Aeromonas veronii Infection in Commercial Freshwater Fish: A Potential Threat to Public Health
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Information
2.2. Ethics Statement
2.3. Separation, Purification, and Physiological and Biochemical Test
2.4. Molecular Sequencing
2.5. Virulence Gene Detection
2.6. Pathogenicity Test on Mice
3. Results
3.1. Bacterial Separation, Purification, and Physicochemical Identification
3.2. Molecular Identification
3.3. Detection of Virulence Genes in A. veronii Isolates
3.4. Pathogenicity Test
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Parte, A.C. LPSN—List of prokaryotic names with standing in nomenclature. Nucleic Acids Res. 2013, 42, 613–616. [Google Scholar] [CrossRef]
- Ghenghesh, K.S.; Abeid, S.S.; Jaber, M.M.; Ben-Taher, S.A. Isolation and haemolytic activity of Aeromonas species from domestic dogs and cats. Comp. Immunol. Microb. 1999, 22, 175–179. [Google Scholar] [CrossRef]
- D’Aloia, M.A.; Bailey, T.A.; Samour, J.H.; Naldo, J.; Howlett, J.C. Bacterial flora of captive houbara (Chlamydotis undulata), kori (Ardeotis kori) and rufous-crested (Eupodotis ruficrista) bustards. Avian Pathol. 1996, 25, 459–468. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.X.; Kang, Y.H.; Song, M.F.; Shu, H.P.; Guo, S.N.; Jia, J.P.; Tao, L.T.; Zhao, Z.L.; Wang, C.F.; Wang, G.Q.; et al. Identity and virulence properties of Aeromonas isolates from healthy Northern snakehead (Channa argus) in China. Lett. Appl. Microbiol. 2019, 69, 100–109. [Google Scholar] [CrossRef] [PubMed]
- Parker, J.L.; Shaw, J.G. Aeromonas spp. clinical microbiology and disease. J. Infect. 2011, 62, 109–118. [Google Scholar] [CrossRef]
- Pablos, M.; Huys, G.; Conckaert, M.; Rodríguez-Calleja, J.M.; Otero, A.; Santos, J.A.; García-López, M.L. Identification and epidemiological relationships of Aeromonas isolates from patients with diarrhea, drinking water and foods. Int. J. Food Microbiol. 2011, 147, 203–210. [Google Scholar] [CrossRef]
- Yamada, S.; Matsushita, S.; Dejsirilert, S.; Kudoh, Y. Incidence and clinical symptoms of Aeromonas-associated travellers’ diarrhoea in Tokyo. Epidemiol. Infect. 1997, 119, 121–126. [Google Scholar] [CrossRef]
- Neves, M.S.; Nunes, M.P.; Milhomem, A.M.; Ricciardi, I.D. Production of enterotoxin and cytotoxin by Aeromonas veronii. Braz. J. Med. Biol. Res. 1990, 23, 437–440. [Google Scholar]
- Chen, P.L.; Tsai, P.J.; Chen, C.S.; Lu, Y.C.; Chen, H.M.; Lee, N.Y.; Lee, C.C.; Li, C.W.; Li, M.C.; Wu, C.J.; et al. Aeromonas stool isolates from individuals with or without diarrhea in southern Taiwan: Predominance of Aeromonas veronii. J. Microbiol. Immunol. 2015, 48, 618–624. [Google Scholar] [CrossRef]
- Roberts, M.T.M.; Enoch, D.A.; Harris, K.A.; Karas, J.A. Aeromonas veronii biovar sobria bacteraemia with septic arthritis confirmed by 16S rDNA PCR in an immunocompetent adult. J. Med. Microbiol. 2006, 55, 241–243. [Google Scholar] [CrossRef]
- Mencacci, A.; Cenci, E.; Mazzolla, R.; Farinelli, S.; D’Alò, F.; Vitali, M.; Bistoni, F. Aeromonas veronii biovar veronii septicaemia and acute suppurative cholangitis in a patient with hepatitis B. J. Med. Microbiol. 2003, 52, 727–730. [Google Scholar] [CrossRef] [PubMed]
- Chim, H.; Song, C. Aeromonas infection in critically ill burn patients. Burns 2007, 33, 756–759. [Google Scholar] [CrossRef]
