mRNA Expressions of Candidate Genes in Gestational Day 16 Conceptus and Corresponding Endometrium in Repeat Breeder Dairy Cows with Suboptimal Uterine Environment Following Transfer of Different Quality Day 7 Embryos
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cows
2.2. Estrus Synchronization
2.3. Embryo Transfer
2.4. Embryo Collection
2.5. Endometrial Tissue Sample Collection
2.6. Real-Time Polymerase Chain Reaction for Determination of mRNA Expression of Candidate Genes in Embryo and Endometrial Samples
2.6.1. Total RNA Isolation
2.6.2. Complementary DNA (cDNA) Synthesis
2.6.3. Real-Time PCR of Candidate Genes
2.7. Western Blot Analysis
2.8. Predicting Functional Protein Partners
2.9. Computational Prediction of Protein Targets
2.10. Statistical Analysis
3. Results
3.1. mRNA Abundances in GD 16 Conceptus and Endometrium of Cows that Received Embryo with Quality Grade 1, 2 and 3
3.2. mRNA Abundances in GD 16 Conceptus and Endometrium of Cows with or without Subclinical Endometritis
3.3. Interactions between Subclinical Endometritis Status by Embryo Quality Grade mRNA Expressions
3.4. mRNA Expressions of GD 16 Filamentous vs. Tubular Conceptus of Cows with or without Subclinical Endometritis Following Transfer of Different GD 7 Embryo Grades
3.5. Protein Expression in GD 16 Conceptus and Corresponding Endometrium
3.6. Interactive Pathway of Genes Associated with Embryo-Uterus Crosstalk on GD 16
3.7. Computational Prediction of Protein Targets
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sánchez, J.M.; Simintiras, C.A.; Lonergan, P. Aspects of embryo-maternal communication in establishment of pregnancy in cattle. Anim. Reprod. 2019, 16, 376–385. [Google Scholar] [CrossRef] [PubMed]
- Diskin, M.G.; Murphy, J.J.; Sreenan, J.M. Embryo survival in dairy cows managed under pastoral conditions. Anim. Reprod. Sci. 2006, 96, 297–311. [Google Scholar] [CrossRef] [PubMed]
- Diskin, M.G.; Morris, D.G. Embryonic and early foetal losses in cattle and other ruminants. Reprod. Domest. Anim. 2008, 43, 260–267. [Google Scholar] [CrossRef] [PubMed]
- Wiltbank, M.C.; Baez, G.M.; Garcia-Guerra, A.; Toledo, M.Z.; Monteiro, P.L.; Melo, L.F.; Ochola, J.C.; Santos, J.E.; Sartori, R. Pivotal periods for pregnancy loss during the first trimester of gestation in lactating dairy cows. Theriogenology 2016, 86, 239–253. [Google Scholar] [CrossRef] [PubMed]
- Diskin, M.G.; Waters, S.M.; Parr, M.H.; Kenny, D.A. Pregnancy losses in cattle: Potential for improvement. Reprod. Fertil. Dev. 2016, 28, 83–93. [Google Scholar] [CrossRef] [PubMed]
- Ryan, D.P.; Prichard, J.F.; Kopel, E.; Godke, R.A. Comparing early embryo mortality in dairy cows during hot and cool seasons of the year. Theriogenology 1993, 39, 719–737. [Google Scholar] [CrossRef] [PubMed]
- Sartori, R.; Sartori-Bergfelt, R.; Mertens, S.A.; Guenther, J.N.; Parish, J.J.; Wiltbank, M.C. Fertilization and early embryonic development in heifers and lactating cows in summer and lactating and dry cows in winter. J. Dairy Sci. 2002, 85, 2803–2812. [Google Scholar] [CrossRef] [PubMed]
