.; Wang, X.; Wang, Y.; Ren, F.; Chang, D.; Chang, Z.; Jia, B. Caspase 3 is Activated through Caspase 8 instead of Caspase 9 during H2O2-induced Apoptosis in HeLa Cells. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2011, 27, 539–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Feng, R.; Ni, H.-M.; Wang, S.Y.; Tourkova, I.L.; Shurin, M.; Harada, H.; Yin, X.-M. Cyanidin-3-rutinoside, a Natural Polyphenol Antioxidant, Selectively Kills Leukemic Cells by Induction of Oxidative Stress. J. Biol. Chem. 2007, 282, 13468–13476. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, Y.; Li, Y.; Zhang, H.; Wang, Y.; Wu, C.; Huang, W. Malvidin induces hepatic stellate cell apoptosis via the endoplasmic reticulum stress pathway and mitochondrial pathway. Food Sci. Nutr. 2020, 8, 5095–5106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cellat, M.; İşler, C.T.; Uyar, A.; Kuzu, M.; Aydın, T.; Etyemez, M.; Güvenç, M. Protective effect of Smilax excelsa L. pretreatment via antioxidant, anti-inflammatory effects, and activation of Nrf-2/HO-1 pathway in testicular torsion model. J. Food Biochem. 2022, 46, e14161. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| Ingredient | Dry Matter (%) | |||||
|---|---|---|---|---|---|---|
| Crude Protein (CP) 1 | Crude Fat (CF) 2 | Neutral Detergent Fiber (NDF) 3 | Acid Detergent Fiber (ADF) 4 | Calcium (Ca) 5 | Total Phosphorus (TP) 6 | |
| Corn | 7.786 | 4.722 | 19.911 | 2.258 | 0.200 | 0.204 |
| Bran | 17.966 | 2.429 | 47.431 | 12.992 | 0.207 | 0.512 |
| Soybean Meal | 45.774 | 0.784 | 23.184 | 14.380 | 0.559 | 0.298 |
| Dioscorea alata L. | 9.550 | 1.855 | 25.662 | 5.540 | - | - |
| Item | Content (%) 1 | |
|---|---|---|
| Control | Treatment | |
| Corn | 67 | 47 |
| Bran | 10 | 11 |
| Soybean Meal | 18 | 17 |
| Dioscorea alata L. powder | 0 | 20 |
| Shell powder | 1.4 | 1.4 |
| Sodium bicarbonate | 0.6 | 0.6 |
| CaHPO4 | 1 | 1 |
| Premix 2 | 1 | 1 |
| Salt | 1 | 1 |
| Total | 100 | 100 |
| Dry Matter | ||
| CP % | 15.25 | 15.33 |
| CF % | 3.55 | 2.99 |
| NDF % | 22.26 | 23.65 |
| ADF % | 5.40 | 6.04 |
| Metabolisable energy 3 (ME MJ/kg) | 13.45 | 13.43 |
| Gene 1 | Primer Sequence (5′→3′) |
|---|---|
| Bax | F: TTTCCGACGCACTTCAAC R: CTCGAAGGAAGTCCAATGTC |
| Bcl-2 | F: TCTCCGGCTCACAGCAC R: CAGCCAGGAAATCAACAG |
| Nrf2 | F: TGACAATGAGGTTTCTTCG R: GTGGCTACCTGAACGAACA |
