Occurrence and Molecular Characteristics of Mcr-1-Positive Escherichia coli from Healthy Meat Ducks in Shandong Province of China
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Isolate
2.2. Antimicrobial Susceptibility Testing
2.3. Molecular Detection
2.4. Molecular Typing
2.5. Conjugation Assays
2.6. Plasmid Characterization
2.7. Ethics Statement
3. Results and Discussion
3.1. Identification of Mcr-1-Carrying E. coli Isolates
3.2. Antimicrobial Resistance Patterns and Resistance Genes
3.3. Phylogenetic Groups and Virulence Genes
3.4. Molecular Typing
3.5. Genetic Environment of Mcr-1 Gene
3.6. Plasmids Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Dziva, F.; Hauser, H.; Connor, T.R.; van Diemen, P.M.; Prescott, G.; Langridge, G.C.; Eckert, S.; Chaudhuri, R.R.; Ewers, C.; Mellata, M.; et al. Sequencing and functional annotation of avian pathogenic Escherichia coli serogroup O78 strains reveal the evolution of E. coli lineages pathogenic for poultry via distinct mechanisms. Infect. Immun. 2013, 81, 838–849. [Google Scholar] [CrossRef]
- Ewers, C.; Antao, E.M.; Diehl, I.; Philipp, H.C.; Wieler, L.H. Intestine and environment of the chicken as reservoirs for extraintestinal pathogenic Escherichia coli strains with zoonotic potential. Appl. Environ. Microbiol. 2009, 75, 184–192. [Google Scholar] [CrossRef] [PubMed]
- Mellata, M. Human and avian extraintestinal pathogenic Escherichia coli: Infections, zoonotic risks, and antibiotic resistance trends. Foodborne Pathog. Dis. 2013, 10, 916–932. [Google Scholar] [CrossRef] [PubMed]
- Falagas, M.E.; Kasiakou, S.K. Colistin: The revival of polymyxins for the management of multidrug-resistant gram-negative bacterial infections. Clin. Infect. Dis. 2005, 40, 1333–1341. [Google Scholar] [CrossRef]
- Carattoli, A.; Villa, L.; Feudi, C.; Curcio, L.; Orsini, S.; Luppi, A.; Pezzotti, G.; Magistrali, C.F. Novel plasmid-mediated colistin resistance mcr-4 gene in Salmonella and Escherichia coli, Italy 2013, Spain and Belgium, 2015 to 2016. Euro Surveill. 2017, 22, 30589. [Google Scholar] [CrossRef]
- Carroll, L.M.; Gaballa, A.; Guldimann, C.; Sullivan, G.; Henderson, L.O.; Wiedmann, M. Identification of novel mobilized colistin resistance gene mcr-9 in a multidrug-resistant, colistin-susceptible Salmonella enterica serotype Typhimurium isolate. MBio 2019, 10, e00853-19. [Google Scholar] [CrossRef]
- Wang, C.; Feng, Y.; Liu, L.; Wei, L.; Kang, M.; Zong, Z. Identification of novel mobile colistin resistance gene mcr-10. Emerg. Microbes Infect. 2020, 9, 508–516. [Google Scholar] [CrossRef] [PubMed]
- Schwarz, S.; Johnson, A.P. Transferable resistance to colistin: A new but old threat. J. Antimicrob. Chemother. 2016, 71, 2066–2070. [Google Scholar] [CrossRef]
- Chen, K.C.; Chan, E.W.; Xie, M.M.; Ye, L.W.; Dong, N.; Chen, S. Widespread distribution of mcr-1-bearing bacteria in the ecosystem, 2015 to 2016. Eurosurveillance 2017, 22, 17-00206. [Google Scholar] [CrossRef]
- Hu, Y.F.; Liu, F.; Lin, I.Y.; Gao, G.F.; Zhu, B.L. Dissemination of the mcr-1 colistin resistance gene. Lancet Infect. Dis. 2016, 16, 146–147. [Google Scholar] [CrossRef]
- Wang, Q.J.; Sun, J.; Li, J.; Ding, Y.F.; Li, X.P.; Lin, J.X.; Hassan, B.; Feng, Y.J. Expanding landscapes of the diversified mcr-1-bearing plasmid reservoirs. Microbiome 2017, 5, 70. [Google Scholar] [CrossRef] [PubMed]
- Salyers, A.A.; Gupta, A.; Wang, Y.P. Human intestinal bacteria as reservoirs for antibiotic resistance genes. Trends Microbiol. 2004, 12, 412–416. [Google Scholar] [CrossRef] [PubMed]