- Wiebold, J.L. Embryonic mortality and the uterine environment in first service lactating dairy cows. J. Reprod. Fertil. 1998, 84, 393–399. [Google Scholar] [CrossRef] [PubMed]
- Barnwell, C.V.; Farin, P.W.; Ashwell, C.M.; Farmer, W.T.; Galphin, S.P., Jr.; Farin, C.E. Differences in mRNA populations of short and long bovine conceptuses on day 15 of gestation. Mol. Reprod. Dev. 2016, 83, 424–441. [Google Scholar] [CrossRef] [PubMed]
- Moraes, J.G.N.; Behura, S.K.; Geary, T.W.; Hansen, P.J.; Neibergs, H.L.; Spencer, T.E. Uterine influences on conceptus development in fertility-classified animals. Proc. Natl. Acad. Sci. USA 2018, 115, E1749–E1758. [Google Scholar] [CrossRef] [PubMed]
- Fléchon, J.E.; Flechon, B.; Degrouard, J.; Guillomot, M. Cellular features of the extra- embryonic endoderm during elongation in the ovine conceptus. Genesis 2007, 45, 709–715. [Google Scholar] [CrossRef] [PubMed]
- Hoelker, M.; Held, E.; Salilew-Wondim, D.; Schellander, K.; Tesfaye, D. Molecular signatures of bovine embryo developmental competence. Reprod. Fertil. Dev. 2013, 26, 22–36. [Google Scholar] [CrossRef] [PubMed]
- Miravet-Valenciano, J.A.; Rincon-Bertolin, A.; Vilella, F.; Simon, C. Understanding and improving endometrial receptivity. Curr. Opin. Obstet. Gynecol. 2015, 27, 187–192. [Google Scholar] [CrossRef] [PubMed]
- Spencer, T.E.; Forde, N.; Lonergan, P. Insights into conceptus elongation and establishment of pregnancy in ruminants. Reprod. Fertil. Dev. 2016, 29, 84–100. [Google Scholar] [CrossRef] [PubMed]
- Forde, N.; Lonergan, P. Transcriptomic analysis of the bovine endometrium: What is required to establish uterine receptivity to implantation in cattle? J. Reprod. Dev. 2012, 58, 189–195. [Google Scholar] [CrossRef] [PubMed]
- Forde, N.; Spencer, T.E.; Bazer, F.W.; Song, G.; Roche, J.F.; Lonergan, P. Effect of pregnancy and progesterone concentration on expression of genes encoding for transporters or secreted proteins in the bovine endometrium. Physiol. Genom. 2010, 41, 53–62. [Google Scholar] [CrossRef] [PubMed]
- Forde, N.; Carter, F.; Spencer, T.E.; Bazer, F.W.; Sandra, O.; Mansouri-Attia, N.; Okumu, L.A.; McGettigan, P.A.; Mehta, J.P.; McBride, R.; et al. Conceptus-induced changes in the endometrial transcriptome: How soon does the cow know she is pregnant? Biol. Reprod. 2011, 85, 144–156. [Google Scholar] [CrossRef] [PubMed]
- Farin, C.E.; Imakawa, K.; Hansen, T.R.; McDonnell, J.J.; Murphy, C.N.; Farin, P.W.; Roberts, R.M. Expression of trophoblastic interferon genes in sheep and cattle. Biol. Reprod. 1990, 43, 210–218. [Google Scholar] [CrossRef] [PubMed]
- Lonergan, P. State-of-the-art embryo technologies in cattle. Soc. Reprod. Fertil. Suppl. 2007, 64, 315–325. [Google Scholar] [CrossRef] [PubMed]
- Kasimanickam, R.; Kasimanickam, V.; Grende, K. Endometrial expression of various genes (ISGs, PPARs, RXRs and MUC1) on day 16 post-ovulation in repeat breeder cows, with or without subclinical endometritis. Theriogenology 2020, 142, 251–259. [Google Scholar] [CrossRef] [PubMed]