| NQO-1 | F: AGTCCCTGCCATCCTGAA R: TCGGGAGTGTGCCCAATG |
| Caspase-3 | F: CATTATTCAGGCCTGCCGAG R: CTCGAGCTTGTGAGCGTACT |
| Caspase-9 | F: GGGAAATGCTGATCTGGCCT R: CAGCCGTGAGAGAGGATGAC |
| TNF-α | F: CAAGTAACAAGCCGGTAGCCC R: CCTGAAGAGGACCTGCGAGTAG |
| HO-1 | F: GAACGCAACAAGGAGAAC R: CTGGAGTCGCTGAACATAG |
| IL-1β | F: CATGTGTGCTGAAGGCTCTC R: AGTGTCGGCGTATCACCTTT |
| GAPDH | F: CCGTTCGACAGATAGCCGTAA R: AGGATCTCGCTCCTGGAAGA |
| Group | Item | Time (d) | |||||
|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 7 | 14 | 21 | ||
| Control | CAT (U/mL) | 4.923 ± 0.493 Aa | 3.425 ± 0.496 Aa | 4.234 ± 0.64 Aa | 4.458 ± 0.875 Aa | 3.925 ± 0.615 Aa | 3.853 ± 0.760 Aa |
| Treatment | 3.295 ± 0.639 Aa | 3.495 ± 0.535 Aa | 3.597 ± 0.839 Aa | 4.351 ± 0.737 Aa | 5.030 ± 0.878 Aa | 4.760 ± 0.921 Aa | |
| Control | T-AOC (U/mL) | 1.406 ± 0.121 Aa | 1.857 ± 0.190 Aa | 1.575 ± 0.125 Aa | 1.663 ± 0.107 Aa | 1.486 ± 0.104 Aa | 1.472 ± 0.067 Aa |
| Treatment | 2.105 ± 0.091 Ab | 2.007 ± 0.137 Aa | 2.044 ± 0.083 Ab | 2.112 ± 0.090 Ab | 2.097 ± 0.121 Ab | 2.098 ± 0.167 Ab | |
| Control | SOD (U/mL) | 19.819 ± 0.642 Aa | 18.785 ± 1.339 Aa | 20.477 ± 0.742 Aa | 20.372 ± 0.655 Aa | 20.300 ± 0.635 Aa | 21.579 ± 0.521 Aa |
| Treatment | 25.341 ± 0.426 Ab | 24.396 ± 0.373 Ab | 25.034 ± 0.282 Ab | 24.575 ± 0.914 Ab | 24.523 ± 0.738 Ab | 24.606 ± 0.746 Ab | |
| Control | GSH-Px (U/mgPr) | 466.925 ± 8.353 Aa | 483.800 ± 6.671 ABa | 487.476 ± 10.872 ABa | 500.392 ± 9.243 Ba | 497.490 ± 7.727 Ba | 491.974 ± 8.668 ABa |
| Treatment | 477.236 ± 9.820 Aa | 481.557 ± 7.950 Aa | 492.888 ± 12.282 ABa | 533.744 ± 12.036 Cb | 521.782 ± 10.494 BCa | 507.744 ± 13.389 ABCa | |
| Control | MDA (nmol/mL) | 11.594 ± 0.684 Aa | 11.544 ± 0.662 Aa | 9.966 ± 0.343 ABa | 8.971 ± 0.862 Ba | 9.010 ± 0.569 Ba | 11.103 ± 0.937 ABa |
| Treatment | 9.601 ± 0.535 Ab | 7.588 ± 0.366 Bb | 8.280 ± 0.623 Bb | 7.654 ± 0.402 Ba | 7.762 ± 0.51 Ba | 9.288 ± 0.496 Ab | |
| Group | Item | Time (d) | |||||
|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 7 | 14 | 21 | ||
| Control | CAT (U/mL) | 22.992 ± 2.073 Aa | 20.464 ± 1.465 Aa | 20.314 ± 1.523 Aa | 24.357 ± 1.903 Aa | 31.612 ± 1.207 Ba | 30.967 ± 1.719 Ba |
| Treatment | 28.128 ± 1.636 Aa | 27.762 ± 2.145 Ab | 30.620 ± 2.420 Ab | 25.680 ± 2.163 Aa | 30.389 ± 1.556 Aa | 38.509 ± 0.800 Bb | |