- Wu, C.J.; Wu, J.J.; Yan, J.J.; Lee, H.C.; Lee, N.Y.; Chang, C.M.; Shih, H.I.; Wu, H.M.; Wang, L.R.; Ko, W.C. Clinical significance and distribution of putative virulence markers of 116 consecutive clinical Aeromonas isolates in southern Taiwan. J. Microbiol. Immunol. 2007, 54, 151–158. [Google Scholar] [CrossRef] [PubMed]
- Castro-Escarpulli, G.; Figueras, M.J.; Aguilera-Arreola, G.; Soler, L.; Fernandez-Rendon, E.; Aparicio, G.O.; Guarro, J.; Chacon, M.R. Characterisation of Aeromonas spp. isolated from frozen fish intended for human consumption in Mexico. Int. J. Food Microbiol. 2003, 84, 41–49. [Google Scholar] [CrossRef]
- Stratev, D. Microbiological status of fish products on retail markets in the Republic of Bulgaria. Int. Food Res. J. 2015, 22, 64–69. [Google Scholar]
- Hossain, S.; De Silva, B.C.J.; Dahanayake, P.S.; Heo, G.J. Characterization of virulence properties and multi-drug resistance profiles in motile Aeromonas spp. isolated from zebrafish (Danio rerio). Lett. Appl. Microbiol. 2018, 67, 598–605. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Zhang, X.; Gao, X.; Jiang, Q.; Wen, Y.; Lin, L. Characterization of Virulence Properties of Aeromonas veronii Isolated from Diseased Gibel Carp (Carassius gibelio). Int. J. Mol. Sci. 2016, 17, 496. [Google Scholar] [CrossRef] [PubMed]
- Ran, C.; Qin, C.; Xie, M.; Zhang, J.; Li, J.; Xie, Y.; Wang, Y.; Li, S.; Liu, L.; Fu, X.; et al. Aeromonas veronii and aerolysin are important for the pathogenesis of motile aeromonad septicemia in cyprinid fish. Environ. Microbiol. 2018, 20, 3442–3456. [Google Scholar] [CrossRef]
- George, M. Bergey’s Manual of Systematic Bacteriology, 2nd ed.; Springer: New York, NY, USA, 2005; Volume 2. [Google Scholar]
- Bian, Y.; Qian, H.W.; Meng, Q.F.; He, D.C.; Seduli, B.; Shan, X.F.; Kang, Y.H.; Wang, W.L.; Qian, A.D. Development of duplex PCR for detection of Aeromonas veronii. Chin. J. Prev. Vet. Med. 2013, 35, 304–307. [Google Scholar]
- Nawaz, M.; Khan, S.A.; Khan, A.A.; Sung, K.; Tran, Q.; Kerdahi, K.; Steele, R. Detection and characterization of virulence genes and integrons in Aeromonas veronii isolated from catfish. Food Microbiol. 2010, 27, 327–331. [Google Scholar] [CrossRef]
- Reed, L.J.; Muench, H. A simple method of estimating fifty percent enpoints. Am. J. Epidemiol. 1938, 27, 493–497. [Google Scholar] [CrossRef]
- Kozińska, A.; Figueras, M.J.; Chacon, M.R.; Soler, L. Phenotypic characteristics and pathogenicity of Aeromonas genomospecies isolated from common carp (Cyprinus carpio L.). J. Appl. Microbiol. 2002, 93, 1034–1041. [Google Scholar] [CrossRef]
- Rahman, M.; Colque-Navarro, P.; Kuhn, I.; Huys, G.; Swings, J.; Mollby, R. Identification and characterization of pathogenic Aeromonas veronii biovar sobria associated with epizootic ulcerative syndrome in fish in Bangladesh. Appl. Environ. Microb. 2002, 68, 650–655. [Google Scholar] [CrossRef] [PubMed]
- Gui, M.; Wu, R.; Liu, L.; Wang, S.; Zhang, L.; Li, P. Effects of quorum quenching by AHL lactonase on AHLs, protease, motility and proteome patterns in Aeromonas veronii LP-11. Int. J. Food Microbiol. 2017, 252, 61–68. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.X.; Kang, Y.H.; Chen, L.; Siddiqui, S.A.; Wang, C.F.; Qian, A.D.; Shan, X.F. Oral immunization with recombinant Lactobacillus casei expressing OmpAI confers protection against Aeromonas veronii challenge in common carp, Cyprinus carpio. Fish Shellfish Immunol. 2018, 72, 552–563. [Google Scholar] [CrossRef]