- Kasimanickam, R.; Kasimanickam, V. IFNT, ISGs, PPARs, RXRs and MUC1 in day 16 embryo and corresponding endometrium of repeat-breeder cows, with or without subclinical endometritis. Theriogenology 2020, 158, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Kasimanickam, R.; Duffield, T.F.; Foster, R.A.; Gartley, C.J.; Leslie, K.E.; Walton, J.S.; Johnson, W.H. A comparison of the cytobrush and uterine lavage techniques to evaluate endometrial cytology in clinically normal postpartum dairy cows. Can. Vet. J. 2005, 46, 255–259. [Google Scholar] [PubMed]
- Dubuc, J.; Duffield, T.F.; Leslie, K.E.; Walton, J.S.; LeBlanc, S.J. Definitions and diagnosis of postpartum endometritis in dairy cows. J. Dairy Sci. 2010, 93, 5225–5233. [Google Scholar] [CrossRef] [PubMed]
- Jones, G.M.; Wildman, E.E.; Troutt, H.F., Jr.; Lesch, T.N.; Wagner, P.E.; Boman, R.L.; Lanning, N.M. Metabolic profiles in Virginia dairy herds of different milk yields. J. Dairy Sci. 1982, 65, 683–688. [Google Scholar] [CrossRef] [PubMed]
- Edmonson, A.J.; Lean, I.J.; Weaver, L.D.; Farver, T.; Webster, G. A body condition scoring chart for Holstein dairy cows. J. Dairy Sci. 1989, 72, 68–78. [Google Scholar] [CrossRef]
- Bo, G.A.; Mapletoft, R.J. Evaluation and classification of bovine embryos. Anim. Reprod. 2012, 10, 344–348. [Google Scholar]
- Peralta, O.A.; Huckle, W.R.; Eyestone, W.H. Developmental expression of the cellular prion protein (PrP(C)) in bovine embryos. Mol. Reprod. Dev. 2012, 79, 488–498. [Google Scholar] [CrossRef] [PubMed]
- Betteridge, K.J.; Eaglesome, M.D.; Randall, G.C.; Mitchell, D. Collection, description and transfer of embryos from cattle 10–16 days after oestrus. J. Reprod. Fertil. 1980, 59, 205–216. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, E.S.; Monteiro, A.P.A.; Bisinotto, R.S.; Lima, F.S.; Greco, L.F.; Ealy, A.D.; Thatcher, W.W.; Santos, J.E.P. Conceptus development and transcriptome at preimplantation stages in lactating dairy cows of distinct genetic groups and estrous cyclic statuses. J. Dairy Sci. 2016, 99, 4761–4777. [Google Scholar] [CrossRef] [PubMed]
- Kasimanickam, V.; Kasimanickam, R. Exogenous retinoic acid and cytochrome P450 26B1 inhibitor modulate meiosis-associated genes expression in canine testis, an in vitro model. Reprod. Domest. Anim. 2014, 49, 315–323. [Google Scholar] [CrossRef] [PubMed]
- Szklarczyk, D.; Morris, J.H.; Cook, H.; Kuhn, M.; Wyder, S.; Simonovic, M.; Santos, A.; Doncheva, N.T.; Roth, A.; Bork, P.; et al. The STRING database in 2017: Quality-controlled protein-protein association networks, made broadly accessible. Nucleic Acids Res. 2016, 45, D362–D368. [Google Scholar] [CrossRef] [PubMed]
- Mi, H.; Muruganujan, A.; Thomas, P.D. PANTHER in 2013: Modeling the evolution of gene function, and other gene attributes, in the context of phylogenetic trees. Nucleic Acids Res. 2013, 41, D377–D386. [Google Scholar] [CrossRef] [PubMed]