| Control | T-AOC (U/mL) | 38.262 ± 2.618 ABa | 41.295 ± 2.564 Ba | 33.390 ± 2.543 ABa | 50.853 ± 3.200 Ca | 38.171 ± 3.760 ABa | 32.049 ± 2.091 Aa |
| Treatment | 42.584 ± 1.88 Aa | 57.446 ± 3.639 Bb | 54.911 ± 3.753 Bb | 38.368 ± 3.314 Ab | 44.634 ± 3.994 Aa | 44.489 ± 2.927 Ab | |
| Control | SOD (U/mL) | 9.963 ± 1.481 ABa | 11.019 ± 1.717 Ba | 12.053 ± 0.896 Ba | 11.342 ± 1.622 Ba | 6.176 ± 1.035Aa | 7.917 ± 0.954 ABa |
| Treatment | 12.197 ± 1.358 Aa | 9.776 ± 1.918 Aa | 11.693 ± 1.882 Aa | 9.457 ± 1.496 Aa | 12.06 ± 1.873 Ab | 9.581 ±1.374 Aa | |
| Control | GSH-Px (U/mgPr) | 478.876 ± 6.981 Aa | 490.966 ± 6.037 Aa | 481.148 ± 7.832 Aa | 480.891 ± 9.380 Aa | 492.499 ± 12.768 Aa | 491.825 ± 8.849 Aa |
| Treatment | 495.336 ± 9.497 Aa | 508.435 ± 10.544 Aa | 501.153 ± 9.089 Aa | 517.455 ± 5.797 Ab | 513.965 ± 7.843 Aa | 512.936 ± 7.321 Aa | |
| Control | MDA (nmol/mL) | 12.015 ± 1.868 Aa | 10.761 ± 1.513 ABa | 8.417 ± 0.788 ABa | 7.449 ± 1.114 Ba | 8.83 ± 0.987 ABa | 10.393 ± 0.806 ABa |
| Treatment | 8.267 ± 0.725 Ab | 7.956 ± 0.801 Aa | 6.515 ± 0.583 Aa | 6.270 ± 0.728 Aa | 7.545 ±0.497 Aa | 7.239 ± 0.654 Ab | |
| Item | Group | |||
|---|---|---|---|---|
| Control | Treatment | |||
| Experiment 14 d | Postpartum 21 d | Experiment 14 d | Postpartum 21 d | |
| Acetic acid (mmol/L) | 32.730 ± 1.921 A | 28.663 ± 2.395 A | 29.887 ± 0.015 A | 28.208 ± 1.140 A |
| Propionic acid (mmol/L) | 10.807 ± 0.544 A | 8.609 ± 0.322 B | 9.096 ± 0.003 B | 7.141 ± 0.213 C |
| Acetic acid/Propionic acid | 3.043 ± 0.218 A | 3.325 ± 0.215 A | 3.286 ± 0.001 A | 3.944 ± 0.067 B |
| Butyric acid (mmol/L) | 6.231 ± 0.235 A | 5.246 ± 0.312 B | 4.246 ± 0.096 C | 4.080 ± 0.080 C |
| TVFA (mmol/L) | 53.043 ± 1.889 A | 44.843 ± 2.332 B | 45.996 ± 0.143 B | 41.567 ± 1.336 B |
| pH | 6.84 ± 0.12 AB | 6.60 ± 0.06 A | 7.07 ± 0.01 BC | 7.20 ± 0.07 C |
| Group | Item | Time (d) | ||
|---|---|---|---|---|
| 7 | 14 | 21 | ||
| Control | CAT (U/mL) | 3.046 ± 0.470 ABa | 2.501 ± 0.280 Aa | 3.648 ± 0.448 Ba |
| Treatment | 2.262 ± 0.079 Aa | 4.119 ± 1.340 ABa | 7.369 ± 1.451 Bb | |
| Control | T-AOC (U/mL) | 3.772 ± 0.302 Aa | 4.050 ± 0.362 Aa | 3.440 ± 0.276 Aa |
| Treatment | 5.045 ± 0.452 Ab | 4.791 ± 0.331 Aa | 4.410 ± 0.358 Ab | |
| Control | SOD (U/mL) | 16.914 ± 1.771 Aa | 18.510 ± 1.978 Aa | 20.051 ± 1.145 Aa |