- Skurnik, D.; Clermont, O.; Guillard, T.; Launay, A.; Danilchanka, O.; Pons, S.; Diancourt, L.; Lebreton, F.; Kadlec, K.; Roux, D.; et al. Emergence of antimicrobial-resistant Escherichia coli of animal origin spreading in humans. Mol. Biol. Evol. 2016, 33, 898–914. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.Y.; Wang, Y.; Walsh, T.R.; Yi, L.X.; Zhang, R.; Spencer, J.; Doi, Y.; Tian, G.B.; Dong, B.L.; Huang, X.H.; et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: A microbiological and molecular biological study. Lancet Infect. Dis. 2016, 16, 161–168. [Google Scholar] [CrossRef]
- Tang, Y.; Diao, Y.X.; Gao, X.H.; Yu, C.M.; Chen, H.; Zhang, D.B. Analysis of the complete genome of Tembusu virus, a flavivirus isolated from ducks in China. Transbound. Emerg. Dis. 2012, 59, 336–343. [Google Scholar] [CrossRef]
- Li, Z.; Wang, X.; Zhang, R.; Chen, J.; Xia, L.; Lin, S.; Xie, Z.; Jiang, S. Evidence of possible vertical transmission of duck circovirus. Vet. Microbiol. 2014, 174, 229–232. [Google Scholar] [CrossRef]
- Li, P.; Lin, S.; Zhang, R.; Chen, J.; Sun, D.; Lan, J.; Song, S.; Xie, Z.; Jiang, S. Isolation and characterization of novel goose parvovirus-related virus reveal the evolution of waterfowl parvovirus. Transbound. Emerg. Dis. 2018, 65, e284–e295. [Google Scholar] [CrossRef]
- Zhang, R.; Chen, J.; Zhang, J.; Yang, Y.; Li, P.; Lan, J.; Xie, Z.; Jiang, S. Novel duck hepatitis A virus type 1 isolates from adult ducks showing egg drop syndrome. Vet. Microbiol. 2018, 221, 33–37. [Google Scholar] [CrossRef]
- Lan, J.; Zhang, R.; Li, P.; Chen, J.; Xie, Z.; Jiang, S. Identification of a type-specific epitope in the ORF2 protein of duck astrovirus type 1. Animals 2019, 9, 1069. [Google Scholar] [CrossRef]
- Yang, F.F.; Sun, Y.N.; Li, J.X.; Wang, H.; Zhao, M.J.; Su, J.; Zhang, Z.J.; Liu, H.J.; Jiang, S.J. Detection of Aminoglycoside resistance genes in Riemerella anatipestifer isolated from ducks. Vet. Microbiol. 2012, 158, 451–452. [Google Scholar] [CrossRef]
- Liu, C.Y.; Diao, Y.J.; Wang, D.X.; Chen, H.; Tang, Y.; Diao, Y.X. Duck viral infection escalated the incidence of avian pathogenic Escherichia coli in China. Transbound. Emerg. Dis. 2019, 66, 929–938. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Chen, L.; Wang, J.; Yassin, A.K.; Butaye, P.; Kelly, P.; Gong, J.; Guo, W.; Li, J.; Li, M.; et al. Molecular detection of colistin resistance genes (mcr-1, mcr-2 and mcr-3) in nasal/oropharyngeal and anal/cloacal swabs from pigs and poultry. Sci. Rep. 2018, 8, 3705. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.S.; Feng, Y.; Lv, X.Y.; Duan, J.H.; Chen, J.; Fang, L.X.; Xia, J.; Liao, X.P.; Sun, J.; Liu, Y.H. Emergence of NDM-5- and MCR-1-Producing Escherichia coli Clones ST648 and ST156 from a Single Muscovy Duck (Cairina moschata). Antimicrob. Agents Chemother. 2016, 60, 6899–6902. [Google Scholar] [CrossRef] [PubMed]
- Yassin, A.K.; Zhang, J.; Wang, J.; Chen, L.; Kelly, P.; Butaye, P.; Lu, G.; Gong, J.; Li, M.; Wei, L.; et al. Identification and characterization of mcr mediated colistin resistance in extraintestinal Escherichia coli from poultry and livestock in China. FEMS Microbiol. Lett. 2017, 364, 10. [Google Scholar] [CrossRef] [PubMed]
- Clinical and Laboratory Strandards Institute. Performance Standands for Antimicrobial Susceptibility Testing; Twenty-Fifth Information Supplement M100-S25; Clinical and Laboratory Strandards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- Clinical and Laboratory Strandards Institute. Performance Standards for Antimicrobial Disk and Dilution Susceptibility Tests for Bacteria Isolated from Animals, 3rd ed.; CLSI Supplement VET01-S; Clinical and Laboratory Strandards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- European Committee on Antimicrobial Susceptibility Testing (EUCAST). Breakpoint Tables for Interpretation of MICs and Zone Diameters: Version 6.0. 2016. Available online: https://www.eucast.org/ast_of_bacteria/previous_versions_of_documents/ (accessed on 29 July 2020).