- Thomas, P.D.; Campbell, M.J.; Kejariwal, A.; Mi, H.; Karlak, B.; Daverman, R.; Diemer, K.; Muruganujan, A.; Narechania, A. PANTHER: A library of protein families and subfamilies indexed by function. Genome Res. 2003, 13, 2129–2141. [Google Scholar] [CrossRef] [PubMed]
- Salilew-Wondim, D.; Holker, M.; Rings, F.; Ghanem, N.; Ulas-Cinar, M.; Peippo, J.; Tholen, E.; Looft, C.; Schellander, K.; Tesfaye, D. Bovine pretransfer endometrium and embryo transcriptome fingerprints as predictors of pregnancy success after embryo transfer. Physiol. Genom. 2010, 42, 201–218. [Google Scholar] [CrossRef] [PubMed]
- Hill, J.; Gilbert, R. Reduced quality of bovine embryos cultured in media conditioned by exposure to an inflamed endometrium. Aust. Vet. J. 2008, 86, 312–316. [Google Scholar] [CrossRef] [PubMed]
- Betsha, S.; Hoelker, M.; Salilew-Wondim, D.; Held, E.; Rings, F.; Grosse-Brinkhause, C.; Cinar, M.U.; Havlicek, V.; Besenfelder, U.; Tholen, E.; et al. Transcriptome profile of bovine elongated conceptus obtained from SCNT and IVP pregnancies. Mol. Reprod. Dev. 2013, 80, 315–333. [Google Scholar] [CrossRef] [PubMed]
- O’Hara, L.; Forde, N.; Kelly, A.K.; Lonergan, P. Effect of bovine blastocyst size at embryo transfer on day 7 on conceptus length on day 14: Can supplementary progesterone rescue small embryos? Theriogenology 2014, 81, 1123–1128. [Google Scholar] [CrossRef] [PubMed]
- Sponchiado, M.; Gomes, N.S.; Fontes, P.K.; Martins, T.; Del Collado, M.; Pastore, A.A.; Pugliesi, G.; Nogueira, M.F.G.; Binelli, M. Pre-hatching embryo-dependent and -independent programming of endometrial function in cattle. PLoS ONE 2017, 12, e0175954. [Google Scholar] [CrossRef] [PubMed]
- Passaro, C.; Forde, N.; Spencer, T.E.; Lonergan, P. Proteomic analysis of uterine luminal fluid on day 7 of pregnancy in cattle. Reprod. Fert. Dev. 2016, 28, 166. [Google Scholar] [CrossRef]
- Gray, C.A.; Abbey, C.A.; Beremand, P.D.; Choi, Y.; Farmer, J.L.; Adelson, D.L.; Thomas, T.L.; Bazer, F.W.; Spencer, T.E. Identification of endometrial genes regulated by early pregnancy, progesterone, and interferon tau in the ovine uterus. Biol. Reprod. 2006, 74, 383–394. [Google Scholar] [CrossRef] [PubMed]
- Klein, C.; Bauersachs, S.; Ulbrich, S.E.; Einspanier, R.; Meyer, H.H.D.; Schmidt, S.E.M.; Reichenbach, H.D.; Vermehren, M.; Sinowatz, F.; Blum, H.; et al. Monozygotic twin model reveals novel embryo-induced transcriptome changes of bovine endometrium in the pre-attachment period. Biol. Reprod. 2006, 74, 253–264. [Google Scholar] [CrossRef] [PubMed]
- Sofia, H.J.; Chen, G.; Hetzler, B.G.; Reyes-Spindola, J.F.; Miller, N.E. Radical SAM, a novel protein superfamily linking unresolved steps in familiar biosynthetic pathways with radical mechanisms: Functional characterization using new analysis and information visualization methods. Nucleic Acids Res. 2001, 29, 1097–1106. [Google Scholar] [CrossRef] [PubMed]
- Song, G.; Bazer, F.W.; Spencer, T.E. Pregnancy and interferon tau regulate RSAD2 and IFIH1 expression in the ovine uterus. Reproduction 2007, 133, 285–295. [Google Scholar] [CrossRef] [PubMed]