| Treatment | 24.658 ± 0.238 Ab | 24.586 ± 0.651 Ab | 24.916 ± 0.506 Ab | |
| Control | GSH-Px (U/mgPr) | 441.24 ± 13.109 Aa | 513.143 ± 16.634 Ba | 459.186 ± 7.421 Aa |
| Treatment | 464.522 ± 17.104 Aa | 520.154 ± 11.981 Ba | 483.484 ± 14.614 ABa | |
| Control | MDA (nmol/mL) | 11.180 ± 0.297 Aa | 11.124 ± 0.335 Aa | 10.786 ± 0.488 Aa |
| Treatment | 9.801 ± 0.417 Ab | 9.327 ± 0.370 Ab | 9.731 ± 0.364 Aa | |
| Concentration of DAC (μg/mL) | Treatment Time (h) | |||
|---|---|---|---|---|
| 3 | 5 | 7 | 9 | |
| 0 | 100.0 ± 0 Aa | 100.0 ± 0 Ab | 100.0 ± 0 Aa | 100.0 ± 0 Aa |
| 15 | 99.5 ± 2.3 Aa | 104.4 ± 0.9 ABbc | 106.8 ± 0.6 ABab | 110.7 ± 3.7 Bbc |
| 20 | 100.2 ± 1.9 Aa | 106.9 ± 0.3 ABcd | 105.9 ± 1.2 Aab | 114.9 ± 4.6 Bc |
| 40 | 101.7 ± 2.2 Aa | 110.1 ± 1.7 Bcd | 109.6 ± 2.6 Bbc | 114.0 ± 1.3 Bc |
| 50 | 101.3 ± 2.3 Aa | 106.8 ± 3.4 ABcd | 118.8 ± 2.9 Bd | 110.6 ± 5.1 ABbc |
| 70 | 95.2 ± 3.7 Ab | 92.5 ± 2.0 Aa | 103.4 ± 2.7 Bab | 103.1 ± 2.5 Bab |
| 100 | 110.1 ± 3.1 Ab | 111.9 ± 1.5 Ad | 117.0 ± 4.9 Acd | 114.9 ± 0.8 Ac |
| Concentration of DAC (μg/mL) | Treatment Time (h) | |||
|---|---|---|---|---|
| 3 | 5 | 7 | 9 | |
| 0 | 189.217 ± 6.799 Aa | 176.775 ± 7.477 Aa | 188.803 ± 8.776 Aa | 197.201 ± 11.667 Aa |
| 15 | 196.475 ± 13.716 Aa | 180.923 ± 9.891 Aab | 190.254 ± 9.215 Aa | 209.953 ± 10.775 Aab |
| 20 | 198.341 ± 17.226 Aa | 185.070 ± 11.776 Aab | 205.806 ± 10.825 Aab | 217.937 ± 8.019 Aab |
| 40 | 219.907 ± 6.652 Aa | 199.585 ± 4.519 Aab | 218.662 ± 14.380 Aab | 206.843 ± 8.979 Aab |
| 50 | 214.101 ± 4.519 Aba | 191.291 ± 7.183 Aab | 224.469 ± 8.098 Bab | 223.432 ± 9.890 Bab |
| 100 | 219.284 ± 6.475 Aa | 207.880 ± 6.307 Ab | 231.726 ± 11.215 Ab | 235.874 ± 12.613 Ab |
| Concentration of DAC (μg/mL) | Treatment Time (h) | |||
|---|---|---|---|---|
| 3 | 5 | 7 | 9 | |
| 0 | 100.0 ± 0 Aa | 100.0 ± 0 Aa | 100.0 ± 0 Aa | 100.0 ± 0 Aa |
| 15 | 109.4 ± 2.2 Ab | 91.2 ± 1.8 Bb | 88.6 ± 0.015 Bb | 85.4 ± 1.8 Bb |
| 20 | 100.2 ± 3.1 Aa | 89.5 ± 2.9 Bb | 82.1 ± 0.027 BCc | 80.0 ± 1.4 Cc |
| 40 | 95.3 ± 1.8 Aa | 87.3 ± 1.4 Bb | 81.8 ±0.016 Cc | 79.0 ± 0.5 Cc |
| 50 | 96.3 ± 4.3 Aa | 86.7 ± 0.9 Bb | 79.6 ± 0.005 BCc | 78.7 ± 0.4 Cc |
| 100 | 98.0 ± 2.8 Aa | 85.7 ± 2.1 Bb | 79.3 ± 0.025 Bc | 78.5 ± 1.9 Bc |
| Concentration of DAC (μg/mL) | Treatment Time (h) | |||