- Ottaviani, D.; Parlani, C.; Citterio, B.; Masini, L.; Leoni, F.; Canonico, C.; Sabatini, L.; Bruscolini, F.; Pianetti, A. Putative virulence properties of Aeromonas strains isolated from food, environmental and clinical sources in Italy: A comparative study. Int. J. Food Microbiol. 2011, 144, 538–545. [Google Scholar] [CrossRef]
- Sung, H.H.; Hwang, S.F.; Tasi, F.M. Responses of giant freshwater prawn (Macrobrachium rosenbergii) to challenge by two strains of Aeromonas spp. J. Invertebr. Pathol. 2000, 76, 278–284. [Google Scholar] [CrossRef]
- Cai, S.H.; Wu, Z.H.; Jian, J.C.; Lu, Y.S.; Tang, J.F. Characterization of pathogenic Aeromonas veronii bv. veronii associated with ulcerative syndrome from chinese longsnout catfish (Leiocassis longirostris Günther). Braz. J. Microbiol. 2012, 43, 382–388. [Google Scholar] [CrossRef]
- Janda, J.M.; Abbott, S.L. The genus Aeromonas: Taxonomy, pathogenicity, and infection. Clin. Microbiol. Rev. 2010, 23, 35–73. [Google Scholar] [CrossRef]
- Nawaz, M.; Sung, K.; Khan, S.A.; Khan, A.A.; Steele, R. Biochemical and molecular characterization of tetracycline-resistant Aeromonas veronii isolates from catfish. Appl. Environ. Microb. 2006, 72, 6461–6466. [Google Scholar] [CrossRef]
- Skwor, T.; Shinko, J.; Augustyniak, A.; Gee, C.; Andraso, G. Aeromonas hydrophila and Aeromonas veronii predominate among potentially pathogenic ciprofloxacin- and tetracycline-resistant Aeromonas isolates from Lake Erie. Appl. Environ. Microb. 2014, 80, 841–848. [Google Scholar] [CrossRef] [PubMed]
- Kang, Y.H.; Pan, X.; Xu, Y.; Siddiqui, S.A.; Wang, C.F.; Shan, X.F.; Qian, A.D. Complete genome sequence of the fish pathogen Aeromonas veronii TH0426 with potential application in biosynthesis of pullulanase and chitinase. J. Biotechnol. 2016, 227, 81–82. [Google Scholar] [CrossRef] [PubMed]
- Patel, B.; Kumari, S.; Banerjee, R.; Samanta, M.; Das, S. Disruption of the quorum sensing regulated pathogenic traits of the biofilm-forming fish pathogen Aeromonas hydrophila by tannic acid, a potent quorum quencher. Biofouling 2017, 33, 580–590. [Google Scholar] [CrossRef] [PubMed]
- Reyes-Becerril, M.; Sanchez, V.; Delgado, K.; Guerra, K.; Velazquez, E.; Ascencio, F.; Angulo, C. Caspase-1, -3, -8 and antioxidant enzyme genes are key molecular effectors following Vibrio parahaemolyticus and Aeromonas veronii infection in fish leukocytes. Immunobiology. 2018, 223, 562–576. [Google Scholar] [CrossRef]
- González-Serrano, C.J.; Santos, J.A.; García-López, M.L.; Otero, A. Virulence markers in Aeromonas hydrophila and Aeromonas veronii biovar sobria isolates from freshwater fish and from a diarrhoea case. J. Appl. Microbiol. 2002, 93, 414–419. [Google Scholar] [CrossRef]
- Abu-Elala, N.; Abdelsalam, M.; Marouf, S.; Setta, A. Comparative analysis of virulence genes, antibiotic resistance and gyrB-based phylogeny of motile Aeromonas species isolates from Nile tilapia and domestic fowl. Lett. J. Appl. Microbiol. 2015, 61, 429–436. [Google Scholar] [CrossRef]
- Dong, H.T.; Techatanakitarnan, C.; Jindakittikul, P.; Thaiprayoon, A. Aeromonas jandaei and Aeromonas veronii caused disease and mortality in Nile tilapia, Oreochromis niloticus (L.). J. Fish Dis. 2017, 40, 1395–1403. [Google Scholar] [CrossRef]