- Johnson, J.R.; Stell, A.L. Extended virulence genotypes of Escherichia coli strains from patients with urosepsis in relation to phylogeny and host compromise. J. Infect. Dis. 2000, 181, 261–272. [Google Scholar] [CrossRef]
- Stürenburg, E.; Kühn, A.; Mack, D.; Laufs, R. A novel extended-spectrum beta-lactamase CTX-M-23 with a P167T substitution in the active-site omega loop associated with ceftazidime resistance. J. Antimicrob. Chemother. 2004, 54, 406–409. [Google Scholar] [CrossRef]
- Maynard, C.; Fairbrother, J.M.; Bekal, S.; Sanschagrin, F.; Levesque, R.C.; Brousseau, R.; Masson, L.; Larivière, S.; Harel, J. Antimicrobial resistance genes in enterotoxigenic Escherichia coli O149:K91 isolates obtained over a 23-year period from pigs. Antimicrob. Agents Chemother. 2003, 47, 3214–3221. [Google Scholar] [CrossRef]
- Hou, J.X.; Huang, X.H.; Deng, Y.T.; He, L.Y.; Yang, T.; Zeng, Z.L.; Chen, Z.; Liu, J.H. Dissemination of the fosfomycin resistance gene fosA3 with CTX-M β-lactamase genes and rmtB carried on IncFII plasmids among Escherichia coli isolates from pets in China. Antimicrob. Agents Chemother. 2012, 56, 2135–2138. [Google Scholar] [CrossRef]
- Johnson, J.R.; Murray, A.C.; Gajewski, A.; Sullivan, M.; Snippes, P.; Kuskowski, M.A.; Smith, K.E. Isolation and molecular characterization of nalidixic acid-resistant extraintestinal pathogenic Escherichia coli from retail chicken products. Antimicrob. Agents Chemother. 2003, 47, 2161–2168. [Google Scholar] [CrossRef]
- Gautom, R.K. Rapid pulsed-field gel electrophoresis protocol for typing of Escherichia coli O157:H7 and other gram-negative organisms in 1 day. J. Clin. Microbiol. 1997, 35, 2977–2980. [Google Scholar] [CrossRef]
- Pavel, A.B.; Vasile, C.I. PyElph-a software tool for gel images analysis and phylogenetics. BMC Bioinf. 2012, 13, 9. [Google Scholar] [CrossRef] [PubMed]
- Tartof, S.Y.; Solberg, O.D.; Manges, A.R.; Riley, L.W. Analysis of a uropathogenic Escherichia coli clonal group by multilocus sequence typing. J. Clin. Microbiol. 2005, 43, 5860–5864. [Google Scholar] [CrossRef] [PubMed]
- Clermont, O.; Bonacorsi, S.; Bingen, E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl. Environ. Microbiol. 2000, 66, 4555–4558. [Google Scholar] [CrossRef]
- Borgia, S.; Lastovetska, O.; Richardson, D.; Eshaghi, A.; Xiong, J.; Chung, C.; Baqi, M.; McGeer, A.; Ricci, G.; Sawicki, R.; et al. Outbreak of carbapenem-resistant Enterobacteriaceae containing blaNDM-1, Ontario, Canada. Clin. Infect. Dis. 2012, 55, e109–e117. [Google Scholar] [CrossRef] [PubMed]
- Versalovic, J.; Koeuth, T.; Lupski, J.R. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 1991, 19, 6823–6831. [Google Scholar] [CrossRef]
- Carattoli, A.; Bertini, A.; Villa, L.; Falbo, V.; Hopkins, K.L.; Threlfall, E.J. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods. 2005, 63, 219–228. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Li, Z.; Lin, J.; Wang, X.; Deng, X.; Feng, Y. Complex dissemination of the diversified mcr-1-harbouring plasmids in Escherichia coli of different sequence types. Oncotarget 2016, 7, 82112–82122. [Google Scholar] [CrossRef]