|---|---|---|---|---|
| 3 | 5 | 7 | 9 | |
| 0 | 1.295 ± 0.299 Aa | 1.393 ± 0.370 Aa | 1.540 ± 0.243 Aa | 1.753 ± 0.206 Aa |
| 15 | 0.656 ± 0.158 Aa | 1.131 ± 0.295 ABa | 1.654 ± 0.394 BCa | 2.211 ± 0.311 Cab |
| 20 | 1.049 ± 0.245 Aa | 1.114 ± 0.361 Aa | 2.653 ± 0.331 Bb | 4.257 ± 0.220 Cc |
| 40 | 0.967 ± 0.286 Aa | 1.344 ± 0.232 ABa | 1.851 ± 0.266 ABab | 2.604 ± 0.741 Bab |
| 50 | 1.311 ± 0.333 Aa | 1.900 ± 0.243 Aab | 1.933 ± 0.384 Aab | 2.031 ± 0.378 Aa |
| 100 | 0.771 ± 0.279 Aa | 2.604 ± 0.612 Bb | 2.457 ± 0.204 Bab | 3.307 ± 0.327 Bbc |
| Concentration of DAC (μg/mL) | Treatment Time (h) | |||
|---|---|---|---|---|
| 3 | 5 | 7 | 9 | |
| 0 | 2.025 ± 0.193 Aa | 2.019 ± 0.069 Aa | 2.434 ± 0.082 ABa | 2.864 ± 0.213 Ba |
| 15 | 2.163 ± 0.118 Aab | 2.578 ± 0.084 Ab | 3.381 ± 0.269 Bb | 3.679 ± 0.311 Bb |
| 20 | 2.650 ± 0.100 Ab | 3.022 ± 0.155 Ab | 3.928 ± 0.170 Bc | 4.119 ± 0.186 Bb |
| 40 | 3.332 ± 0.136 Ac | 4.370 ± 0.270 Bc | 5.065 ± 0.156 Cd | 6.243 ± 0.247 Dc |
| 50 | 4.426 ± 0.295 Ad | 4.590 ± 0.155 ABc | 5.371 ± 0.196 BCd | 5.969 ± 0.385 Cc |
| 100 | 5.943 ± 0.179 Ae | 6.876 ± 0.267 Bd | 7.801 ± 0.181 Ce | 8.128 ± 0.104 Cd |
| Concentration of DAC (μg/mL) | Treatment Time (h) | |||
|---|---|---|---|---|
| 3 | 5 | 7 | 9 | |
| 0 | 7.775 ± 0.347 Aa | 7.907 ± 0.345 Aa | 7.743 ± 0.364 Aa | 7.759 ± 0.430 Aa |
| 15 | 6.493 ± 0.475 Aabc | 9.501 ± 0.253 Bb | 17.475 ± 0.353 Cb | 16.847 ± 0.533 Cb |
| 20 | 7.184 ± 0.694 Aab | 9.913 ± 0.765 Bb | 18.830 ± 0.674 Cb | 19.617 ± 0.377 Cc |
| 40 | 6.099 ± 0.261 Abc | 12.099 ± 0.349 Bc | 14.882 ± 0.485 Cc | 13.655 ± 0.844 BCd |
| 50 | 6.559 ± 0.350 Aabc | 10.373 ± 0.461 Bb | 12.373 ± 0.625 Cd | 10.795 ± 0.717 BCe |
| 100 | 5.605 ± 0.381 Ac | 10.17 ± 0.705 Bb | 10.871 ± 0.237 Be | 11.589 ± 0.579 Be |
| Concentration of DAC (μg/mL) | Treatment Time (h) | |||
|---|---|---|---|---|
| 3 | 5 | 7 | 9 | |
| 0 | 238.87 ± 23.88 Aa | 175.238 ± 31.053 Aa | 172.209 ± 12.746 Aa | 225.942 ± 4.287 Aa |
| 15 | 342.397 ± 22.793 Bbc | 249.98 ± 19.244 Aab | 296.441 ± 34.218A Bb | 462.589 ± 24.024 Cc |
| 20 | 295.936 ± 5.824 Aab | 256.697 ± 23.14 Aab | 368.657 ± 11.549 Bb | 499.960 ± 17.862 Cc |
| 40 | 382.798 ± 10.936 ABc | 352.497 ± 34.596 Ac | 363.607 ± 22.489 Ab | 455.014 ± 18.869 Bc |
| 50 | 338.357 ± 37.889 ABbc | 262.101 ± 23.487 Aab | 328.257 ± 30.719 ABb | 376.232 ± 11.006 Bb |
