Next Article in Journal
Factors Affecting Grazing and Rumination Behaviours of Dairy Cows in a Pasture-Based System in New Zealand
Previous Article in Journal
The Effect of Anthocyanins from Dioscorea alata L. on Antioxidant Properties of Perinatal Hainan Black Goats and Its Possible Mechanism in the Mammary Gland
Previous Article in Special Issue
Effects of Dietary Supplementation of Peanut Skin Proanthocyanidins on Growth Performance and Lipid Metabolism of the Juvenile American Eel (Anguilla rostrata)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Influence of Commercial Feed Supplemented with Carnobacterium maltaromaticum Environmental Probiotic Bacteria on the Rearing Parameters and Microbial Safety of Juvenile Rainbow Trout

by
Iwona Gołaś
* and
Jacek Arkadiusz Potorski
Department of Water Protection Engineering and Environmental Microbiology, University of Warmia and Mazury in Olsztyn, Prawocheńskiego 1, 10-720 Olsztyn, Poland
*
Author to whom correspondence should be addressed.
Animals 2022, 12(23), 3321; https://doi.org/10.3390/ani12233321
Submission received: 9 November 2022 / Revised: 22 November 2022 / Accepted: 25 November 2022 / Published: 28 November 2022
(This article belongs to the Special Issue The Relationship between Feeds, Feeding and Fish Quality)

Simple Summary

Rainbow trout meat is characterized by a high nutritional value and microbial safety. The growing demand for trout meat has promoted the rapid development of modern aquaculture methods. Fish feeds are supplemented with various strains of probiotic bacteria to conform to the modern production requirements in aquaculture. Probiotic bacteria, including Carnobacterium maltaromaticum, are defined as live microorganisms that confer health benefits. The beneficial influence exerted by probiotics on fish growth and welfare is determined by the microbial species, its metabolic activity, and origin. However, commercial cultures of probiotic bacteria generally do not deliver the anticipated effects on the farming of fish and other aquatic organisms. In this study, fish feed was supplemented with a probiotic strain of C. maltaromaticum that naturally colonizes cold water in deep lake strata. Juvenile rainbow trout were fed commercial feed supplemented with the analyzed bacterial isolate. Feed supplementation significantly increased the fish biomass, improved the apparent digestibility of feed and nutrients, and contributed to a several–fold decrease in the counts of potentially pathogenic bacteria in the feed, digestive tract contents, and the skin of fish. The results of this study indicate that the C. maltaromaticum environmental strain is a promising probiotic for rearing juvenile rainbow trout in aquaculture.

Abstract

The aim of this study was to determine the effect of commercial feed (CF) supplemented with 0.1% of the Carnobacterium maltaromaticum environmental probiotic strain on the rearing parameters, apparent nutrient digestibility, and microbial safety of juvenile rainbow trout (Oncorhynchus mykiss). The fish were fed CF (control group, CG) and experimental feed (EF) supplemented with 0.1% of C. maltaromaticum (experimental group, EG) for 56 days. The final body weight and total body length of the fish were measured. The growth rate, condition factor, feed conversion ratio, viscerosomatic and hepatosomatic indices, and apparent digestibility coefficients of protein (PAD), lipids (LAD), ash (AAD), and nitrogen-free extract (NFEAD) were calculated. The total viable counts of C. maltaromaticum bacteria, mesophilic bacteria, hemolytic mesophilic bacteria, Pseudomonas fluorescens, Aeromonas hydrophila, Staphylococcus sp., and sulfite-reducing anaerobic spore-forming Clostridium sp. were determined in digestive tract contents and the skin of fish. Feed supplementation with C. maltaromaticum significantly affected most rearing parameters, as well as the PAD, LAD, AAD and NFE values, and bacterial counts. The principal component analysis (PCA) revealed significant positive correlations (p < 0.05) between fish growth rates, PAD and LAD values vs. C. maltaromaticum counts in the EF and in the digestive tract contents of the fish.

1. Introduction

According to FAO data [1], global trout production reached 939.878 tonnes in 2019 and has been increasing since 2015 (21% increase in volume between 2015 and 2019). The rainbow trout was the main species of farmed fish that accounted for 97% of the total production volume in 2019. In the European Union countries, rainbow trout is farmed for human consumption and for re-stocking water bodies for recreational angling [2]. Around 56% of young specimens are farmed in recirculating aquaculture systems (RAS) [3]. In these systems, fish are bred and raised under controlled conditions, and the physicochemical and microbiological parameters of the aquatic environment are monitored in each stage of the production process; therefore, the presence of environmental microorganisms is limited to feed microbiota [4]. The type of diet (including the content of protein, lipids, ash, nitrogen-free extract (NFE), vitamins, and micronutrients) affects feed conversion efficiency (feed conversion ratio (FCR), apparent nutrient digestibility) in different fish species and across different developmental stages. Fish diets also significantly influence fish rearing parameters, including biomass weight and length gain, specific growth rate, daily growth rate, condition factor, as well as embryogenesis, ovulation, immunity, stress responses, and adaptive mechanisms in fish [5,6,7]. In aquaculture, the effectiveness of juvenile fish rearing is influenced not only by the composition of feed, but also by its microbiological quality. Feed microbiota colonize the gastrointestinal tract of fish and facilitate nutrient digestion [8,9,10,11]. However, feed contaminated with potentially pathogenic microorganisms poses a health threat to fish. Juvenile fish are particularly susceptible to pathogenic microbiota. High counts of pathogenic bacterial strains such as P. fluorescens, A. hydrophila, Staphylococcus spp., and Clostridium spp. can compromise fish health and decrease survival rates [12]. Virulent microbiota cause diseases that disrupt the digestive processes, decrease nutrient assimilation and, consequently, reduce fish biomass gain. In addition, fish and fish feces evacuated to the aquatic environment can act as secondary sources of pathogenic microorganisms in RAS.
In aquaculture, potentially pathogenic and pathogenic microorganisms are difficult to eliminate because only a small number of pharmacological products have been approved for use in RAS. Chemotherapeutic agents exert a negative impact on other components of aquaculture, the surrounding environment, and organisms colonizing that environment, which prompts the search for new methods to protect the health of farmed fish [13,14].
Various species of probiotic microorganisms, including Lactobacillus spp., Lactococcus spp., Enterococcus spp., Carnobacterium spp., Streptococcus spp., Bacillus spp., Aeromonas spp., Vibrio spp., Enterobacter spp., and Pseudomonas spp., play an important role in closed aquaculture systems [15,16,17]. The extent to which probiotics confer health benefits on the host is determined by the microbial species, its metabolic activity, and origin. There is considerable evidence to suggest that probiotic bacteria enhance fish health, increase body weight and length gains, enhance the activity of digestive enzymes, eliminate pathogenic bacteria, and stimulate the immune system [17,18,19,20,21,22,23]. However, little is known about the environmental impact or the side effects of probiotics in animal rearing. Probiotic preparations applied in animal (veterinary) husbandry are used in commercial rearing, and they are introduced directly to aquaculture without considering their future impact [24]. For this reason, the properties of probiotic bacteria and their influence on the water environment and other aquatic organisms should be investigated before these strains are introduced to fish farms. Probiotic strains isolated from fish, other aquatic organisms, or water seem to be the safest option for fish farms. Due to their origin, such strains grow and develop rapidly in RAS, and their metabolic activity and antimicrobial properties are enhanced in aquaculture. This group includes Carnobacterium maltaromaticum, which is one of the most metabolically active probiotic bacteria [25,26]. This bacterial species is tolerant to changes in environmental conditions (temperature, pH, salinity), and it easily adapts to various animal habitats. Therefore, the growth and activity of C. maltaromaticum is not compromised by the presence of xenobiotics such as antibiotics and disinfectants, or diverse microbial populations that constitute natural and potentially pathogenic fish microbiota [25,27,28]. A limited number of studies have confirmed that C. maltaromaticum is a promising probiotic for aquaculture [25,26,29].
In view of the far-reaching goals of modern aquaculture, the aim of this study was to determine the influence of commercial feed (CF) supplementation with 0.1% of the C. maltaromaticum environmental probiotic strain on the production of juvenile rainbow trout (Oncorhynchus mykiss) based on: (i) fish rearing parameters, (ii) apparent nutrient digestibility, and (iii) changes in the quantitative and qualitative composition of potentially pathogenic microbiota in the digestive tract contents and the skin of fish.