- Berger, J.; Moller, D.E. The mechanisms of action of PPARs. Annu. Rev. Med. 2002, 53, 409–435. [Google Scholar] [CrossRef] [PubMed]
- Shahbazi, M.N. Mechanisms of human embryo development: From cell fate to tissue shape and back. Development 2020, 147, dev190629. [Google Scholar] [CrossRef] [PubMed]
- Bazer, F.W.; Wang, X.; Johnson, G.A.; Wu, G. Select nutrients and their effects on conceptus development in mammals. Anim. Nutr. 2015, 1, 85–95. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.; Wu, G.; Spencer, T.E.; Johnson, G.A.; Li, X.; Bazer, F.W. Select nutrients in the ovine uterine lumen. I. Amino acids, glucose, and ions in uterine lumenal flushings of cyclic and pregnant ewes. Biol. Reprod. 2009, 80, 86–93. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.Y.; Burghardt, R.C.; Wu, G.; Johnson, G.A.; Spencer, T.E.; Bazer, F.W. Select nutrients in the ovine uterine lumen. VII. Effects of arginine, leucine, glutamine, and glucose on trophectoderm cell signaling, proliferation, and migration. Biol. Reprod. 2011, 84, 62–69. [Google Scholar] [CrossRef] [PubMed]
- Bazer, F.W.; Wu, G.; Spencer, T.E.; Johnson, G.A.; Burghardt, R.C.; Bayless, K. Novel pathways for implantation and establishment and maintenance of pregnancy in mammals. Mol. Hum. Reprod. 2010, 16, 135–152. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, E.S.; Santos, J.E.P.; Thatcher, W.W. Role of lipids on elongation of the preimplantation conceptus in ruminants. Reproduction 2016, 152, R115–R126. [Google Scholar] [CrossRef] [PubMed]
- Ribeiro, E.S.; Greco, L.F.; Bisinotto, R.S.; Lima, F.S.; Thatcher, W.W.; Santos, J.E. Biology of preimplantation conceptus at the onset of elongation in dairy cows. Biol. Reprod. 2016, 94, 97. [Google Scholar] [CrossRef] [PubMed]
- Wieser, F.; Waite, L.; Depoix, C.; Taylor, R.N. PPAR action in human placental development and pregnancy and its complications. PPAR Res. 2008, 2008, 527048. [Google Scholar] [CrossRef] [PubMed]
- Cucchi, D.; Camacho-Muñoz, D.; Certo, M.; Pucino, V.; Nicolaou, A.; Mauro, C. Fatty acids - from energy substrates to key regulators of cell survival, proliferation and effector function. Cell Stress 2019, 4, 9–23. [Google Scholar] [CrossRef] [PubMed]
- Mattos, R.; Staples, C.R.; Thatcher, W.W. Effects of dietary fatty acids on reproduction in ruminants. Rev. Reprod. 2000, 5, 38–45. [Google Scholar] [CrossRef] [PubMed]
- Teeli, A.S.; Sheikh, P.A.; Patra, M.K.; Singh, D.; Kumar, B.; Kumar, H.; Singh, S.K.; Verma, M.R.; Krishnaswamy, N. Effect of dietary n-3 polyunsaturated rich fish oil supplementation on ovarian function and interferon stimulated genes in the repeat breeding cow. Anim. Reprod. Sci. 2019, 211, 106230. [Google Scholar] [CrossRef] [PubMed]
- Giller, K.; Drews, B.; Berard, J.; Kienberger, H.; Schmicke, M.; Frank, J.; Spanier, B.; Daniel, H.; Geisslinger, G.; Ulbrich, S.E. Bovine embryo elongation is altered due to maternal fatty acid supplementation. Biol. Reprod. 2018, 99, 600–610. [Google Scholar] [CrossRef] [PubMed]