| 100 | 276.241 ± 15.874 Aab | 301.996 ± 27.443 Abc | 365.123 ± 42.994 Ab | 334.822 ± 33.753 Ab |
| Concentration of DAC (μg/mL) | Treatment Time (h) | |||
|---|---|---|---|---|
| 3 | 5 | 7 | 9 | |
| 0 | 0.258 ± 0.021 Aa | 0.262 ± 0.018 Aa | 0.245 ± 0.024 Aa | 0.224 ± 0.024 Aa |
| 15 | 0.245 ± 0.129 Aa | 0.207 ± 0.026 Aa | 0.180 ± 0.030 Aab | 0.167 ± 0.012 Ab |
| 20 | 0.230 ± 0.007 Aa | 0.183 ± 0.092 Aa | 0.166 ± 0.043 Aab | 0.141 ± 0.010 Abc |
| 40 | 0.231 ± 0.014 Aa | 0.190 ± 0.017 Ba | 0.174 ± 0.006 Bab | 0.158 ± 0.010 Bb |
| 50 | 0.240 ± 0.041 Aa | 0.173 ± 0.047 ABa | 0.139 ± 0.032 ABb | 0.112 ± 0.009 Bc |
| 100 | 0.248 ± 0.058 Aa | 0.177 ± 0.029 ABa | 0.143 ± 0.021 ABb | 0.101 ± 0.004 Bc |
| Index | Significance of Intersubjective Effect (p-Value) 1 | ||
|---|---|---|---|
| Time | Concentration | Time × Concentration | |
| Survival rate | 0.001 | 0.001 | 0.006 |
| ROS | 0.001 | 0.001 | 0.001 |
| LDH | 0.001 | 0.001 | 0.001 |
| CAT | 0.001 | 0.047 | 0.099 |
| T-AOC | 0.001 | 0.072 | 0.229 |
| SOD | 0.001 | 0.001 | 0.001 |
| MDA | 0.097 | 0.017 | 0.718 |
| GSH-Px | 0.001 | 0.001 | 0.005 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, Y.; Shi, H.; Yun, Y.; Feng, H.; Wang, X. The Effect of Anthocyanins from Dioscorea alata L. on Antioxidant Properties of Perinatal Hainan Black Goats and Its Possible Mechanism in the Mammary Gland. Animals 2022, 12, 3320. https://doi.org/10.3390/ani12233320
Zhang Y, Shi H, Yun Y, Feng H, Wang X. The Effect of Anthocyanins from Dioscorea alata L. on Antioxidant Properties of Perinatal Hainan Black Goats and Its Possible Mechanism in the Mammary Gland. Animals. 2022; 12(23):3320. https://doi.org/10.3390/ani12233320
Chicago/Turabian StyleZhang, Yuanxin, Huiyu Shi, Yanhong Yun, Haibo Feng, and Xuemei Wang. 2022. "The Effect of Anthocyanins from Dioscorea alata L. on Antioxidant Properties of Perinatal Hainan Black Goats and Its Possible Mechanism in the Mammary Gland" Animals 12, no. 23: 3320. https://doi.org/10.3390/ani12233320
APA StyleZhang, Y., Shi, H., Yun, Y., Feng, H., & Wang, X. (2022). The Effect of Anthocyanins from Dioscorea alata L. on Antioxidant Properties of Perinatal Hainan Black Goats and Its Possible Mechanism in the Mammary Gland. Animals, 12(23), 3320. https://doi.org/10.3390/ani12233320