2. Materials and Methods

2.1. Fish and Rearing Conditions

This study involved juvenile rainbow trout (Oncorhynchus mykiss) that were experimentally reared in RAS in the Department of Ichthyology (Center of Aquaculture and Environmental Engineering) of the University of Warmia and Mazury in Olsztyn (Poland). Two isolated RAS were set up for the experiment (Figure 1). Each RAS comprised three rearing tanks (with a volume of 250 L each) filled with mains water at a flow rate of 4 L min−1 [30]. Each day, 10% of total water volume was recirculated in the RAS. Juvenile rainbow trout for the experiment were obtained from Wodna Farma Ltd. in Wirwajdy (Poland), and they had a mean initial body weight (BWi) of 44.20 ± 7.73 g and a mean initial body length (BLi) of 15.5 ± 0.1 cm [31].
A total of 6 rearing tanks were randomly stocked with juvenile rainbow trout (180 individuals) (2 groups with 3 replicates each: 3 control groups and 3 experimental groups). The fish were acclimated for 14 days according to NRC recommendations [32]. During the acclimation period, juveniles were fed commercial feed (CF), Aller Gold (Aller Aqua, Denmark), which was administered at 1.3% of the fish biomass. The optimal water temperature for rainbow trout (16.1 ± 0.20 °C) was maintained during the 8-week rearing experiment. The following water parameters were measured daily before fish feeding: oxygen content (±0.01 mg O2 L−1), water pH (±0.01), content of total ammonia nitrogen (TAN = NH3+–N + NH4+–N) (±0.01 mg TAN L−1), nitrite nitrogen NO2–N (±0.01 mg NO2–N L−1), and nitrate nitrogen NO3-N (±0.01 mg NO3–N L−1). The oxygen content, TAN, NO2–N, NO3–N, and water pH at tank outflow were as follows: 8.05 ± 0.25 mg O2 L−1, 0.05 ± 0.02 mg TAN L−1, 0.020 ± 0.002 mg NO2–N L−1 and 0.20 ± 0.02 mg NO3–N L−1, and 7.20 ± 0.10. During the entire experiment, the physical and chemical parameters of tank water were maintained at the optimal levels recommended for rainbow trout [33]. The fish were exposed to a 8L: 16D photoperiod, and light intensity at tank surface was 40 to 80 lux [34]. After the experiment, the fish were euthanized with a solution of 300 mg tricaine methanesulfonate (MS–222) L−1 (FINQUEL, Redmond, WA, USA) [35].

2.2. Feed and Feeding

During the experiment, juvenile rainbow trout were fed Aller Gold CF (Aller Aqua, Denmark) with pellet diameter of 3.0 mm. According to the manufacturer’s specifications, the feed had the following composition: 44.0% crude protein, 28.0% crude fat, 14.0% NFE, 8.0% crude ash, and 1.9% crude fiber. Gross and digestible energy was 23.5 MJ kg−1 and 21.3 MJ kg−1, respectively. Control group (CG) fish received CF. Experimental group (EG) fish received experimental feed (EF) comprising Aller Gold feed supplemented with 0.1% (6.5 × 108 cfu g−1) of the C. maltaromaticum environmental probiotic strain. Control and experimental feeds contained 1% of chromic oxide (Chempur, Piekary Śląskie, Poland) to determine nutrient digestibility. The feeds were extruded in the TS-4D extruder (Metalchem, Poland) with a 2.0 mm die. The extrusion parameters were as follows: temperature at the conditioner outlet (°C): 120, temperature in the second segment (°C): 110; endplate temperature (°C): 120, endplate pressure (bar): 15, screw speed (rpm): 60, cutter speed (rpm): 20.
The EF was supplemented with an environmental probiotic strain of C. maltaromaticum isolated from water samples collected from the benthic zone of Lake Legińskie (at a depth of 34 m) in north-eastern Poland (N = 53°58′51″ N and E = 21°8′4″). The strain had been isolated during a previous study conducted by the Department of Environmental Microbiology of the University of Warmia and Mazury in Olsztyn (Poland). The isolate was identified by 16S rDNA (recombinant DNA) sequencing with the BigDye Terminator v3.1 kit in the ABI 3730xl genetic analyzer (Applied Biosystems, Foster City, CA, USA). In addition, 16S rDNA genes were sequenced by PCR with the use of 27F (5′–AGAGTTTGATCATTGGCTCAG–3′) and 1492R (5′-GGTACC-TTGTTACGACTT-3′) primers according to the method described by Gillan [36]. The DNA sequences were identified with the BLAST program available on the website of the National Center for Biotechnology Information (http://blast.ncbi.nlm.nih.gov/Blast.cgi, accessed on 20 March 2016) [37]. The results of 16S rDNA sequencing are presented in Table S1 (Supplementary Materials). The probiotic potential, metabolic activity, and applicability of C. maltaromaticum as a supplement for fish feed had been examined previously [31,38,39].
Fresh 24 h cultures of C. maltaromaticum on tryptone soy agar (TSA; Oxoid, Basingstoke, UK) with the addition of 3% yeast extract and 1.5% (w/v) NaCl [25] were lyophilized in the ALPHA 2–4 LDplus freeze dryer (Martin Christ Gefriertrocknungsanlagen GmbH, Osterode am Harz, Germany). A lyophilized probiotic strain of C. maltaromaticum (6.5 × 108 cfu g−1 EF) was added to the mixture of fish oil and soybean oil (5% each). Next, the probiotic oil suspension was added to the EF sample. The oil mixture was pumped into the feed at 0.9 MPa for 5 min with the use of a vacuum pump. Control and experimental feeds were stored in a refrigerator (Whirlpool, Benton Harbor, MI USA) at a temperature of 4–6 °C during the entire experiment [31]. Feed was administered every 12 h by automatic feeders (FIAP, Inverness, UK). The CG and EG fish received feed in the daily amount of 1.3% of their biomass [34].

2.3. Fish Measurements and Sampling

Individual fish were weighed and measured (body weight, BW ± 0.01 g, total length, BL ± 0.1 cm) at the beginning and end of the experiment. Fish biomass was determined weekly in each tank by weighing the entire stock (±1.0 g). Livers and digestive tracts were weighed at the end of the experiment, immediately after euthanasia. The collected data were used to calculate the following parameters:
  • specific growth rate in percent per day:
SGR (% day−1) = 100 × (ln BWf − ln BWi) × T−1
  • daily growth rate in grams per day:
DGR (g day−1) = (BWi − BWf) × T−1
  • condition factor:
Kf (%) = 100 × (BW × BL−3)
  • coefficient of variability of body weight on the first (CVBWi) and last (CVBWf) day of the experiment:
CVBW (%) = 100 (SD × BW−1)
feed conversion ratio: FCR = TFI × (FB − IB)
viscerosomatic index: VSI (%) = 100 × (Wv × BWf−1)
hepatosomatic index: HIS (%) = 100 × (Wl × BWf−1)
Parameters BWi and BWf denote the initial and final body weights (g), respectively; T is rearing time (days); BL is body length (cm); SD is standard deviation of the average body weight; FB and IB are the final and initial stock biomass (g), respectively; TFI is total feed intake (g); Wv is the weight of viscera (g); Wl is liver weight (g).

2.4. Apparent Nutrient Digestibility

To determine the apparent digestibility coefficients of protein, lipids, ash, and nitrogen-free extract (NFE), 5 fish were collected from each tank (15 fish from each dietary treatment) on the first and last day of the experiment. The fish were anesthetized in an anesthetic solution (300 mg L−1), decapitated, and the hindguts were excised. The proximate analysis of feeds and feces (crude protein, crude fat, and crude ash) was performed according to standard AOAC methods [40]. Total protein content was determined using Kjeldahl’s method, and crude fat content using Soxhlet’s method. Nitrogen-free extract was calculated according to Shearer [41] with the following formula:
NFE (%) = 100 − [(moisture (%) + protein (%) + lipids (%) + ash (%) + fiber (%)].
The content of chromic oxide in diets and feces was determined according to the method of Furukawa and Tsukahara [42].
The apparent digestibility coefficients of protein, lipids, and ash was calculated according Maynard et al. [43] as:
PAD, LAD, and AAD (%) = 100 − [(Cr2O3 in feed (%)) × (Cr2O3 in feces (%))−1 × (protein or lipids or ash in feces (%)) × (protein or lipids or ash in feces and in feed (%))−1] × 100.

2.5. Microbiological Analyses

Fifteen fish randomly sampled from CG and EG on the first and last day of each dietary treatment were subjected to microbiological analyses. Samples of digestive tract (1 g) contents and skin (1 g) were collected aseptically from anesthetized fish (in 300 mg of MS–222 solution L−1). Samples of feed: CF and EF (10 g each) were collected aseptically each week and analyzed. A total of 30 representative samples of digestive tract contents and skin from each dietary treatment, and 7 samples of each feed (CF and EF) were subjected to microbiological analyses.
Aliquots of 1 g fish samples (digestive tract contents, skin) and 10 g feed samples were homogenized with 9 mL and 90 mL of sterile phosphate-buffered saline (PBS), respectively. Serial dilutions with PBS were prepared to reduce bacterial density. Subsequently, 0.1 mL of every homogenized solution was subjected to microbiological analysis. The results of microbiological assays are presented in Table 1. All analyses were performed according to Polish Standards [44,45]. The counts of the analyzed bacterial groups, genera, and bacteria were determined with the use of previously described methods [39,46,47]. Mean microbial counts in the same sample of digestive tract contents, skin, and two fish feeds (CF and EF) were determined in triplicate. Total microbial counts were expressed in cfu g−1 of digestive tract contents, skin, and feed.