- Huang, X.; Yu, L.; Chen, X.; Zhi, C.; Yao, X.; Liu, Y.; Wu, S.; Guo, Z.; Yi, L.; Zeng, Z.; et al. High prevalence of colistin resistance and mcr-1 gene in Escherichia coli isolated from food animals in China. Front. Microbiol. 2017, 8, 562. [Google Scholar] [CrossRef]
- Cui, M.Q.; Zhang, J.F.; Zhang, C.P.; Li, R.C.; Wai-Chi Chan, E.; Wu, C.B.; Wu, C.M.; Chen, S. Distinct mechanisms of acquisition of mcr-1-bearing plasmid by Salmonella strains recovered from animals and food samples. Sci. Rep. 2017, 7, 13199. [Google Scholar] [CrossRef]
- Haenni, M.; Poirel, L.; Kieffer, N.; Châtre, P.; Saras, E.; Métayer, V.; Dumoulin, R.; Nordmann, P.; Madec, J.Y. Co-Occurrence of extended spectrum β lactamase and MCR-1 encoding genes on plasmids. Lancet Infect. Dis. 2016, 16, 281–282. [Google Scholar] [CrossRef]
- Yang, F.; Shen, C.; Zheng, X.B.; Liu, Y.; El-Sayed Ahmed, M.A.E.; Zhao, Z.H.; Liao, K.; Shi, Y.L.; Guo, X.; Zhong, R.X.; et al. Plasmid-Mediated colistin resistance gene mcr-1 in Escherichia coli and Klebsiella pneumoniae isolated from market retail fruits in Guangzhou, China. Infect. Drug Resist. 2019, 12, 385–389. [Google Scholar] [CrossRef] [PubMed]
- Obeng, A.S.; Rickard, H.; Ndi, O.; Sexton, M.; Barton, M. Antibiotic resistance, phylogenetic grouping and virulence potential of Escherichia coli isolated from the faeces of intensively farmed and free range poultry. Vet. Microbiol. 2012, 154, 305–315. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, N.M.; Johnson, J.R.; Johnston, B.; Curtiss, R., 3rd; Mellata, M. Zoonotic potential of Escherichia coli isolates from retail chicken meat products and eggs. Appl. Environ. Microbiol. 2015, 81, 1177–1187. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.T.; Li, X.Y.; Zhang, Q.D.; Shan, H.; Zou, M.; Song, F.J. Colistin-Resistant mcr-positive Enterobacteriaceae in fresh vegetables, an increasing infectious threat in China. Int. J. Antimicrob. Agents. 2019, 54, 89–94. [Google Scholar] [CrossRef]
- Shen, Y.B.; Wu, Z.W.; Wang, Y.; Zhang, R.; Zhou, H.W.; Wang, S.L.; Lei, L.; Li, M.; Cai, J.C.; Tyrrell, J.; et al. Heterogeneous and flexible transmission of mcr-1 in hospital-associated Escherichia coli. MBio 2018, 9, e00943-18. [Google Scholar] [CrossRef]
- Schaufler, K.; Semmler, T.; Wieler, L.H.; Wöhrmann, M.; Baddam, R.; Ahmed, N.; Müller, K.; Kola, A.; Fruth, A.; Ewers, C.; et al. Clonal spread and interspecies transmission of clinically relevant ESBL-producing Escherichia coli of ST410-another successful pandemic clone? FEMS Microbiol. Ecol. 2016, 92, fiv155. [Google Scholar] [CrossRef]
- Li, A.Q.; Yang, Y.; Miao, M.H.; Chavda, K.D.; Mediavilla, J.R.; Xie, X.F.; Feng, P.; Tang, Y.W.; Kreiswirth, B.N.; Chen, L.; et al. Complete sequences of mcr-1-harboring plasmids from extended-spectrum beta-lactamase and carbapenemase-producing Enterobacteriaceae. Antimicrob. Agents Chmother. 2016, 60, 4351–4354. [Google Scholar] [CrossRef]