- Seppola, M.; Mikkelsen, H.; Johansen, A.; Steiro, K.; Myrnes, B.; Nilsen, I. Ultrapure LPS induces inflammatory and antibacterial responses attenuated in vitro by exogenous sera in Atlantic cod and Atlantic salmon. Fish Shellfish Immunol. 2015, 44, 66–78. [Google Scholar] [CrossRef]
- Chen, X.; Schauder, S.; Potier, N.; Van Dorsselaer, A.; Pelczer, I.; Bassler, B.L.; Hughson, F.M. Structural identification of a bacterial quorum-sensing signal containing boron. Nature 2002, 415, 545–549. [Google Scholar] [CrossRef]
- Chandrarathna, H.P.S.U.; Nikapitiya, C.; Dananjaya, S.H.S.; Wijerathne, C.U.B.; Wimalasena, S.H.M.P.; Kwun, H.J.; Heo, G.J.; Lee, J.; De Zoysa, M. Outcome of co-infection with opportunistic and multidrug resistant Aeromonas hydrophila and A. veronii in zebrafish: Identification, characterization, pathogenicity and immune responses. Fish Shellfish Immunol. 2018, 80, 573–581. [Google Scholar] [CrossRef]
- Chung, W.O.; Park, Y.; Lamont, R.J.; McNab, R.; Barbieri, B.; Demuth, D.R. Signaling system in Porphyromonas gingivalis based on a LuxS protein. J. Bacteriol. 2001, 183, 3903–3909. [Google Scholar] [CrossRef] [PubMed]
- Frias, J.; Olle, E.; Alsina, M. Periodontal pathogens produce quorum sensing signal molecules. Infect. Immun. 2001, 69, 3431–3434. [Google Scholar] [CrossRef] [PubMed]
- Azakami, H.; Teramura, I.; Matsunaga, T.; Akimichi, H.; Noiri, Y.; Ebisu, S.; Kato, A. Characterization of autoinducer 2 signal in Eikenella corrodens and its role in biofilm formation. J. Biosci. Bioeng. 2016, 102, 110–117. [Google Scholar] [CrossRef] [PubMed]
- Learman, D.R.; Yi, H.; Brown, S.D.; Martin, S.L.; Geesey, G.G.; Stevens, A.M.; Hochella, M.F. Involvement of Shewanella oneidensis MR-1 LuxS in biofilm development and sulfur metabolism. Appl. Environ. Microb. 2009, 75, 1301–1307. [Google Scholar] [CrossRef]
- Schauder, S.; Shokat, K.; Surette, M.G.; Bassler, B.L. The LuxS family of bacterial autoinducers: Biosynthesis of a novel quorum-sensing signal molecule. Mol. Microbiol. 2001, 41, 463–476. [Google Scholar] [CrossRef]

| Fish Species | Supermarket | Aquatic Market | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | Total | 1 | 2 | 3 | 4 | 5 | Total | |
| Carassius auratus | 3 | 3 | 2 | 4 | 3 | 15 | 2 | 2 | 3 | 2 | 3 | 12 |
| Ctenopharyngodon idella | 3 | 4 | 2 | 3 | 3 | 15 | 3 | 3 | 2 | 2 | 4 | 14 |
| Cyprinus carpio | 2 | 2 | 3 | 4 | 3 | 14 | 2 | 2 | 3 | 2 | 3 | 12 |
| Silurus asotus | 2 | 0 | 2 | 2 | 0 | 6 | 2 | 1 | 2 | 2 | 1 | 8 |
| Total | 10 | 9 | 9 | 13 | 9 | 50 | 9 | 8 | 10 | 8 | 11 | 46 |
| Fish Species | Supermarket | Aquatic Market | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 2 | 3 | 4 | 5 | Total | 1 | 2 | 3 | 4 | 5 | Total | |
| Carassius auratus | 3 | 3 | 3 | 3 | 2 | 14 | 2 | 3 | 2 | 3 | 4 | 14 |
| Ctenopharyngodon idella | 3 | 2 | 3 | 3 | 3 | 14 | 3 | 3 | 3 | 2 | 3 | 14 |
| Cyprinus carpio | 4 | 3 | 3 | 2 | 2 | 14 | 3 | 3 | 2 | 3 | 4 | 15 |
| Silurus asotus | 3 | 2 | 3 | 2 | 3 | 13 | 3 | 2 | 3 | 2 | 4 | 14 |
| Total | 13 | 10 | 12 | 10 | 10 | 55 | 11 | 11 | 10 | 10 | 15 | 57 |
| Target Gene | PCR Primer Sequence (5′–3′) | Size of Target Fragments (bp) | Annealing Temperature (°C) |
|---|---|---|---|
| 16S rDNA | P1: GGGATAACTACTGGAAACGGTA P2: GAAGGCACTCCCGTATCTCTA | 886 | 56 |
| aer | P1: CCTATGGCCTGAGCGAGAAG P2: CCAGTTCCAGTCCCACCACT | 431 | 56 |
| act | P1: GAGAAGGTGACCACCAAGAACA P2: AACTGACATCGGCCTTGAACTC | 232 | 60 |
| ser | P1: CTCCTACTCCAGCGTCGGC P2: GATCGTCGGTGCGGTTGT | 128 | 64 |
| Aha | P1: GGCTATTGCTATCCCGGCTCTGTT P2: CGGTCCACTCGTCGTCCATCTTG | 1082 | 60.4 |
| lip | P1: CACCTGGT(T/G)CCGCTCAAG P2: GTACCGAACCAGTCGGAGAA | 247 | 56 |
| exu | P1: AGACATGCACAACCTCTTCC P2: GATTGGTATTGCC(C/T)TGCAA | 323 | 56 |
| LuxS | P1: GATCCTCTCCGAGGCGTGG P2: AGGCTTTTCAGCTTCTCTTCC | 369 | 58 |
| Fingerling | Supermarkets | Aquatic Markets | Separation RRate | ||
|---|---|---|---|---|---|
| Spring | Summer | Spring | Summer | ||
| Carassius auratus | 3/31 (9.68%) | 5/30 (16.67%) | 8/33 (24.24%) | 14/34 (41.18%) | 23.44% |
| Ctenopharyngodon idella | 3/30 (10.00%) | 4/32 (12.50%) | 9/29 (31.03%) | 10/30 (33.33%) | 21.49% |
| Cyprinus carpio | 3/29 (10.34%) | 5/31 (16.52%) | 7/31 (22.58%) | 8/31 (25.81%) | 18.85% |
| Silurus asotus | 0/33 (0.00%) | 2/31 (6.45%) | 2/30 (6.67%) | 4/31 (12.90%) | 6.40% |
| Season | Number of Species Carrying Virulence Genes | ||||||
|---|---|---|---|---|---|---|---|
| 0 | 1 | 2 | 3 | 4 | 5 | 6 | |
| Spring | 0 (0.00%) | 2 (5.71%) | 4 (11.43%) | 6 (17.14%) | 9 (25.71%) | 12 (34.29%) | 2 (5.71%) |
| Summer | 1 (1.92%) | 3 (5.77%) | 9 (17.31%) | 17 (32.69%) | 13 (25.00%) | 9 (17.31%) | 0 (0.00%) |
| Location | Number of Species Carrying Virulence Genes | ||||||
|---|---|---|---|---|---|---|---|
| 0 | 1 | 2 | 3 | 4 | 5 | 6 | |
| Supermarkets | 1 (3.70%) | 3 (11.11%) | 4 (14.81%) | 8 (29.63%) | 6 (22.22%) | 5(18.52%) | 0 (0.00%) |
| Aquatic markets | 0 (0.00%) | 2 (3.33%) | 9 (15.00%) | 15 (25.00%) | 16 (26.67%) | 16 (26.67%) | 2 (3.33%) |
| Strains Name | Virulence Genotype | LD50 (CFU·mL−1) |
|---|---|---|
| CC7282-3 | aer−ser−act−Aha−exu−lip− | \ |
| SL7231-1 | aer+ser−act−Aha−exu−lip− | 4.51 × 109 |
| CC7281-2 | aer+ser+act−Aha−exu−lip− | 3.22 × 108 |
| SL7232-1 | aer+ser+act+Aha−exu−lip− | 4.27 × 107 |
| SJ7231-3 | aer+ser+act+Aha+exu−lip− | 1.21 × 107 |
| SN7252-4 | aer+ser+act+Aha+exu+lip− | 6.42 × 106 |
| SC4122-5 | aer+ser+act+Aha+exu+lip+ | 4.17 × 106 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, T.; Raza, S.H.A.; Yang, B.; Sun, Y.; Wang, G.; Sun, W.; Qian, A.; Wang, C.; Kang, Y.; Shan, X. Aeromonas veronii Infection in Commercial Freshwater Fish: A Potential Threat to Public Health. Animals 2020, 10, 608. https://doi.org/10.3390/ani10040608
Li T, Raza SHA, Yang B, Sun Y, Wang G, Sun W, Qian A, Wang C, Kang Y, Shan X. Aeromonas veronii Infection in Commercial Freshwater Fish: A Potential Threat to Public Health. Animals. 2020; 10(4):608. https://doi.org/10.3390/ani10040608
Chicago/Turabian StyleLi, Tong, Sayed Haidar Abbas Raza, Bintong Yang, Yufeng Sun, Guiqin Wang, Wuwen Sun, Aidong Qian, Chunfeng Wang, Yuanhuan Kang, and Xiaofeng Shan. 2020. "Aeromonas veronii Infection in Commercial Freshwater Fish: A Potential Threat to Public Health" Animals 10, no. 4: 608. https://doi.org/10.3390/ani10040608
APA StyleLi, T., Raza, S. H. A., Yang, B., Sun, Y., Wang, G., Sun, W., Qian, A., Wang, C., Kang, Y., & Shan, X. (2020). Aeromonas veronii Infection in Commercial Freshwater Fish: A Potential Threat to Public Health. Animals, 10(4), 608. https://doi.org/10.3390/ani10040608