2.6. Statistical Analysis

Statistical analyses were carried out using the Statistica 13.3 software package (TIBCO Software Inc., Palo Alto, CA, USA). The Shapiro–Wilk test was applied to test the normality of data distribution. The differences (p < 0.05) in rearing parameters and apparent nutrient digestibility were analyzed using the Mann–Whitney U test. All percentage data were transformed with the square arcsine transformation before statistical analysis.
The significance of differences in bacterial counts between CG and EG were determined using one-way analysis of variance (ANOVA). The correlations between C. maltaromaticum counts and the analyzed bacterial groups in fish and feed samples were determined using Spearman’s nonparametric rank correlation test (p < 0.05).
The presence of relationships between C. maltaromaticum counts in fish and feed samples (CF, EF) and fish rearing parameters was determined by principal component analysis (PCA) with supplementary variables using CANOCO 5.0 software [48]. All variables were standardized to zero mean and unit variance before PCA.

3. Results

3.1. Fish Growth Rate, Apparent Digestibility Coefficients of Protein, Lipids, Ash, and NFE

Significant differences (p < 0.05) in most growth parameters were observed between rainbow trout fed with the CF and EF (Table 2). Fish receiving the EF were characterized by significantly higher values of BWf, Bf, BWg, and DGR (by 14.44 ± 6.52%, 14.44 ± 6.52% 24.78 ± 8.14%, and 25.34 ± 4.23, respectively) than fish fed with the CF. Feed supplemented with 0.1% of the C. maltaromaticum environmental probiotic strain significantly (p < 0.05) decreased the intra-group coefficient of variation of body weight (CVBW) in both the CG and EG. As a result, the mean values of CVWB were determined at 1.34 ± 0.16 in the CG and 1.20 ± 0.13 in the EG, and the difference was statistically significant (p < 0.05). The addition of the C. maltaromaticum probiotic isolate to the Aller Gold feed significantly (p < 0.05) influenced the FCR, specific growth rate (SGR), viscerosomatic index (VSI), and the final condition factor (Kf). In fish fed with the EF, the values of SGR, VSI, and Kf increased (by 13.77 ± 0.04%, 9.00 ± 1.89%, and 4.14 ± 0.53%, respectively), whereas FCR decreased (by 16.14 ± 0.05%) in comparison with fish fed with the CF.
The addition of the C. maltaromaticum probiotic isolate to the fish diets also significantly (p < 0.05) influenced the apparent digestibility coefficients of protein (PAD), lipid (LAD), ash (AAD), and NFE (ADNFE) (Table 2). In the EG fish receiving the Aller Gold feed with 0.1% addition of the probiotic bacteria, the values of the digestibility coefficients increased by 3.29 ± 0.31%, 1.00 ± 0.09%, 1.01 ± 0.07, and 5.13 ± 0.35, respectively, relative to the CG fish whose diets were not supplemented (Table 2).

3.2. Counts of Potentially Pathogenic Microbiota in the Digestive Tract and the Skin of Fish

Microbial counts in the digestive tract and skin samples ranged from 100 to 108 cfu g−1, depending on the sampling date (first or last day of the experiment) and the fish group (control or experimental). The EF containing 0.1% of the probiotic isolate affected the counts of potentially pathogenic bacteria in both the digestive tract and skin samples (Figure 2A,B). The counts of hemolytic bacteria (TCHMB), P. fluorescens, A. hydrophila, Staphylococcus spp., and Clostridium spp. were significantly reduced (ANOVA; p < 0.05) in the digestive tract and the skin of fish fed with the EF in comparison with juvenile rainbow trout fed with the CF (without 0.1% addition of C. maltaromaticum). On the last day of the experiment (day 56), C. maltaromaticum and TCMB counts in the digestive tract and the skin of the EG fish increased significantly (ANOVA; p < 0.05) relative to the first day of the experiment (day 0) (Figure 2A,B).
An analysis of the quantitative and qualitative composition of microbiota in the CF and EF revealed significant differences (ANOVA; p < 0.05; n = 14) in the microbial counts (4 to 6 orders of magnitude) between the examined feeds (Table 3).
The statistical analysis confirmed that the 0.1% addition of C. maltaromaticum (6.5 × 108 cfu g−1) to the EF influenced the microbial counts in the digestive tract of the EG fish. The correlation analysis revealed significant positive correlations (p < 0.001–p < 0.05) between the probiotic isolate counts in the EF and in the digestive tract and skin samples (Table 4). The counts of C. maltaromaticum in the EF and the samples of the digestive tract and skin were negatively correlated (p < 0.001–p < 0.05) with the counts of the most potentially pathogenic bacteria in fish.

3.3. Correlations between Feed Rearing Parameters, the Apparent Digestibility Coefficients of Crude Protein, Crude Fat, Crude Ash, Nfe, and Digestive Tract Microbiota

The PCA confirmed that the 0.1% addition of C. maltaromaticum to the EF had a positive effect on the fish rearing parameters and apparent nutrient digestibility (PAD, LAD, AAD, NFEAD). Carnobacterium maltaromaticum counts in the digestive tract contents were bound by significant positive correlations (p < 0.05; n = 45) with the values of Bg, BWg, BWf, Bf, DGR, SGR, and Kf. The values of FCR and CVBW were negatively correlated (p < 0.05) with C. maltaromaticum counts in the digestive tract contents and the EF (Figure 3). The apparent digestibility analysis revealed that the C. maltaromaticum counts in the digestive tract contents were bound by a significant positive correlation (p < 0.05; n = 45) with PAD and LAD values (Figure 3).