- Snesrud, E.; He, S.; Chandler, M.; Dekker, J.P.; Hickman, A.B.; McGann, P.; Dyda, F. A model for transposition of the colistin resistance gene mcr-1 by ISApl1. Antimicrob. Agents Chmother. 2016, 60, 6973–6976. [Google Scholar] [CrossRef]
- Xavier, B.B.; Lammens, C.; Butaye, P.; Goossens, H.; Malhotra-Kumar, S. Complete sequence of an IncFII plasmid harbouring the colistin resistance gene mcr-1 isolated from Belgian pig farms. J. Antimicrob. Chemother. 2016, 71, 2342–2344. [Google Scholar] [CrossRef]
- Shafiq, M.; Huang, J.H.; Ur Rahman, S.; Shah, J.M.; Chen, L.; Gao, Y.; Wang, M.L.; Wang, L.P. High incidence of multidrug-resistant Escherichia coli coharboring mcr-1 and blaCTX-M-15 recovered from pigs. Infect. Drug Resist. 2019, 12, 2135–2149. [Google Scholar] [CrossRef]
- Kawahara, R.; Khong, D.T.; Le, H.V.; Phan, Q.N.; Nguyen, T.N.; Yamaguchi, T.; Kumeda, Y.; Yamamoto, Y. Prevalence of mcr-1 among cefotaxime-resistant commensal Escherichia coli in residents of Vietnam. Infect. Drug Resist. 2019, 12, 3317–3325. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Li, X.P.; Yang, R.S.; Fang, L.X.; Huo, W.; Li, S.M.; Jiang, P.; Liao, X.P.; Liu, Y.H. Complete nucleotide sequence of an IncI2 plasmid coharboring blaCTX-M-55 and mcr-1. Antimicrob. Agents Chemother. 2016, 60, 5014–5017. [Google Scholar] [CrossRef] [PubMed]
- Tijet, N.; Faccone, D.; Rapoport, M.; Seah, C.; Pasterán, F.; Ceriana, P.; Albornoz, E.; Corso, A.; Petroni, A.; Melano, R.G. Molecular characteristics of mcr-1-carrying plasmids and new mcr-1 variant recovered from polyclonal clinical Escherichia coli from Argentina and Canada. PLoS ONE 2017, 12, e0180347. [Google Scholar] [CrossRef] [PubMed]
- Liu, B.T.; Song, F.J.; Zou, M.; Hao, Z.H.; Shan, H. Emergence of colistin resistance gene mcr-1 in Cronobacter sakazakii producing NDM-9 and in Escherichia coli from the Same Animal. Antimicrob. Agents Chemother. 2017, 61, e01444-16. [Google Scholar] [CrossRef] [PubMed]
- Ye, H.Y.; Li, Y.H.; Li, Z.C.; Gao, R.S.; Zhang, H.; Wen, R.H.; Gao, G.F.; Hu, Q.H.; Feng, Y.J. Diversified mcr-1-harbouring plasmid reservoirs confer resistance to colistin in human gut microbiota. mBio. 2016, 7, e00177. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.M.; Seward, C.H.; Wu, Z.W.; Ye, H.Y.; Feng, Y.J. Genomic insights into the ESBL and MCR-1-producing ST648 Escherichia coli with multi-drug resistance. Sci. Bull. 2016, 61, 875–878. [Google Scholar] [CrossRef]





| Detected Genes | Primer Sequence (5′–3′) | Size/Bp | |
|---|---|---|---|
| 16S rDNA | agagtttgatcctggctcag | 1505 | |
| ggttaccttgttacgactt | |||
| Resistance gene | rmtB | atgaacatcaacgatgccctc | 756 |
| ttatccattcttttttatcaagtatat | |||
| Genetic context of the mcr-1 gene | nikB | gatgaacttgatcatcgtgttgt | 705 |
| gtaattctgacgaaaaagacga | |||
| top | gagttcgcaccgctgacagac | 330 | |
| atcaaacaccgacttcagggcatc | |||
| Strains | Farm | MLST | Groups | Virulence Genes | Resistance Genes | Resistant Pattern |
|---|---|---|---|---|---|---|
| TA9 * | 1 | ST457 | A | iutA, papC | floR, fosA3 | CL/CIP/TET/FFC/FOS 1 |
| TA15 | 2 | ST69 | A | iutA | blaTEM-1, fosA3 | CL/CTX/CIP/TET/FOS/AK |
| TA20 | 2 | ST2973 | A | iutA | blaCTX-M-55, blaTEM-1, floR, fosA3 | CL/CTX/CIP/TET/FFC/FOS |
| TA32 | 3 | ST469 | B1 | iutA | blaCTX-M-55, rmtB | CL/CTX/CIP/TET/AK |
| TA59 | 6 | ST10 | A | papC | blaCTX-M-55, floR, tet(A) | CL/CTX/TET/FFC/AK/GN |
| TA78 | 8 | ST354 | A | papA | blaTEM-1, floR, tet(A) | CL/CTX/CIP/TET/FFC/GN |
| TA95 | 10 | ST3170 | A | kpsMT II | blaTEM-1 | CL/CTX/CIP/TET/FFC |
| TA103 * | 11 | ST345 | D | iutA, papC | blaCTX-M-55, floR | CL/CTX/CIP/TET/FFC |
| TA114 | 12 | ST410 | A | iutA | blaCTX-M-55, blaTEM-1, floR, rmtB | CL/CTX/CIP/TET/FFC/AK |
| Strains | Co-Transfer of Other Resistance Gene | Co-Transfer of Virulence Gene | Resistant Patterns | Contest of Mcr-1 | Conjugation Efficiency | Mcr-1-Carrying Plasmids | |
|---|---|---|---|---|---|---|---|
| Size (kb) | Replicon Type | ||||||
| TA9 * | / | / | CL 1 | I | 1.13 × 10−2 | ≈65 | I2 |
| TA15 | / | / | CL | I | 6.64 × 10−4 | ≈65 | I2 |
| TA20 | / | / | CL | II | 7.56 × 10−2 | ≈65 | I2 |
| TA32 | / | / | CL | I | 2.17 × 10−3 | ≈65 | I2 |
| TA59 | blaCTX-M-55 | / | CL/CTX | I | 2.98 × 10−6 | ≈102 | FII |
| TA78 | / | / | CL | I | 1.85 × 10−5 | ≈95 | N |
| TA95 | / | / | CL | I | 9.93 × 10−5 | ≈102 | FII |
| TA103 * | blaCTX-M-55, floR | / | CL/CTX/FFC | II | 4.35 × 10−7 | / | / |
| TA114 | floR | / | CL/FFC | I | 3.19 × 10−6 | / | / |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, F.; Zhang, R.; Yang, Y.; Li, H.; Wang, J.; Lan, J.; Li, P.; Zhu, Y.; Xie, Z.; Jiang, S. Occurrence and Molecular Characteristics of Mcr-1-Positive Escherichia coli from Healthy Meat Ducks in Shandong Province of China. Animals 2020, 10, 1299. https://doi.org/10.3390/ani10081299
Liu F, Zhang R, Yang Y, Li H, Wang J, Lan J, Li P, Zhu Y, Xie Z, Jiang S. Occurrence and Molecular Characteristics of Mcr-1-Positive Escherichia coli from Healthy Meat Ducks in Shandong Province of China. Animals. 2020; 10(8):1299. https://doi.org/10.3390/ani10081299
Chicago/Turabian StyleLiu, Fengzhi, Ruihua Zhang, Yupeng Yang, Hanqing Li, Jingyu Wang, Jingjing Lan, Pengfei Li, Yanli Zhu, Zhijing Xie, and Shijin Jiang. 2020. "Occurrence and Molecular Characteristics of Mcr-1-Positive Escherichia coli from Healthy Meat Ducks in Shandong Province of China" Animals 10, no. 8: 1299. https://doi.org/10.3390/ani10081299
APA StyleLiu, F., Zhang, R., Yang, Y., Li, H., Wang, J., Lan, J., Li, P., Zhu, Y., Xie, Z., & Jiang, S. (2020). Occurrence and Molecular Characteristics of Mcr-1-Positive Escherichia coli from Healthy Meat Ducks in Shandong Province of China. Animals, 10(8), 1299. https://doi.org/10.3390/ani10081299