- Kasimanickam, R.; Kasimanickam, V.; Kumar, N.; Reisenauer, C. Day 7 embryo quality and suboptimal uterine environment influences morphometry of day 16 embryos in dairy cows. Theriogenology 2021, 163, 10–17. [Google Scholar] [CrossRef] [PubMed]
- Mann, G.E.; Fray, M.D.; Lamming, G.E. Effects of time of progesterone supplementation on embryo development and interferon-tau production in the cow. Vet. J. 2006, 171, 500–503. [Google Scholar] [CrossRef] [PubMed]
- Brooks, K.E.; Burns, G.W.; Spencer, T.E. Peroxisome proliferator activator receptor gamma (PPARG) regulates conceptus elongation in sheep. Biol. Reprod. 2015, 92, 42. [Google Scholar] [CrossRef] [PubMed]
- Yelich, J.V.; Pomp, D.; Geisert, R.D. Detection of transcripts for retinoic acid receptors, retinol-binding protein, and transforming growth factors during rapid trophoblastic elongation in the porcine conceptus. Biol. Reprod. 1997, 57, 286–294. [Google Scholar] [CrossRef] [PubMed]
- Bauersachs, S.; Wolf, E. Transcriptome analyses of bovine, porcine and equine endometrium during the pre-implantation phase. Anim. Reprod. Sci. 2012, 134, 84–94. [Google Scholar] [CrossRef] [PubMed]
- Shirozu, T.; Sasaki, K.; Kawahara, M.; Yanagawa, Y.; Nagano, M.; Yamauchi, N.; Takahashi, M. Expression dynamics of bovine MX genes in the endometrium and placenta during early to mid-pregnancy. J. Reprod. Dev. 2016, 62, 29–35. [Google Scholar] [CrossRef] [PubMed]







| Gene | Primer Sequence (5′–3′) | Product Length | Accession Number |
|---|---|---|---|
| MUC1 | F: ACCATTGCCTGCAGAAACCT R: CATTGCCCTGGTTGTGTGTC | 178 | NM_174115.2 |
| IFNT | F: CTGAAGGTTCACCCAGACCC R: GAGTCTGTTCATTCGGGCCA | 197 | NM_001168279.1 |
| CTSL1 | F: CCTTCACTCCTCCTGACAGC R: TGGTCATGTCACCAAAGGCA | 247 | NM_001083686.2 |
| ISG15 | F: TGTCTTTTGAAGGGAGGCCC R: TTATTCACTGCGCTGCATGG | 156 | NM_174366.1 |
| RSAD2 | F: GCTGGTACCCATTGCGTTTG R: CTGGCGGGTGAAGTGGTAAT | 244 | NM_001045941.1 |
| SLC2A1 | F: CTCATAGCCTGCATCTCGCA R: CCTGTTCCGGAGAGCATTGT | 237 | NM_174829.3 |
| CXCL10 | F: CTGCCCACGTGTCGAGATTA R: AAACCGAAGTCCACGGACAA | 251 | NM_001046551.2 |
| SLC27A6 | F: TGGAGCACGCAGTGATGTAT R: AAGTCCGGGTTCCCCTTTTT | 256 | NM_001101169.1 |
| RXRA | F: CCTTGACTGCCAGGACTTCTCC R: GGGGGAACTGATGACCGAGA | 214 | XM_024998424.1 |
| RXRB | F: GGAGCCATCTTCGATAGGGT R: GCCTATGGACCTGAGAGCAG | 261 | NM_001083640.1 |
| RXRG | F: GGACACACCCATTGACACCT R: CTTCCAGAAAGATCCCCATCCC | 291 | NM_001075408.1 |
| PPARA | F: GCCCCAGGTGGTGGA R: CCGGCCACAGACTGTTACTT | 122 | NM_001034036.1 |
| PPARD | F: AGTGGCTTCTGTTCACCGAC R: GCTGGAAGGAAGTGAGTGCT | 266 | NM_001083636.1 |
| PPARG | F: CACAGAGATGCCGTTTTGGC R: CAACCATCGGGTCAGCTCTT | 173 | NM_181024.2 |
| BRP | F: CCAGGCTTTAGGCATCACCA | 94 | NM_001012682 |
| R: GGCGCCTACTTTGTCTCCTGT |
| Gene | GD 16 Filamentous Conceptus | Corresponding GD16 Endometrium | ||||
|---|---|---|---|---|---|---|