4. Discussion

This study demonstrated that the supplementation of the CF with 0.1% of the C. maltaromaticum environmental probiotic strain significantly improved the rearing parameters of the juvenile rainbow trout in RAS. In the EG fish, the probiotic supplement induced a significant increase (Mann–Whitney U test; p < 0.05) in final body weight (BWf), body weight gain (BWg), daily growth rate (DGR), specific growth rate (SGR), condition factor (Kf), and the viscerosomatic index (VSI) in comparison with the CG fish fed with the CF without supplementation. The EF significantly decreased the FCR. The PCA confirmed the presence of significant correlations between fish rearing parameters and C. maltaromaticum counts. In the present study, the supplementation of fish feed with the C. maltaromaticum environmental probiotic strain had no significant impact on the coefficient of variation of the final body weight (CVBW). The CVBW decreased in the EG on successive days of the experiment, which could suggest that rainbow trout do not exhibit strong stock domination or hierarchy [49].
Higher values of DGR, SGR, and FCR in fish fed with the EF validate the hypotheses postulating that the optimization of the ingredient composition of fish diets and feed rations maximizes feed utilization for growth and other activities, and improves fish welfare [50,51,52,53,54]. The presence of probiotic microorganisms in fish feed improves rearing parameters, and their beneficial influence is determined by the type of isolate, the applied dose, the fish species, the stage of development, and the type of feed [55]. The results of the present study confirm these observations. The values of BWg, DRG, and SGR increased (by approx. 25%, 26%, and 14%, respectively), whereas the FCR decreased (by approx. 17%) in the EG fish receiving feed supplemented with 0.1% of C. maltaromaticum. Merrifield et al. [21] reported an increase in the SGR values (from 2.01 to 2.15% day−1) and a decrease in the FCR values (from 0.98 to 0.93) in an experiment investigating the effect of feed supplemented with probiotics (Bacillus subtilis, B. licheniformis, and Enterococcus faecium) on rainbow trout. In turn, Bagheri et al. [56] found that feed containing B. licheniformis and B. subtilis improved the FCR (from 1.00 to 0.85), DGR (from 3.30 to 3.80 g day−1), and modulated gut microbiota in rainbow trout fry. In a study by Mohapatra et al. [22], the FCR values decreased by around 35% in Labeo rohita fry receiving feed with the addition of B. subtilis, Lactococcus lactis, and Saccharomyces cerevisiae in comparison with fish whose diets were not supplemented. A rearing experiment involving Songpu mirror carp and catfish (Clarias spp.) demonstrated that a B. megaterium-coated diet increased the weight gains (BWg) and SGR values, and reduced the FCR, which suggests that these strains can promote fish growth [57,58].
The supplementation of the CF with 0.1% of the C. maltaromaticum environmental probiotic strain significantly improved apparent nutrient digestibility. The examined probiotic isolate significantly increased (p < 0.05) the apparent digestibility of crude protein (PAD), crude fat (LAD), and NFE (NFEAD) in the EF (by more than 3%, 1%, and 5%, respectively) relative to the CF. The PCA confirmed that the probiotic isolate improved the apparent nutrient digestibility, and it revealed significant correlations (PCA; p < 0.05) between the apparent digestibility coefficients of protein and fat vs. C. maltaromaticum counts in the Aller Gold feed. Similar results were reported by Sahandi et al. [59], who observed that feed supplementation with Bifidobacterium spp. bacteria increased the apparent digestibility coefficients of crude protein and crude fat (from 98.00% to 98.50%, and from 98.50% to 99.50%, respectively). In a rearing experiment involving Labeo rohita fingerlings (6.0 ± 0.06 g), Mohapatra et al. [22] found that a diet supplemented with Bacillus subtilis, Lactococcus lactis, and Saccharomyces cerevisiae probiotic isolates improved growth, protein efficiency ratio, nutrient retention, and digestibility. In the present study, the supplementation of the CF with 0.1% of C. maltaromaticum improved the EF conversion by stimulating nutrient digestibility [23,60,61]. Nutrient digestibility can be improved by including the enzymes produced by feed probiotic bacteria in the pool of digestive enzymes in the gastrointestinal tract of fish [62,63]. An increase in the activity of digestive enzymes (amylase, lipase, protease, trypsin) and growth factors (vitamins, fatty acids, amino acids), which are produced by gut microbiota, improves nutrient digestibility and absorption. Improved digestion is associated with better feed conversion [22,23,64,65], and it delivers indirect environmental benefits by reducing the volume of organic waste and decreasing the concentration of biogenic compounds in water, which is a particularly important consideration in RAS [66,67,68].
The results of the microbiological analyses revealed that C. maltaromaticum bacteria (added to the EF at a concentration of 6.5 × 108 cfu g−1) significantly influenced microbial counts in the digestive tract and skin samples and in feed supplemented with this probiotic isolate. Significant positive relationships (p < 0.05) were noted between C. maltaromaticum counts in the EF and in samples of the digestive tract contents and skin. The concentrations of the probiotic isolate in the EF and in samples of the digestive tract contents and skin were negatively correlated (p < 0.05) with the counts of hemolytic bacteria (TCHMB), P. fluorescens, A. hydrophila, Staphylococcus spp., and Clostridium spp. At the end of the experiment, the counts of potentially pathogenic bacteria (excluding TCMB) in the digestive tract contents and skin of the EG fish decreased significantly (ANOVA; p < 0.05) relative to the CG fish. A decreasing trend (several orders of magnitude) in the total counts of potentially pathogenic bacteria was also noted in the EF supplemented with 0.1% of C. maltaromaticum relative to the CF. It should be noted that under controlled farming conditions in RAS, feed is the main source of biogenic compounds and microorganisms, and its microbiological quality directly affects the qualitative and quantitative composition of the gut microbiota in fish [18,19,57,69]. In turn, feed microorganisms indirectly influence the microbiota colonizing the water, skin, gills, eyes, and other anatomical structures in the fish [47,70]. Kim and Austin [71] and Zhang et al. [72] also reported that the C. maltaromaticum environmental probiotic strain exerted antagonistic effects against Aeromonas salmonicida, A. hydrophila, Streptococcus iniae, Vibrio anguillarum, Serratia spp., Pseudomonas spp., and Bacillus spp. bacteria. The counts of V. anguillarum A. salmonicida V. ordalii, and Y. ruckeri were also considerably reduced in the intestinal contents and skin mucus of salmonids when the C. maltaromaticum isolate was introduced to aquaculture [73,74]. Fish skin mucus is a biological reservoir of various immune molecules (lysozyme, proteins, immunoglobulins, enzymes, lectins, etc.), and it is a defense barrier against foreign particles, pathogens, and toxins [75]. Probiotics stimulate goblet cells in the epidermis by producing nutrients such as short-chain fatty acids, vitamins, and minerals, which enhance the secretion of antibacterial agents. Similar observations were made by Farsani et al. [76], who found that diets supplemented with L. acidophilus and B. bifidum significantly increased lysozyme levels in fish skin mucus.
According to the literature [77,78], C. maltaromaticum can be a fish pathogen. In most described instances, C. maltaromaticum exerted pathological effects only on severely stressed fish, for example during spawning. In the present study, feed supplementation with this probiotic isolate did not compromise fish welfare parameters (swimming behavior, feeding behavior, skin and fin damage) during experimental rearing of juveniles in RAS. In this study, the C. maltaromaticum environmental probiotic strain exerted antagonistic effects against a broad range of potentially pathogenic bacteria, including TCHMB, P. fluorescens, A. hydrophila, Streptococcus sp., and Clostridium spp., which validates other authors’ observations that this bacterial species is an effective biocontrol agent in aquaculture [18,79]. The EF supplemented with the analyzed probiotic isolate significantly improved the rainbow trout rearing parameters and apparent nutrient digestibility (protein, lipid, and NFE), and it contributed to the microbial safety of the juvenile rainbow trout. The C. maltaromaticum environmental probiotic strain effectively reduced and controlled the growth of pathogenic microorganisms, which is particularly important in the production of juvenile fish that are least resistant to the harmful effects of opportunistic and pathogenic microorganisms. The results of this study indicated that feed supplementation with the C. maltaromaticum environmental probiotic strain exerted a positive effect on juvenile rainbow trout, and they provide valuable inputs for future research into the isolate’s influence on other developmental stages of rainbow trout, as well as other species of farmed fish.

5. Conclusions

This study demonstrated that the C. maltaromaticum environmental probiotic strain is a biological growth stimulator that enhances the microbial safety of juvenile rainbow trout in RAS. During a 56-day rearing experiment, the EF (Aller Gold supplemented with 0.1% of C. maltaromaticum) significantly influenced (p < 0.05) rearing parameters, apparent nutrient digestibility (protein, lipids, ash, and NFE), as well as the counts of potentially pathogenic bacteria in the digestive tract contents and the skin of fish.
In fish receiving the EF with the addition of the probiotic isolate, final body weights (BWf) and body weight gains (BWg) increased by 14.44%; daily growth rate (DGR) increased by 25.34%; specific growth rate (SGR) increased by 13.77%; the viscerosomatic index (VSI) increased by 9.00%; and the final condition factor (Kf) increased by 4.14% relative to fish fed with the CF. The apparent digestibility coefficients of protein, fat, ash, and NFE increased significantly by 3.29%, 1.00%, 1.01%, and 5.13%, respectively, in fish receiving the EF supplemented with 0.1% of C. maltaromaticum. The counts of potentially pathogenic bacteria (TCHMB, P. fluorescens, A. hydrophila, Staphylococcus spp., and Clostridium spp.) were also significantly reduced (102–106) in the digestive tract contents and the skin of juvenile rainbow trout, as well as in the EF.
The results of this study indicate that feed supplementation with the C. maltaromaticum environmental probiotic strain exerts a positive effect on juvenile rainbow trout, and they pave the way for future research into the isolate’s influence on other developmental stages of rainbow trout, as well as other species of farmed fish.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani12233321/s1, Table S1: The identification of an environmental strain of Carnobacterium maltaromaticum bacteria based on 16S rDNA sequence analysis.

Author Contributions

Conceptualization, I.G. and J.A.P.; methodology, I.G. and J.A.P.; software, I.G.; validation, I.G. and J.A.P.; formal analysis, J.A.P.; investigation, I.G. and J.A.P.; resources, I.G. and J.A.P.; data curation, I.G. and J.A.P.; writing: original draft preparation, J.A.P.; writing: review and editing, I.G.; visualization, J.A.P.; supervision, I.G.; project administration, I.G. and J.A.P.; funding acquisition, I.G. and J.A.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The animal study was approved by the Local Ethical Committee for Animal Experiments in Olsztyn (LKE/34/2022) of University of Warmia and Mazury in Olsztyn, Poland.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The project was financially supported by the Minister of Education and Science under the program entitled “Regional Initiative of Excellence” for the years 2019–2023, Project No. 010/RID/2018/19, amount of funding PLN 12 000 000. This study was co-supported by research grants No. 18.610-004-300 and No. 18.610.001-300 from the Ministry of Science and Higher Education (Poland).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAO (Food and Agriculture Organization of the United Nations). The State of World Fisheries and Aquaculture; FAO: Rome, Italy, 2020; Available online: http://www.fao.org/documents/card/en/c/ca9229en (accessed on 10 August 2022).
  2. EUMOFA (European Market Observatory for Fisheries and Aquaculture). Products—Portion Trout in the EU. 2021. Available online: https://www.eumofa.eu/documents/20178/474612/PTAT+Portion+trout+in+PL+DE+IT_EN.pdf/4f9b95b8-5a26-95b4-ac6bc735f2668159?t=1635330900589 (accessed on 8 August 2022).
  3. EUMOFA (European Market Observatory For Fisheries and Aquaculture). Recirculating Aquaculture Systems. 2020. Available online: https://www.eumofa.eu/documents/20178/84590/RAS+in+the+EU.pdf (accessed on 8 August 2022).
  4. Zakęś, Z.; Partyka, K. The applicability of recirculating aquaculture systems in the production of fish fry for lake stocking. In Sustainable Use and Condition of Fishery Resources in 2012; Mickiewicz, M., Ed.; Publishing House of the Institute of Inland Fisheries: Olsztyn, Poland, 2013; pp. 103–115. (In Polish) [Google Scholar]
  5. Docan, A.; Dediu, L.; Cristea, V. Effect of feeding with different dietary protein level on hematological indices of juvenile Siberian sturgeon, Acipenser baeri reared under recirculating systems conditio. Aquac. Aquar. Conserv. Legis. 2011, 4, 180–186. [Google Scholar]
  6. Demska-Zakęś, K.; Zakeś, Z.; Ziomek, E.; Jarmołowicz, S. Impact of feeding juvenile tench (Tinca tinca (L.)) feeds supplemented with vegetable oils on hematological indexes and liver histology. Arch. Pol. Fish. 2012, 20, 67–75. [Google Scholar] [CrossRef] [Scilit]
  7. Akrami, R.; Gharaei, A.; Karami, R. Age and sex specific variation in hematological and serum biochemical parameters of Beluga (Huso huso Linnaeus, 1758). Int. J. Aquat. Biol. 2013, 1, 132–137. [Google Scholar] [CrossRef]
  8. Ingerslev, H.-C.; von Gersdorff Jørgensen, L.; Strube, M.L.; Larsen, N.; Dalsgaard, I.; Boye, M.; Madsen, L. The development of the gut microbiota in rainbow trout (Oncorhynchus mykiss) is affected by first feeding and diet type. Aquaculture 2014, 424–425, 24–34. [Google Scholar] [CrossRef] [Scilit]
  9. Pedrotti, F.S.; Davies, S.; Merrifield, D.; Marques, M.R.F.; Fraga, A.P.M.; Mouriño, J.L.P.; Fracalossi, D.M. The autochthonous microbiota of the freshwater omnivores jundiá (Rhamdia quelen) and tilapia (Oreochromis niloticus) and the effect of dietary carbohydrates. Aquac. Res. 2015, 46, 472–481. [Google Scholar] [CrossRef] [Scilit]
  10. Ringø, E.; Zhou, Z.; Vecino, J.L.G.; Wadsworth, S.; Romero, J.P.; Krogdahl, A.; Olsen, R.; Dimitroglou, A.; Foey, A.; Davies, S.G.; et al. Effect of dietary components on the gut microbiota of aquatic animals. A never-ending story? Aquac. Nutr. 2016, 22, 219–282. [Google Scholar] [CrossRef] [Scilit]
  11. Tarnecki, A.; Burgos, F.; Ray, C.; Arias, C. Fish intestinal microbiome: Diversity and symbiosis unravelled by metagenomics. J. Appl. Microbiol. 2017, 123, 2–17. [Google Scholar] [CrossRef] [Scilit]
  12. Terech-Majewska, E.; Pajdak, J.; Siwicki, A.K. Water as a source of macronutrients and micronutrients for fish, with special emphasis on the nutritional requirements of two fish species: The common carp (Cyprinus carpio) and the rainbow trout (Oncorhynchus mykiss). J. Elem. 2016, 21, 947–961. [Google Scholar] [CrossRef] [Scilit]
  13. Reverter, M.; Sarter, S.; Caruso, D.; Avarre, J.-C.; Combe, M.; Pepey, E.; Pouyaud, L.; Vega-Heredía, S.; de Verdal, H.; Gozlan, R.E. Aquaculture at the crossroads of global warming and antimicrobial resistance. Nat. Commun. 2020, 11, 1870. [Google Scholar] [CrossRef] [Scilit]
  14. Gołaś, I.; Szmyt, M.; Glińska-Lewczuk, K. Water as a source of indoor air contamination with potentially pathogenic Aeromonas hydrophila in aquaculture. Int. J. Environ. Res. Public Health 2022, 19, 2379. [Google Scholar] [CrossRef] [Scilit]
  15. Hill, C.; Guarner, F.; Reid, G.; Gibson, G.R.; Merenstein, D.J.; Pot, B.; Morelli, L.; Canani, R.B.; Flint, H.J.; Salminen, S.; et al. Expert consensus document: The International Scientific Association for Probiotics and Prebiotics consensus statement on the scope and appropriate use of the term probiotic. Nat. Rev. Gastroenterol. Hepat. 2014, 11, 506–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Terech-Majewska, E. Improving disease prevention and treatment in controlled fish culture. Arch. Pol. Fish. 2016, 24, 115–165. [Google Scholar] [CrossRef] [Scilit]
  17. Kazuń, B.; Kazuń, K.; Siwicki, A.K.; Żylińska, J. In vitro study of Lactobacillus plantarum properties as a potential probiotic strain and an alternative method to antibiotic treatment of fish. Fish. Aquat. Life 2018, 26, 47–55. [Google Scholar] [CrossRef] [Scilit]
  18. Balcazar, J.L.; de Blas, I.; Ruiz-Zarzuela, I.; Cunningham, D.; Vendrell, D.; Calvo, A.C.; Marquez, I. The role of probiotics in aquaculture. Vet. Microbiol. 2006, 114, 173–186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Balcazar, J.L.; de Blas, I.; Ruiz-Zarzuela, I.; Vendrell, D.; Calvo, A.C.; Marquez, I.; Girones, O.; Muzquiz, J.L. Changes in intestinal microbiota and humoral immune response following probiotic administration in brown trout (Salmo trutta). Br. J. Nutr. 2007, 97, 522–527. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Kim, D.H.; Kang, K.; Hae Kyung, C.; Jisoon, I.; Kwisung, P. Carnobacterium isolated from caviar of sturgeon (Acipenser ruthenus) farmed in Korea. J. Bacteriol. Virol. 2015, 45, 151–154. [Google Scholar] [CrossRef] [Scilit]
  21. Merrifield, D.L.; Dimitroglou, A.; Bradley, G.; Baker, R.T.M.; Davies, S.J. Probiotic applications for rainbow trout (Oncorhynchus mykiss Walbaum) I. Effects on growth performance, feed utilization, intestinal microbiota and related health criteria. Aquac. Nutr. 2010, 16, 504–510. [Google Scholar] [CrossRef] [Scilit]
  22. Mohapatra, S.; Chakraborty, T.; Prusty, A.K.; Das, P.; Paniprasad, K.; Mohanta, K.N. Use of different microbial probiotics in the diet of Rohu, Labeo rohita fingerling: Effects on growth, nutrient digestibility and retention, digestive enzyme activities and intestinal microflora. Aquac. Nutr. 2012, 18, 1–11. [Google Scholar] [CrossRef] [Scilit]
  23. Mohapatra, S.; Chakraborty, T.; Kuma, V.; DeBoeck, G.; Mohanta, K.N. Aquaculture and stress management: A review of probiotic intervention. J. Anim. Physiol. Anim. Nutr. 2013, 97, 405–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Mamun, M.A.A.; Nasren, S.; Bari, S.M. Role of probiotics in aquaculture: Importance and future guidelines. J. Bangladesh Acad. Sci. 2018, 42, 105–109. [Google Scholar] [CrossRef] [Scilit]
  25. Kim, D.H.; Austin, B. Characterization of probiotic carnobacteria isolated from rainbow trout (Oncorhynchus mykiss) intestine. Lett. Appl. Microbiol. 2008, 47, 141–147. [Google Scholar] [CrossRef] [Scilit]
  26. Ringø, E. The ability of carnobacteria isolated from fish intestine to inhibit growth of fish pathogenic bacteria: A screening study. Aquac. Res. 2008, 39, 171–180. [Google Scholar] [CrossRef] [Scilit]