| Embryo QG 1 vs. 3 with SCE | Embryo QG 2 vs. 3 with SCE | Embryo QG 1 vs. 2 with SCE | Embryo QG 1 vs. 3 with SCE | Embryo QG 2 vs. 3 with SCE | Embryo QG 1 vs. 2 with SCE | |
| PPARA | 0.01 | 0.01 | 0.44 | 0.05 | 0.05 | 0.61 |
| PPARD | 0.01 | 0.05 | 0.11 | 0.01 | 0.05 | 0.08 |
| PPARG | 0.05 | 0.05 | 0.46 | 0.01 | 0.01 | 0.10 |
| RXRA | 0.001 | 0.01 | 0.10 | 0.05 | 0.05 | 0.19 |
| RXRB | 0.05 | 0.05 | 0.13 | 0.01 | 0.05 | 0.11 |
| RXRG | 0.001 | 0.01 | 0.10 | 0.01 | 0.05 | 0.17 |
| IFNT | 0.001 | 0.05 | 0.10 | 0.001 | 0.01 | 0.07 |
| CTSL1 | 0.01 | 0.05 | 0.15 | 0.01 | 0.01 | 0.05 |
| ISG15 | 0.0001 | 0.01 | 0.15 | 0.0001 | 0.01 | 0.37 |
| RSAD2 | 0.05 | 0.05 | 0.10 | 0.05 | 0.05 | 0.28 |
| SLC2A1 | 0.0001 | 0.001 | 0.05 | 0.01 | 0.05 | 0.10 |
| CXCL10 | 0.0001 | 0.001 | 0.01 | 0.001 | 0.01 | 0.08 |
| SLC27A6 | 0.0001 | 0.001 | 0.05 | 0.05 | 0.05 | 0.05 |
| MUC1 | 0.0001 | 0.01 | 0.22 | 0.001 | 0.001 | 0.13 |
| Gene | GD 16 Filamentous Conceptus | Corresponding GD16 Endometrium | ||||
|---|---|---|---|---|---|---|
| Embryo QG 1 vs. 3 without SCE | Embryo QG 2 vs. 3 without SCE | Embryo QG 1 vs. 2 without SCE | Embryo QG 1 vs. 3 without SCE | Embryo QG 2 vs. 3 without SCE | Embryo QG 1 vs. 2 without SCE | |
| PPARA | 0.05 | 0.05 | 0.08 | 0.05 | 0.05 | 0.61 |
| PPARD | 0.05 | 0.05 | 0.34 | 0.05 | 0.05 | 0.43 |
| PPARG | 0.05 | 0.05 | 0.22 | 0.05 | 0.01 | 0.16 |
| RXRA | 0.01 | 0.05 | 0.46 | 0.01 | 0.05 | 0.10 |
| RXRB | 0.05 | 0.05 | 0.24 | 0.05 | 0.05 | 0.58 |
| RXRG | 0.01 | 0.05 | 0.19 | 0.05 | 0.05 | 0.37 |
| IFNT | 0.01 | 0.01 | 0.10 | 0.01 | 0.01 | 0.07 |
| CTSL1 | 0.01 | 0.05 | 0.15 | 0.05 | 0.01 | 0.08 |
| ISG15 | 0.001 | 0.01 | 0.15 | 0.001 | 0.01 | 0.07 |
| RSAD2 | 0.05 | 0.05 | 0.10 | 0.001 | 0.05 | 0.28 |
| SLC2A1 | 0.0001 | 0.05 | 0.10 | 0.05 | 0.05 | 0.10 |
| CXCL10 | 0.001 | 0.01 | 0.15 | 0.01 | 0.01 | 0.15 |
| SLC27A6 | 0.0001 | 0.01 | 0.10 | 0.05 | 0.05 | 0.19 |
| MUC1 | 0.01 | 0.05 | 0.22 | 0.05 | 0.01 | 0.13 |
| Gene | GD 16 Tubular Conceptus | Corresponding GD16 Endometrium | ||||
|---|---|---|---|---|---|---|
| Embryo QG 1 vs. 3 with SCE | Embryo QG 2 vs. 3 with SCE | Embryo QG 1 vs. 2 with SCE | Embryo QG 1 vs. 3 with SCE | Embryo QG 2 vs. 3 with SCE | Embryo QG 1 vs. 2 with SCE | |
| PPARA | 0.05 | 0.05 | 0.71 | 0.001 | 0.01 | 0.43 |
| PPARD | 0.001 | 0.05 | 0.09 | 0.001 | 0.05 | 0.06 |
| PPARG | 0.001 | 0.01 | 0.06 | 0.001 | 0.01 | 0.08 |
| RXRA | 0.05 | 0.01 | 0.31 | 0.001 | 0.05 | 0.22 |
| RXRB | 0.001 | 0.05 | 0.06 | 0.001 | 0.05 | 0.11 |
| RXRG | 0.001 | 0.01 | 0.10 | 0.05 | 0.01 | 0.17 |
| IFNT | 0.001 | 0.01 | 0.10 | 0.001 | 0.01 | 0.26 |
| CTSL1 | 0.01 | 0.05 | 0.15 | 0.001 | 0.01 | 0.07 |
| ISG15 | 0.0001 | 0.001 | 0.06 | 0.0001 | 0.01 | 0.34 |
| RSAD2 | 0.05 | 0.05 | 0.28 | 0.05 | 0.05 | 0.22 |
| SLC2A1 | 0.05 | 0.01 | 0.34 | 0.01 | 0.01 | 0.10 |
| CXCL10 | 0.001 | 0.001 | 0.07 | 0.001 | 0.01 | 0.06 |
| SLC27A6 | 0.05 | 0.001 | 0.09 | 0.05 | 0.05 | 0.06 |
| MUC1 | 0.01 | 0.01 | 0.22 | 0.001 | 0.01 | 0.16 |
| Gene | GD 16 Tubular Conceptus | Corresponding GD16 Endometrium | ||||
|---|---|---|---|---|---|---|
| Embryo QG 1 vs. 3 without SCE | Embryo QG 2 vs. 3 without SCE | Embryo QG 1 vs. 2 without SCE | Embryo QG 1 vs. 3 without SCE | Embryo QG 2 vs. 3 without SCE | Embryo QG 1 vs. 2 without SCE | |
| PPARA | 0.001 | 0.001 | 0.07 | 0.01 | 0.05 | 0.11 |
| PPARD | 0.05 | 0.05 | 0.31 | 0.01 | 0.05 | 0.07 |
| PPARG | 0.001 | 0.01 | 0.06 | 0.01 | 0.01 | 0.09 |
| RXRA | 0.01 | 0.05 | 0.06 | 0.01 | 0.05 | 0.05 |
| RXRB | 0.01 | 0.05 | 0.13 | 0.01 | 0.05 | 0.58 |
| RXRG | 0.01 | 0.01 | 0.08 | 0.05 | 0.05 | 0.37 |
| IFNT | 0.0001 | 0.01 | 0.06 | 0.001 | 0.01 | 0.07 |
| CTSL1 | 0.001 | 0.001 | 0.07 | 0.001 | 0.001 | 0.08 |
| ISG15 | 0.0001 | 0.01 | 0.09 | 0.0001 | 0.05 | 0.06 |
| RSAD2 | 0.001 | 0.01 | 0.06 | 0.05 | 0.05 | 0.08 |
| SLC2A1 | 0.0001 | 0.001 | 0.08 | 0.01 | 0.05 | 0.06 |
| CXCL10 | 0.0001 | 0.01 | 0.06 | 0.01 | 0.01 | 0.07 |
| SLC27A6 | 0.0001 | 0.0001 | 0.06 | 0.01 | 0.05 | 0.09 |
| MUC1 | 0.0001 | 0.001 | 0.12 | 0.01 | 0.01 | 0.13 |
| Gene | GD 16 Conceptus | Corresponding GD 16 Endometrium | ||||
|---|---|---|---|---|---|---|
| Embryo QG1 vs. 3 | Embryo QG 2 vs. 3 | Embryo QG 1 vs. 2 | Embryo QG 1 vs. 3 | Embryo QG 2 vs. 3 | Embryo QG 1 vs. 2 | |
| PPARG | 0.01 | 0.05 | 0.25 | 0.01 | 0.01 | 0.16 |
| RXRG | 0.01 | 0.01 | 0.34 | 0.01 | 0.05 | 0.37 |
| IFNT | 0.01 | 0.05 | 0.16 | 0.01 | 0.01 | 0.22 |
| ISG15 | 0.01 | 0.05 | 0.15 | 0.01 | 0.001 | 0.10 |
| SLC2A1 | 0.01 | 0.01 | 0.19 | 0.05 | 0.05 | 0.10 |
| CXCL10 | 0.01 | 0.01 | 0.10 | 0.01 | 0.01 | 0.11 |
| SLC27A6 | 0.001 | 0.01 | 0.08 | 0.001 | 0.05 | 0.10 |
| MUC1 | 0.01 | 0.01 | 0.13 | 0.01 | 0.01 | 0.10 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kasimanickam, R.K.; Kasimanickam, V.R. mRNA Expressions of Candidate Genes in Gestational Day 16 Conceptus and Corresponding Endometrium in Repeat Breeder Dairy Cows with Suboptimal Uterine Environment Following Transfer of Different Quality Day 7 Embryos. Animals 2021, 11, 1092. https://doi.org/10.3390/ani11041092
Kasimanickam RK, Kasimanickam VR. mRNA Expressions of Candidate Genes in Gestational Day 16 Conceptus and Corresponding Endometrium in Repeat Breeder Dairy Cows with Suboptimal Uterine Environment Following Transfer of Different Quality Day 7 Embryos. Animals. 2021; 11(4):1092. https://doi.org/10.3390/ani11041092
Chicago/Turabian StyleKasimanickam, Ramanathan K., and Vanmathy R. Kasimanickam. 2021. "mRNA Expressions of Candidate Genes in Gestational Day 16 Conceptus and Corresponding Endometrium in Repeat Breeder Dairy Cows with Suboptimal Uterine Environment Following Transfer of Different Quality Day 7 Embryos" Animals 11, no. 4: 1092. https://doi.org/10.3390/ani11041092
APA StyleKasimanickam, R. K., & Kasimanickam, V. R. (2021). mRNA Expressions of Candidate Genes in Gestational Day 16 Conceptus and Corresponding Endometrium in Repeat Breeder Dairy Cows with Suboptimal Uterine Environment Following Transfer of Different Quality Day 7 Embryos. Animals, 11(4), 1092. https://doi.org/10.3390/ani11041092