  27. Iskandar, C.F.; Borges, F.; Taminiau, B.; Daube, G.; Zagorec, M.; Remenant, B.; Leisner, J.J.; Hansen, M.A.; Sørensen, S.J.; Mangavel, C.; et al. Comparative genomic analysis reveals ecological differentiation in the genus Carnobacterium. Front. Microbiol. 2017, 8, 357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Yukgehnaish, K.; Kumar, P.; Sivachandran, P.; Marimuthu, K.; Arshad, A.; Paray, B.A.; Arockiaraj, J. Gut microbiota metagenomics in aquaculture: Factors influencing gut microbiome and its physiological role in fish. Rev. Aquac. 2020, 12, 1–25. [Google Scholar] [CrossRef] [Scilit]
  29. Pikuta, E.V.; Hoover, R.B. The genus Carnobacterium. In Lactic Acid Bacteria: Biodiversity and Taxonomy; Holzapfel, W.H., Wood, B.J.B., Eds.; Wiley Blackwell: Chichester, UK, 2014; pp. 109–123. [Google Scholar] [CrossRef] [Scilit]
  30. Iwashita, Y.; Suzuki, N.; Yamamoto, T.; Shibata, J.; Isokawa, K.; Soon, A.H.; Ikehata, Y.; Furuita, H.; Sugita, T. Supplemental effect of cholyltaurine and soybean lecithin to a soybean meal-based fish meal-free diet on hepatic and intestinal morphology of rainbow trout Oncorhynchus mykiss. Fish Sci. 2008, 74, 1083–1095. [Google Scholar] [CrossRef] [Scilit]
  31. Potorski, J.A. An Evaluation of the Potential of the Carnobacterium maltaromaticum Probiotic Strain in Rearing Selected Fish Species. Ph.D. Dissertation, UWM, Olsztyn, Poland, 2022. (In Polish) [Google Scholar]
  32. NRC (National Research Council). Nutrient Requirements of Fish and Shrimp; The National Academies Press: Washington, DC, USA, 2011. [Google Scholar] [CrossRef] [Scilit]
  33. Goryczko, K.; Grudniewska, J.C. Rainbow Trout Breeding and Rearing; Publishing House of the Institute of Inland Fisheries: Olsztyn, Poland, 2015; pp. 97–145. (In Polish) [Google Scholar]
  34. Niewiadomski, P.; Gomułka, P.; Poczyczyński, P.; Woźniak, M.; Szmyt, M. Dietary effect of supplementation with amaranth meal on growth performance and apparent digestibility of rainbow trout Oncorhynchus mykiss. Pol. J. Nat. Sci. 2016, 31, 459–469. [Google Scholar]
  35. Popovic, N.; Strunjak-Perovic, I.; Coz-Rakovac, R.; Barisic, J.; Jadan, M.; Persin-Berakovic, A.; Klobucar, S.R. Tricaine methane-sulfonate (MS-222) application in fish anaesthesia. J. Appl. Ichthyol. 2012, 28, 553–564. [Google Scholar] [CrossRef] [Scilit]
  36. Gillan, D.C.; Speksnijder, A.; Zwart, G.; De Ridder, C. Genetic diversity of the biofilm covering Montacuta ferruginosa (Mollusca, Bivalvia) as evaluated by denaturing gradient gel electrophoresis analysis and cloning of PCR-amplified gene fragments coding for 16S rRN. Appl. Environ. Microbiol. 1998, 64, 3464–3472. [Google Scholar] [CrossRef] [Scilit]
  37. NCBI (National Center for Biotechnology Information, U.S.). National Library of Medicine. Available online: http://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 10 April 2017).
  38. Potorski, J.A.; Gołaś, I. The effect of Carnobacterium maltaromaticum probiotic bacteria on commercial fish feed heterothropic microbiota. Fish. Commun. 2018, 4, 1–5. (In Polish) [Google Scholar]
  39. Gołaś, I.; Potorski, J.A.; Woźniak, M.; Niewiadomski, P.; Aguilera-Arreola, M.G.; Contreras-Rodríguez, A.; Gotkowska-Płachta, A. Amaranth meal and environmental Carnobacterium maltaromaticum probiotic bacteria as novel stabilizers of the microbiological quality of compound fish feeds for aquaculture. Appl. Sci. 2020, 10, 5114. [Google Scholar] [CrossRef] [Scilit]
  40. AOAC (Association of Official Analytical Chemists). Official Methods of Analysis of Aoac International, Agricultural Chemicals, Contaminants, Drugs, Vol. 1; Aoac Intl: Arlington, VA, USA, 2000. [Google Scholar]
  41. Shearer, K.D. Factors affecting the proximate composition of cultured fishes with emphasis on salmonids. Aquaculture 1994, 119, 63–88. [Google Scholar] [CrossRef] [Scilit]
  42. Furukawa, A.; Tsukahara, H. On the acid digestion method for the determination of chromic oxide as an index substance in the study of digestibility of fish feed. Bull. Jpn. Soc. Sci. Fish. 1966, 32, 502–506. [Google Scholar] [CrossRef] [Scilit]
  43. Maynard, L.A.; Loosli, J.K.; Hintz, H.F.; Warner, R.K. Animal Nutrtion; McGraw-Hill Book Co.: New York, NY, USA, 1979; Volume IX, p. 602. [Google Scholar]
  44. PN-A 86730:1989; Fish and Fish Products. Microbiological Requirements and Analyses. Polish Standard: Warsaw, Poland, 1989.
  45. PN-R-64791:1994; Animal Feeds. Microbiological Requirements and Analyses. Polish Standard: Warsaw, Poland, 1994.
  46. Gołaś, I. The influence of aquaculture effluents on the prevalence and biocides resistance of opportunistic Pseudomonas fluorescens bacteria in the Drwęca river protected under the Natura 2000 Network. Water 2020, 12, 1947. [Google Scholar] [CrossRef] [Scilit]
  47. Gołaś, I.; Szmyt, M.; Potorski, J.; Łopata, M.; Gotkowska-Płachta, A.; Glińska-Lewczuk, K. Distribution of Pseudomonas fluorescens and Aeromonas hydrophila bacteria in a recirculating aquaculture system during farming of european grayling (Thymallus thymallus L.) broodstock. Water 2019, 11, 376–391. [Google Scholar] [CrossRef] [Scilit]
  48. Ter Braak, C.J.F.; Šmilauer, P. CANOCO Reference Manual and CanoDraw for Windows User’s Guide, Software for Canonical Community Ordination, Version 4.5; Microcomputer Power: New York, NY, USA, 2002; 500p. [Google Scholar]
  49. Jobling, M.; Koskela, J. Interindividual variations in feeding and growth in rainbow trout during restricted feeding and in a subsequent period of compensatory growth. J. Fish Biol. 1996, 49, 658–667. [Google Scholar] [CrossRef]
  50. Sevgili, H.; Hossu, B.; Emre, Y.; Kanyılmaz, M. Compensatory growth following various time lengths of restricted feeding in rainbow trout (Oncorhynchus mykiss) under summer conditions. J. Appl. Ichthyol. 2013, 29, 1330–1336. [Google Scholar] [CrossRef] [Scilit]
  51. Oberg, E.W.; Faulk, C.K.; Fuiman, L.A. Optimal dietary ration for juvenile pigfish, Orthopristis chrysoptera, growth. Aquaculture 2014, 433, 335–339. [Google Scholar] [CrossRef] [Scilit]
  52. Lee, S.; Haller, L.Y.; Fangue, N.A.; Fadel, J.G.; Hung, S.S.O. Effects of feeding rate on growth performance and nutrient partitioning of young-of-the-year white sturgeon (Acipenser transmontanus). Aquac. Nutr. 2016, 22, 400–409. [Google Scholar] [CrossRef] [Scilit]
  53. Imtiaz, A. Effects of feeding levels on growth performance, feed utilization, body composition, energy and protein maintenance requirement of fingerling, rainbow trout, Oncorhynchus mykiss (Walbaum, 1792). Iran. J. Fish. Sci. 2018, 17, 745–762. [Google Scholar] [CrossRef]
  54. Trenzado, C.E.; Carmona, R.; Merino, R.; García-Gallego, M.; Furné, M.; Domezain, A.; Sanz, A. Effect of dietary lipid content and stocking density on digestive enzymes profile and intestinal histology of rainbow trout (Oncorhynchus mykiss). Aquaculture 2018, 497, 10–16. [Google Scholar] [CrossRef] [Scilit]
  55. Suguna, T. Role of probiotics in aquaculture. Int. J. Curr. Microbiol. App. Sci. 2020, 9, 143–149. [Google Scholar] [CrossRef] [Scilit]
  56. Bagheri, T.; Hedayati, S.A.; Yavari, V.; Alizade, M.; Farzanfar, A. Growth, survival and gut microbial load of rainbow trout (Oncorhynchus mykiss) fry given diet supplemented with probiotic during the two months of first feeding. Turk. J. Fish. Aquat. Sci. 2008, 8, 43–48. [Google Scholar]
  57. Afrilasari, W.; Meryandini, A. Effect of probiotic Bacillus megaterium PTB 1.4 on the population of intestinal microflora, digestive enzyme activity and the growth of catfish (Clarias sp.). HAYATI J. Biosci. 2016, 23, 168–172. [Google Scholar] [CrossRef] [Scilit]
  58. Luo, L.; Xu, Q.; Xu, W.; Li, J.; Wang, C.; Wang, L.; Zhao, Z. Effect of Bacillus megaterium-coated diets on the growth, digestive enzyme activity, and intestinal microbial diversity of Songpu mirror carp Cyprinus specularis Songpu. Biomed. Res. Int. 2020, 8863737. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Sahandi, J.; Jafaryan, H.; Soltani, M.; Ebrahimi, P. The use of two Bifidobacterium strains enhanced growth performance and nutrient utilization of rainbow trout (Oncorhynchus mykiss) fry. Probiotics Antimicrob. Proteins. 2019, 11, 966–972. [Google Scholar] [CrossRef] [Scilit]
  60. Dawood, M.A.O.; Koshio, S.; Ishikawa, M.; El-Sabagh, M.; Esteban, M.A.; Zaineldin, A.I. Probiotics as an environment-friendly approach to enhance red sea bream, Pagrus major growth, immune response and oxidative status. Fish Shellfish Immunol. 2016, 57, 170–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Ramos, M.A.; Batista, S.; Pires, M.A.; Silva, A.P.; Pereira, L.F.; Saavedra, M.J.; Ozório, R.O.A.; Rema, P. Dietary probiotic supplementation improves growth and the intestinal morphology of Nile tilapia. Animals 2017, 11, 1259–1269. [Google Scholar] [CrossRef] [Scilit]
  62. De Schrijver, R.; Ollevier, F. Protein digestion in juvenile turbot (Scophthalmus maximus) and effects of dietary administration of Vibrio proteolyticus. Aquaculture 2000, 186, 107–116. [Google Scholar] [CrossRef] [Scilit]
  63. Banerjee, G.; Nandi, A.; Ray, A.K. Assessment of hemolytic activity, enzyme production and bacteriocin characterization of Bacillus subtilis LR1 isolated from the gastrointestinal tract of fish. Arch. Microbiol. 2017, 199, 115–124. [Google Scholar] [CrossRef] [Scilit]
  64. Askarian, F.; Zhou, Z.; Olsen, R.E.; Sperstad, S.; Ringø, E. Culturable autochthonous gut bacteria in Atlantic salmon (Salmo salar L.) fed diets with or without chitin. Characterization by 16S rRNA gene sequencing, ability to produce enzymes and in vitro growth inhibition of four pathogens. Aquaculture 2012, 1–8, 326–329. [Google Scholar] [CrossRef] [Scilit]
  65. Bøgwald, J.; Dalmo, R.A. Gastrointestinal pathogenesis in aquatic animals. In Aquaculture Nurition: Gut Health, Probiotics and Prebiotics; Merrifield, D., Ringø, E., Eds.; Wiley-Blackwell Publishing: Oxford, UK, 2014; pp. 53–74. [Google Scholar] [CrossRef] [Scilit]
  66. Sahu, M.K.; Swarnakumar, N.S.; Sivakumar, K.; Thangaradjou, T.; Kannan, L. Probiotics in aquaculture: Importance and future perspectives. Indian J. Microbiol. 2008, 48, 299–308. [Google Scholar] [CrossRef] [PubMed]
  67. Wang, Y.M.; Wang, Y.G. Advance in the mechanisms and application of microecologics in aquaculture. Prog. Vet. Med. 2008, 29, 72–75. [Google Scholar]
  68. Das, S.; Mondal, K.; Haque, S.A. Review on application of probiotic, prebiotic and synbiotic for sustainable development of aquaculture. J. Entomol. Zool. Stud. 2017, 5, 422–429. [Google Scholar]
  69. Krause, J.; Zmysłowska, I.; Gołaś, I.; Harnisz, M. Bacteriological contamination of sturgeon hybrid, fodder and water in intensive tank rearing. Acta Univ. Nicolai Copernici. Pr. Limnol. 2007, 2, 83–89. [Google Scholar] [CrossRef] [Scilit]
  70. Pastorino, P.; Colussi, S.; Pizzul, E.; Varello, K.; Menconi, V.; Mugetti, D.; Tomasoni, M.; Esposito, G.; Bertoli, M.; Bozzetta, E.; et al. The unusual isolation of carnobacteria in eyes of healthy salmonids in high-mountain lakes. Sci. Rep. 2021, 11, 2314. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  71. Kim, D.H.; Austin, B. Innate immune responses in rainbow trout (Oncorhynchus mykiss, Walbaum) induced by probiotics. Fish Shellfish Immunol. 2006, 21, 513–524. [Google Scholar] [CrossRef] [Scilit]
  72. Zhang, P.; Baranyi, J.; Tamplin, M. Interstrain interactions between bacteria isolated from vacuum-packaged refrigerated beef. Appl. Environ. Microbiol. 2015, 81, 2753–2761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  73. Jöborn, A.; Olsson, J.C.; Westerdahl, A.; Conway, P.L.; Kjelleberg, S. Colonization in the fish intestinal tract and production of inhibitory substances in intestinal mucus and faecal extracts by Carnobacterium sp. J. Fish Dis. 1997, 20, 383–392. [Google Scholar] [CrossRef] [Scilit]
  74. Robertson, P.A.W.; O’Dowd, C.; Burrells, C.; Williams, P.; Austin, B. Use of Carnobacterium sp. as a probiotic for Atlantic salmon (Salmo salar L.) and rainbow trout (Oncorhynchus mykiss, Walbaum). Aquaculture 2000, 185, 235–243. [Google Scholar] [CrossRef] [Scilit]
  75. Salinas, I.; Magadán, S. Omics in fish mucosal immunity. Dev. Comp. Immunol. 2017, 75, 99–108. [Google Scholar] [CrossRef] [Scilit]
  76. Farsani, M.N.; Meshkini, S.; Manaffar, R. Growth performance, immune response, antioxidant capacity and disease resistance against Yersinia ruckeri in rainbow trout (Oncorhynchus mykiss) as influenced through singular or combined consumption of resveratrol and two-strain probiotics. Aquac. Nutr. 2021, 27, 2587–2599. [Google Scholar] [CrossRef] [Scilit]
  77. Leisner, J.J.; Laursen, B.G.; Prévost, H.; Drider, D.; Dalgaard, P. Carnobacterium: Positive and negative effects in the environment and in foods. FEMS Microbiol. Rev. 2007, 31, 592–613. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  78. Starliper, C.E.; Shotts, E.B.; Brown, J. Isolation of Carnobacterium piscicola and an unidentified Gram-positive bacillus from sexually mature and post-spawning rainbow trout Oncorhynchus mykiss. Dis. Aquat. Org. 1992, 13, 181–187. [Google Scholar] [CrossRef] [Scilit]
  79. Verschuere, L.; Rombaut, G.; Sorgeloos, P.; Verstraete, W. Probiotic bacteria as biological control agents in aquaculture. Microbiol. Mol. Biol. Rev. 2000, 64, 655–671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Diagram of juvenile rainbow trout rearing in a recirculating aquaculture system (RAS). Abbreviations: CG—rearing tanks stocked with control group fish; EG—rearing tanks stocked with experimental group fish; LT—lower tank, C—coil heater; A—aerators, UV—UV lamp; TF—trickling filter; WI—water inflow; WO—water outflow.
Figure 1. Diagram of juvenile rainbow trout rearing in a recirculating aquaculture system (RAS). Abbreviations: CG—rearing tanks stocked with control group fish; EG—rearing tanks stocked with experimental group fish; LT—lower tank, C—coil heater; A—aerators, UV—UV lamp; TF—trickling filter; WI—water inflow; WO—water outflow.
Animals 12 03321 g001
Figure 2. Bacterial counts (third quartile, median, standard deviation) (cfu g−1) in the digestive tract (A) and skin (B) of the control (CG) and experimental groups (EG) of juvenile rainbow trout administered Aller Gold commercial feed and the same feed supplemented with 0.1% of the Carnobacterium maltaromaticum environmental probiotic strain, respectively. The numbers marked with different superscript letters differ significantly (ANOVA; p < 0.05; n = 30). Denotations: 0 day—first day of experiment, 56 day—last day of experiment, TCMB—total counts of mesophilic bacteria; TCHMB—total counts of hemolytic mesophilic bacteria.
Figure 2. Bacterial counts (third quartile, median, standard deviation) (cfu g−1) in the digestive tract (A) and skin (B) of the control (CG) and experimental groups (EG) of juvenile rainbow trout administered Aller Gold commercial feed and the same feed supplemented with 0.1% of the Carnobacterium maltaromaticum environmental probiotic strain, respectively. The numbers marked with different superscript letters differ significantly (ANOVA; p < 0.05; n = 30). Denotations: 0 day—first day of experiment, 56 day—last day of experiment, TCMB—total counts of mesophilic bacteria; TCHMB—total counts of hemolytic mesophilic bacteria.
Animals 12 03321 g002
Figure 3. Principal component analysis (PCA) biplot of the correlations (p < 0.05) between C. maltaromaticum counts in the digestive tract (d.g.) and skin (s.) of juvenile rainbow trout vs. the experimental feed (Aller Gold supplemented with 0.1% of the Carnobacterium maltaromaticum environmental probiotic strain), rearing parameters (BWg—body weight gain, BWf—final body weight, Bf—final biomass, Bg—biomass gain, SGR—specific growth rate, Kf—final condition factor, VSI—viscerosomatic index, DGR—daily growth rate, CVBW—coefficient of variation of body weight, FCR—feed conversion ratio, HIS—hepatosomatic index), and the apparent digestibility coefficients of crude protein (PAD), crude fat (LAD), crude ash (AAD), and nitrogen-free extract (NFEAD).
Figure 3. Principal component analysis (PCA) biplot of the correlations (p < 0.05) between C. maltaromaticum counts in the digestive tract (d.g.) and skin (s.) of juvenile rainbow trout vs. the experimental feed (Aller Gold supplemented with 0.1% of the Carnobacterium maltaromaticum environmental probiotic strain), rearing parameters (BWg—body weight gain, BWf—final body weight, Bf—final biomass, Bg—biomass gain, SGR—specific growth rate, Kf—final condition factor, VSI—viscerosomatic index, DGR—daily growth rate, CVBW—coefficient of variation of body weight, FCR—feed conversion ratio, HIS—hepatosomatic index), and the apparent digestibility coefficients of crude protein (PAD), crude fat (LAD), crude ash (AAD), and nitrogen-free extract (NFEAD).
Animals 12 03321 g003
Table 1. Microbiological assays and culturing conditions (temperature and incubation time) during analyses of the digestive tract contents, skin, and feed samples.
Table 1. Microbiological assays and culturing conditions (temperature and incubation time) during analyses of the digestive tract contents, skin, and feed samples.
AssayCulture MediumTemperature and Incubation Time
Total counts of Carnobacterium
maltaromaticum bacteria
Tryptone soy agar (TSA; Oxoid, Basingstoke, UK) with the addition of 3% yeast extract and 1.5% (w/v) NaCl [25]28 °C/24 h
TCMB: total counts of mesophilic
bacteria
Tryptone soy agar (TSA; Oxoid, Basingstoke, UK)28 °C/48 h
TCHMB: total counts of hemolytic mesophilic bacteriaTryptone soy agar (TSA; Oxoid, Basingstoke, UK) with 5% addition of defibrinated sheep blood37 °C/48 h
Counts of Pseudomonas fluorescens
bacteria
King B medium (Merck KgaA, Darmstadt, Germany)28 °C/48 h
Counts of Aeromonas hydrophila
bacteria
Aeromonas Medium Base (Ryan) (Merck KgaA, Darmstadt, Germany)37 °C/24 h
Counts of Staphylococcus spp.
bacteria
Chapman medium (Merck KgaA, Darmstadt, Germany)37 °C/48 h
Counts of sulfite-reducing anaerobic spore-forming Clostridium sp. bacteriaWilson-Blair medium (Merck KgaA, Darmstadt, Germany)37 °C/18 h
Table 2. Rearing parameters and apparent nutrient digestibility in juvenile rainbow trout fed with a commercial feed (Aller Gold) and feed supplemented with 0.1% of the Carnobacterium maltaromaticum environmental probiotic strain (mean value ± SD; n = 3). The dietary treatments are described in the Materials and Methods section. Groups marked with different letters in the same row differ significantly (Mann–Whitney U test p < 0.05; n = 90).
Table 2. Rearing parameters and apparent nutrient digestibility in juvenile rainbow trout fed with a commercial feed (Aller Gold) and feed supplemented with 0.1% of the Carnobacterium maltaromaticum environmental probiotic strain (mean value ± SD; n = 3). The dietary treatments are described in the Materials and Methods section. Groups marked with different letters in the same row differ significantly (Mann–Whitney U test p < 0.05; n = 90).
ParameterJuvenile Rainbow Trout Feeding
CF 1EF 2
Initial body weight: BWi (g)44.20 ± 7.73 a44.40 ± 6.37 a
Final body weight: BWf (g)89.17 ± 11.80 a104.10 ± 12.45 b
Weight gain: BWg (g juveniles−1)44.97 ± 12.98 a59.70 ± 11.65 b
Initial biomass: Bi (kg m−3)5.30 ± 0.93 a5.33 ± 0.76 a
Final biomass: Bf (kg m−3)10.70 ± 1.42 a12.49 ± 1.49 b
Biomass gain: Bg (kg m−3)5.40 ± 1.56 a7.16 ± 1.40 b
Daily growth rate: DGR (g day−1)0.80 ± 0.23 a1.07 ± 0.21 b
Initial condition factor: Ki (%)1.18 ± 0.31 a1.19 ± 0.30 a
Final condition factor: Kf (%)1.19 ± 0.07 a1.24 ± 0.12 b
Coefficient of variation of initial body weight: CVBWi (%)18.09 ± 3.53 a14.68 ± 2.42 b
Coefficient of variation of final body weight: CVBWf (%)13.50 ± 2.05 a12.15 ± 1.64 b
CVBW = CVBWf/CVBWi1.34 ± 0.16 a1.20 ± 0.13 b
Feed conversion ratio: FCR1.06 ± 0.03 a0.89 ± 0.16 b
Specific growth rate: SGR (% day−1)1.19 ± 0.04 a1.38 ± 0.08 b
Hepatosomatic index: HSI (%)1.17 ± 2.10 a1.20 ± 0.18 a
Viscerosomatic index: VSI (%)14.56 ± 2.76 a16.00 ± 2.00 b
Apparent digestibility coefficient of crude protein: PAD (%)93.52 ± 0.49 a96.70 ± 0.20 b
Apparent digestibility coefficient of crude fat: LAD (%)95.01 ± 0.26 a95.97 ± 0.67 b
Apparent digestibility coefficient of crude ash: AAD (%)80.02 ± 0.10 a80.84 ± 0.19 b
Apparent digestibility coefficient of nitrogen-free extract: NFEAD (%)50.53 ± 0.48 a53.26 ± 0.43 b
1 commercial feed (Aller Gold); 2 experimental feed (Aller Gold with 0.1% of C. maltaromaticum).
Table 3. Bacterial counts (mean ± SD, n = 14) in juvenile rainbow trout administered commercial feed (CF) (Aller Gold) and experimental feed (EF) (Aller Gold supplemented with 0.1% of the Carnobacterium environmental probiotic strain). The numbers marked with different superscript letters differ significantly (ANOVA; p < 0.05; n = 14).
Table 3. Bacterial counts (mean ± SD, n = 14) in juvenile rainbow trout administered commercial feed (CF) (Aller Gold) and experimental feed (EF) (Aller Gold supplemented with 0.1% of the Carnobacterium environmental probiotic strain). The numbers marked with different superscript letters differ significantly (ANOVA; p < 0.05; n = 14).
BacteriaBacterial Counts (Mean ± SD) in Feed (cfu g−1)
CF 1EF 2
C. maltaromaticumn. f. 36.5 × 108 ± 4.9 × 107 b
TCMB 42.8 × 1010 ± 1.3 × 1010 a9.6 × 105 ± 4.9 × 105 b
TCHMB 55.3 × 107 ± 3.4 × 107 a1.6 × 102 ± 0.9 × 102 b
P. fluorescens4.0 × 107 ± 2.4 × 107 a1.9 × 102 ± 2.4 × 101 b
A. hydrophila3.6 × 107 ± 2.4 × 107 a8.2 × 102 ± 2.1 × 102 b
Staphylococcus spp.4.8 × 107 ± 1.3 × 107 a2.0 × 101 ± 1.0 × 101 b
Clostridium spp.1.7 × 107 ± 1.3 × 107 a3.0 × 101 ± 1.0 × 101 b
1 commercial feed; 2 experimental feed; 3 not found; 4 total counts of mesophilic bacteria; 5 total counts of hemolytic mesophilic bacteria.
Table 4. Correlation coefficients denoting the strength of the relationships between Carnobacterium maltaromaticum counts in the experimental feed, digestive tract, and skin samples (n = 44).
Table 4. Correlation coefficients denoting the strength of the relationships between Carnobacterium maltaromaticum counts in the experimental feed, digestive tract, and skin samples (n = 44).
SampleBacteriaC. maltaromaticum Counts in
Experimental FeedDigestive TractSkin
Digestive tractC. maltaromaticum0.7327 ***n. d. 3n. d.
TCMB 1−0.1139−0.7678 ***n. d.
TCHMB 2−0.9525 ***−0.8726 ***n. d.
P. fluorescens−0.7390 ***−0.7256 ***n. d.
A. hydrophila−0.9387 ***−0.9109 ***n. d.
Staphylococcus spp.−0.2620 ***−0.9437 ***n. d.
Clostridium sp.−0.7017 ***−0.7678 ***n. d.
SkinC. maltaromaticum0.3241 *n. d.n. d.
TCMB 1−0.1045n. d.−0.3648 *
TCHMB 2−0.3525 *n. d.−0.9515 **
P. fluorescens−0.4561 *n. d.−0.9826 *
A. hydrophila−0.4876 *n. d.−0.9274 **
Staphylococcus spp.−0.1623n. d.−0.9753 *
Clostridium sp.−0.4215 *n. d.−0.8479 **
1 total counts of mesophilic bacteria; 2 total counts of hemolytic mesophilic bacteria; 3 not determined; * statistically significant correlations at p < 0.05; ** at p < 0.01; *** at p < 0.001.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Gołaś, I.; Potorski, J.A. The Influence of Commercial Feed Supplemented with Carnobacterium maltaromaticum Environmental Probiotic Bacteria on the Rearing Parameters and Microbial Safety of Juvenile Rainbow Trout. Animals 2022, 12, 3321. https://doi.org/10.3390/ani12233321

AMA Style

Gołaś I, Potorski JA. The Influence of Commercial Feed Supplemented with Carnobacterium maltaromaticum Environmental Probiotic Bacteria on the Rearing Parameters and Microbial Safety of Juvenile Rainbow Trout. Animals. 2022; 12(23):3321. https://doi.org/10.3390/ani12233321

Chicago/Turabian Style

Gołaś, Iwona, and Jacek Arkadiusz Potorski. 2022. "The Influence of Commercial Feed Supplemented with Carnobacterium maltaromaticum Environmental Probiotic Bacteria on the Rearing Parameters and Microbial Safety of Juvenile Rainbow Trout" Animals 12, no. 23: 3321. https://doi.org/10.3390/ani12233321

APA Style

Gołaś, I., & Potorski, J. A. (2022). The Influence of Commercial Feed Supplemented with Carnobacterium maltaromaticum Environmental Probiotic Bacteria on the Rearing Parameters and Microbial Safety of Juvenile Rainbow Trout. Animals, 12(23), 3321. https://doi.org/10.3390/ani12233321

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop