Next Article in Journal
Effects of Farrowing Stall Layout and Number of Heat Lamps on Sow and Piglet Production Performance
Previous Article in Journal
Influences of Immunocastration on Endocrine Parameters, Growth Performance and Carcass Quality, as Well as on Boar Taint and Penile Injuries
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effect of Carotenoids, Oligosaccharides and Anthocyanins on Growth Performance, Immunological Parameters and Intestinal Morphology in Broiler Chickens Challenged with Escherichia coli Lipopolysaccharide

1
Department of Animal Science, Institute of Animal Science, Biotechnology and Nature Conservation, Faculty of Agricultural and Food Sciences and Environmental Management, University of Debrecen, 4032 Debrecen, Hungary
2
Doctoral School of Animal Science, University of Debrecen, 4032 Debrecen, Hungary
3
Department of Human Genetics, Institute of Microbiomics, Faculty of Medicine, University of Debrecen, 4032 Debrecen, Hungary
4
Department of Feed and Food Biotechnology, Institute of Animal Science, Biotechnology and Nature Conservation, Faculty of Agricultural and Food Sciences and Environmental Management, University of Debrecen, 4032 Debrecen, Hungary
5
Department of Laboratory of Animal Genetics, Institute of Animal Science, Biotechnology and Nature Conservation, Faculty of Agricultural and Food Sciences and Environmental Management, University of Debrecen, 4032 Debrecen, Hungary
6
Institute of Food Technology, Faculty of Agricultural and Food Sciences and Environmental Management, University of Debrecen, 4032 Debrecen, Hungary
7
Department of Medical Chemistry, Faculty of Medicine, University of Debrecen, 4032 Debrecen, Hungary
8
Farm and Regional Research Institute of Debrecen, University of Debrecen, 4032 Debrecen, Hungary
*
Authors to whom correspondence should be addressed.
Animals 2020, 10(2), 347; https://doi.org/10.3390/ani10020347
Submission received: 4 February 2020 / Accepted: 18 February 2020 / Published: 21 February 2020
(This article belongs to the Section Poultry)

Simple Summary

In recent years, substitution or reduction of antibiotic application has become a general aim in poultry industry, after concerns about multiresistant bacteria appeared. Accordingly, many natural compounds are used as potential immunostimulants to enhance immune responses. In this research, the effects of carotenoids, oligosaccharides and anthocyanins were investigated on chicken inflammatory cytokines and receptors. Being part of the innate immune system, cytokines are peptides which take part in signaling processes between cells and regulate inflammatory responses. Toll-like receptors are cell surface receptors which bind to antigens specifically. Gene expression levels of some cytokines such as interleukin-1β, interleukin-6, interferon-α, interferon-γ and toll-like receptors such as toll-like receptor 4, toll-like receptor 5 were evaluated in chicken spleen and ileum by Real Time Polymerase Chain Reaction (Real Time PCR) analyses. Relative gene expression level of splenic interleukin-1β decreased in carotenoid-, oligosaccharide- and anthocyanin treated chickens, and relative mRNA level of splenic interleukin-6 was lower in birds fed carotenoid supplement, which could represent a beneficial effect of mentioned natural compounds. Effects of compounds were also examined on gut morphology, where natural agents may result in better absorptive functions.

Abstract

This study was conducted to investigate the effect of carotenoid, oligosaccharide and anthocyanin supplementation in broiler diets under Escherichia coli lipopolysaccharide (LPS) challenge. Ross 308 chickens were fed 5 diets: basal diet (control diet), diet supplemented with β-glucan in 0.05% (positive control) and diets with 0.5% carotenoid-, oligosaccharide- or anthocyanin contents. On the 26th days of age, chickens were challenged intraperitoneally 2 mg LPS per kg of body weight. 12 h after injection, birds were euthanized, then spleen and ileum samples were collected. LPS induced increased relative mRNA expression of splenic (p = 0.0445) and ileal (p = 0.0435) interleukin-1β (IL-1β), which was lower in the spleen in carotenoid (p = 0.0114), oligosaccharide (p = 0.0497) and anthocyanin (p = 0.0303)-treated chickens compared to LPS-injected control birds. Dietary supplementation of carotenoids also decreased relative gene expression of splenic interleukin-6 (IL-6) (p = 0.0325). In the ileum, β-glucan supplementation showed lower relative mRNA expression of toll-like receptor 5 (TLR-5) (p = 0.0387) compared to anthocyanin treatment. Gene expression of both splenic and ileal interferon-α (IFN-α), interferon-γ (IFN-γ), toll-like receptor 4 (TLR-4) and toll-like receptor 5 (TLR-5) were not influenced by dietary supplements. In conclusion, carotenoids, oligosaccharides and anthocyanins could partially mitigate the immune stress caused by LPS challenge. All of the compounds impacted longer villus height (p < 0.0001), villus height:crypt depth ratios were higher after β-glucan (p < 0.0001) and anthocyanin (p = 0.0063) supplementations and thickened mucosa was observed in β-glucan (p < 0.0001), oligosaccharide (p < 0.0001) and anthocyanin (p = 0.048) treatments. All of these findings could represent a more effective absorption of nutrients.

1. Introduction

Health status and performance of farm animals can be affected by numerous diseases. Among illnesses, bacterial infections of poultry such as salmonellosis and coccidiosis, are prevented by antibiotics [1,2]. Application of antibiotics in agriculture has led to increasing concerns due to resistance in pathogens [3]. Resistant bacteria can be transferred to human population from livestock directly and human health can be also influenced by contaminated foodstuffs. Horizontal gene transfer is another route to receive resistance genes from agriculture into human pathogenic bacteria [4]. Previous studies showed that fluoroquinolone-resistant Campylobacter spread by chicken contamination [5], clinical infections caused by resistant zoonotic pathogens, such as Salmonella and Campylobacter, methicillin-resistant Staphylococcus aureus transmission among human population [4] and carbapenem-resistant Enterobacteriace with easily transferable resistance gene (NDM) originated from chicken [6] exemplify the prevalence of antibiotic resistance in agriculture, which led to antibiotic regulations worldwide [4].
Therefore, many natural agents have been investigated as potential immunomodulators in recent years to substitute or reduce the amount of antimicrobial drugs [7,8,9]. The immunostimulant impact of β-glucan (yeast cell wall extract) has been proved [10]. Live yeast could reduce levels of pro-inflammatory cytokines as interferon-γ (IFN-γ) and interleukin-1β (IL-1β) levels in pigs [11,12] and increase anti-inflammatory interleukin-10 (IL-10) mRNA expression in chicken [13]. Therefore, it is widely used in the poultry industry to improve both the humoral and cellular immune responses and to strengthen the defense system [14].
Other possible compounds can be applied in the diet to modulate the immune system by boosting immune responses [15]. Carotenoids are pigments which produce the bright yellow, red and orange colors in plants [16]. These pigments can function as antioxidants and immunomodulators, as well [17]. Some of their compounds, e.g., astaxanthin showed an anti-inflammatory effect in LPS-stimulated mice when expression of pro-inflammatory cytokines, as tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) were inhibited [18]. Other xanthophylls could also decrease gene expression levels of pro-inflammatory interleukin-1β (IL-1β), interleukin-6 (IL-6) and interferon-γ (IFN-γ) in hens [19]. Oligosaccharides are natural components of vegetable or fruit extracts. Several oligosaccharides, such as fructooligosaccharides, mannan-oligosaccharides or galactooligosaccharides cannot be digested in the intestine of monogastrics. Rather, they reach the colon and are fermented by useful microorganisms [20]. Therefore, these oligosaccharides are often used as prebiotics as they represent natural alternatives to antibiotic growth promoters (AGPs), can enhance production performance and stimulate the immune system [21,22,23,24]. Some of these oligosaccharides, such as fructooligosaccharides and mannan-oligosaccharides are reported to improve intestinal structures as well [25,26,27]. Anthocyanins are a group of flavonoids found in berries to produce the colors red, purple or blue [28]. Today, anthocyanins are being applied as feed components because of their possible antioxidant, anti-inflammatory and immunostimulant properties. Yet, their effects on avians are less known [29]. A few studies have shown that anthocyanin-rich-fragments could inhibit the expressions of pro-inflammatory cytokines in mice [28].
As part of the innate and acquired immunity, cytokines act as extracellular signals between cells during the immune responses [30]. Interleukin-1β is a pro-inflammatory cytokine [31]. It plays a role in inflammatory reactions and activates macrophages and T cells [32,33,34,35]. Similar to IL-1β, IL-6 is another pro-inflammatory cytokine [36]. IFN-α is a member of interferon family and has antiviral function [37,38]. Upregulation of this primary factor of innate immunity signs viral infection of the host and involves high expressions of other genes that have role in antiviral immune response [39]. IFN-γ is another pro-inflammatory cytokine, which stimulates the macrophages and produced by Th1 cells [8,40]. Toll-like receptors are type I transmembrane proteins and perceive the occurrence of pathogen associated molecular patterns (PAMPs) and are important for innate immunity [41,42]. Toll-like receptor 4 (TLR-4) recognizes lipopolysaccharide (LPS) from Gram negative bacteria and toll-like receptor 5 (TLR-5) recognizes bacterial flagellin, a sub-unit of the bacterial flagellum [43,44]. Furthermore, bacterial TLR agonists (lipopolysaccharide and flagellin) enhance expression levels of additional pro-inflammatory cytokines as IL-1β and IL-6 [45]. Due to the correlation among toll-like receptors and pro-inflammatory cytokines, as well as the limited studies available investigating feed supplements on chicken TLRs, the mentioned immunological parameters were involved in our study.
To our knowledge, the impacts of the bioactive compounds applied in the current study have yet to be examined elsewhere in poultry. Therefore, cytokine and toll-like receptor gene expression analysis and intestinal morphometric measurements were carried out in chicken under Escherichia coli lipopolysaccharide challenge.

2. Materials and Methods

2.1. Ethical Approval

Experiments were confirmed by University of Debrecen Committee of Animal Welfare, Hungary (Permit number: DEMAB/12-7/2015).

2.2. Birds and Housing

A total of 900, 1-day old Ross 308 mixed-sex broilers were used from a commercial hatchery in Hungary. The experiment was carried out on the experimental farm of University of Debrecen, Farm and Regional Research Institute. All broilers were placed in the same barn. Chickens were kept in floor pens covered with wood shavings in a thermostatically controlled house at a stocking density of 650 cm2/bird. Temperature was 32 °C at placement and gradually decreased by 1.5 °C/week. The birds were exposed to light according to Olanrewaju et al. [46] as follows: 23L:1D during the first 7 days, 20L:4D between 8−28 days and 23L:1D between 29−42 days (L = light, D = dark).

2.3. Evaluated Parameters and Used Methods

Effect of β-glucan (positive control), carotenoid, oligosaccharide and anthocyanin supplements were examined on growth performance, such as body weight (BW), average daily gain (ADG) and average daily feed intake (ADFI). Effects of the supplements were also investigated on chicken cytokines and toll-like receptors gene expressions, such as interleukin-1β, interleukin-6, interferon-α, interferon-γ, toll-like receptor 4 and toll-like receptor 5 under Escherichia coli lipopolysaccharide (LPS) challenge. For gene expression analysis, total RNA was isolated with commercially available kit (Zymo Research, Orange, CA, USA) from spleen and ileum samples, RNA concentrations were measured with NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and RNA integrity was checked by 1% agarose gel electrophoresis. RNA was reverse transcribed into cDNA, then qPCR reactions were carried out and results were generated using the Pfaffl method [47]. Small intestinal morphometric parameters, as villus height, crypt depth, villus height:crypt depth ratio (VH:CD ratio) and total mucosa thickness were also measured to investigate the effects of natural compounds and LPS challenge. For tissue morphology, formalin-preserved ileal tissues were used for hematoxylin-eosin stain [48], then Zeiss SteReo V8 microscope (Carl Zeiss, Jena, Germany) paired with a Zeiss camera (Carl Zeiss, Jena, Germany) was applied to capture images of stained ileal segments. Morphometric parameters were measured according to Munyaka et al. [49]. Each method is described in detail in the relevant subchapter.

2.4. Preparation and Determination of Extracts

2.4.1. Carotenoids

Hungarian red sweet pepper powder (in 1–5 g) was applied in triplicates to extract carotenoids and extraction was carried out with 50 mL dichloroethane:acetone:methanol as solvent mixture in 2:2:1 ratio. Next, the mixture was mixed in an ultrasonic water bath for 30 min, then filtered through a filter paper (Munktell-292). Afterwards, a 0.22 µm PTFE syringe filter (TPP Techno Plastic Products AG, Trasadingen, Switzerland) was used for further purification. Filtered residue was vaporized at 40 °C at 0.2 bar and then filtrate was solved in an high-performance liquid chromatographic (HPLC) pigment reagent (isopropanol:ACN:methanol in 55:35:10 proportion) (Merck, Darmstadt, Germany) [50]. A HPLC separation was performed on Phenomenex Kinetex® column (2.6 µm, XB-C18, 100 Å, 100 × 4.6 mm) (Phenomenex, Torrance, CA, USA) with 2 gradient elutions: A: 11% methanol, B: isopropanol:ACN:methanol (55:35:10 V/V/V%) mixture. Gradient elution steps were the following: 0–3 min solvent A 100%; 15–20 min solvent A 20%; 25–45 min solvent B 100%; 48–50 min solvent A 100%. Flow rate was 0.6 mL/min and Diode Array Detector (DAD) detection was carried out on 460 nm and 350 nm. Samples were injected in 10 µL and after DAD detection was applied at 460 nm and 350 nm. HPLC profile is shown in Figure 1. Carotenoid compounds with the greatest areas were identified and involved in Table 1.

2.4.2. Oligosaccharides

As natural prebiotics, oligosaccharides with high arabino-galactose content were extracted from Hungarian red sweet pepper retained from industrial food waste. A HP 5890 Gas chromatograph with SP-2380 capillary column (30 m × 0.25 mm, 0.2 µm) was used to evaluate the composition of oligosaccharides. Samples were lyophilized and extracted with a trifluoracetic acid:acetic acid:water in a 5:75:20 proportion as solvent. Before identification, oligosaccharides were turned into alditol-acetate. After reduction, sugars were changed to sugar alcohols (alditols) which eliminate interfering isomers and anomers. Reduction was performed with NaBH4 at alkaline pH. Acetylation was also carried out with acetic anhydride in pyridine. Feed gas was nitrogen at 1.2 mL/min flow rate. Injector temperature was 300 °C, split ratio was 1:20. After Flame Ionization Detector (FID) detection, monomer units of oligosaccharides were identified and involved in Table 2.

2.4.3. Anthocyanins

Anthocyanins were extracted from Hungarian sour cherry. After fruits were deseeded and homogenized, a methanol:water:acetic acid solution in 25:24:1 ratio was applied for extraction. Further processes involved mixing with Magnetic stirrer MSH 300 (BioSan, Riga, Latvia) through 1 h, filtering and centrifuging at 10,000 rpm for 5 min, then a simple fractionation was carried out in pre-conditioned tubes (Supelclean ENVI-18 SPE tubes). Tubes were conditioned with 5 mL MeOH first, then 5 mL H2O, then 1 mL of fruit sample was used. Elution was carried out with methanol including 20% H2O solution, and vaporized at 40 °C (BÜCHI ROTAVAPOR R-210, Flawil, Switzerland). Samples were dried in vacuum and anthocyanin extract reached powder formula. Determination of anthocyanin profile was carried out with VWR-Hitachi ChromasterUltraRs UHPLC (Hitachi, Tokyo, Japan) using a Phenomenex Kinetex® column (2.6 µm, XB-C18, 100 Å, 100 × 4.6 mm) (Phenomenex, Torrance, CA, USA). 2 solvents were A: MeOH and B: 3% formic acid. Gradient elution steps were the following: 0 min solvent A 15%; 0–25 min solvent A 30%; 25–30 min solvent A 40%; 30–40 min solvent A 50%. Flow rate was kept at 0.7 mL/min and temperature was 25 °C. Anthocyanin composition was quantified by comparison with the corresponding authentic standards. UV-VIS detection was performed at 535 nm and injection volume was 10 µL [51]. The main anthocyanin compounds are included in Table 3 [52].

2.5. Experimental Design, Dietary Treatments and Growth Performance

The 1-day old Ross 308 hybrid chicken were randomly placed into 5 experimental groups (3 pens/treatment, 60 birds/pen). The experiment was started at 1 day of age and lasted until 42 days of age. The dietary treatments consisted of the control group (basal diet), the β-glucan considered as positive control and supplementation of carotenoids, oligosaccharides or anthocyanins. β-glucan was added at 0.05% to the basal diet (Table 4), additional treatments included 0.5% of bioactive extracts. The basal diets (pre-starter, starter, grower, finisher) were corn-soybean meal diets. All diets were fed in mash form. Feed and water were available ad libitum during the entire experiment. Broilers were weighed at 1, 10, 21, 32, 42 days of age. As growth performance parameters, average body weight (BW), average daily gain (ADG) and average daily feed intake (ADFI) were calculated. On day 26, 6 male chickens per treatment were injected with 2 mg/kg liveweight Escherichia coli O55:B5 lipopolysaccharide (LPS) (L2880, Sigma, St. Louis, MO, USA) with a concentration in 2 mg/mL, intraperitoneally. In the control group, another 6 male chickens were inoculated with 2 mL/kg liveweight isotonic saline solution (B. Braun, Budapest, Hungary) in the same way [27].

2.6. Sample Collection and Lymphoid Organ Weight

On day 27, 12 h after challenge, individual bodyweight of broilers was measured, then all of the injected birds (n = 6/treatment; control: n = 6/saline and n = 6/LPS-inoculated) were euthanized by cervical dislocation for the collection of tissue samples. Spleen and terminal ileum tissues were aseptically excised, the whole spleen was measured then samples were snap-frozen in liquid nitrogen and stored at −80 °C for RNA isolation [27]. Further 1 cm segments from the terminal sections of ileum (n = 3/treatment) were collected and preserved in formalin (10% neutral-buffered formalin solution, Sigma-Aldrich, Hungary) for tissue morphology [53].

2.7. RNA Isolation and Reverse Transcription

Total RNA from spleen and ileum tissues was extracted using Direct-zol™ RNA MiniPrep (Zymo Research, Orange, CA, USA) according to the manufacturer’s protocol, including DNA digestion step. Concentration of the RNA in each sample was measured using a NanoDrop ND-1000 Spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). RNA integrity was checked by 1% agarose gel electrophoresis. 800 ng of the isolated RNA was reverse-transcribed using qPCR BIO cDNA Synthesis Kit (PCR Biosystems, London, UK) in 20 µL final volume containing oligo (dT)s, random hexamers and MMLV type reverse transcriptase. Conditions consisted of: reverse transcription 42 °C for 30 min and reverse transcriptase denaturation at 85 °C for 10 min. cDNA samples were diluted 10-fold and stored at −20 °C.

2.8. qPCR Analysis of Cytokine and Toll-Like Receptor Genes

Forward and reverse primers for chicken IL-1β, IL-6, IFN-α, IFN-γ, TLR-4 and TLR-5 (Table 5) were designed by Primer Express v3.0.1 software and checked for target identity using National Center for Biotechnology Information (NCBI) Primer Blast [54]. Quantitative PCR was performed by LightCycler 480 Instrument II (Roche Life Science, Penzberg, Germany), reactions were run in triplicates using 384-well plates (4titude, Surrey, UK). Each reaction included a 4 ng cDNA template, 2× Xceed qPCR SG Hi-ROX Mix (Institute of Applied Biotechnologies, Prague, Czech Republic), 200 nM of each primer and distilled water in 10 µL final volume. No template controls were included for each primer. Real Time PCR conditions were the following: initial denaturation at 95 °C for 2 min, 40 cycles of denaturation at 95 °C for 5 s and annealing/extension at 60 °C for 30 s. Raw fluorescent data were collected by LightCycler software 1.5.0 (Roche Life Science) then Ct values and main reaction efficiencies were determined with linear regression analyses on individual amplification curves by using LinReg PCR 2017.0 software. Among the most frequently used reference genes in chicken gene expression studies, stability of β-cytoskeletal actin (ACTB), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and 18S ribosomal RNA (RN18S) were analyzed by 3 algorithms, namely ΔCt, NormFinder, Best Keeper [55]. In spleen GAPDH, in ileum ACTB were considered as the most stabile genes for normalization. Results were generated using the Pfaffl method [47] by normalizing the expression of the target gene to a housekeeping gene. Results were determined as fold changes of the expression of the target genes in the experimental groups compared with LPS injected control group.

2.9. Intestine Morphometric Measurements

Formalin-preserved terminal ileal segments were used to determine villus height, crypt depth, villus height to crypt depth ratio (VH:CD ratio) and total mucosa thickness. Hematoxylin-eosin stain was carried out on 18 samples (n = 3 birds per treatment) [48]. Zeiss SteREO V8 (Carl Zeiss, Jena, Germany) microscope paired with a Zeiss Camera (Carl Zeiss, Jena, Germany) were used to capture images of stained segments. Photos were evaluated by Adobe Photoshop CC version 19.1.6 software. Height of villus was determined from the tip of the villus to the top of the lamina propria, the depth of the crypt was determined from the villus-crypt axis to the base of crypt and total mucosa thickness was measured from the top of the villus to the wall of intestine including villus height, crypt depth and muscolaris mucosa [49].

2.10. Statistical Analysis

The main effects of the bioactive compounds under immunological challenge were analyzed using One-way analysis of variance (one-way ANOVA) Tukey-test by GraphPad Prism 6.0.1 software. Differences among groups were considered significant at p < 0.05.

3. Results

3.1. Growth Performance

Dietary effects related to growth performance such as body weight (BW), average daily gain (ADG) and average daily feed intake (ADFI) were measured (Table 6). Among treatments, β-glucan supplementation had positive effect on BW of broilers compared to those birds in anthocyanin supplemented group on day 21, but no other treatments could affect BW compared to control treatment. ADG was not impacted by dietary treatments through the experimental period. ADFI was increased by anthocyanin supplementation under grower period (day 22–31). In addition, β-glucan, oligosaccharide and anthocyanin supplementations could increase ADFI through the experimental period (day 1–42) compared to the control.

3.2. Lymphoid Organ Weight

Relative weight of spleen compared to live weight (LW) did not show significant differences among treatments (Figure 2). Results were the following: control (saline): 0.100% of LW, control (LPS): 0.093% of LW, β-glucan: 0.100% of LW, carotenoids: 0.082% of LW, oligosaccharides: 0.091% of LW, anthocyanins: 0.082% of LW.

3.3. Cytokine and Toll-Like Receptor Gene Expression Analysis

Relative mRNA expression levels in spleen are shown in Figure 3. The results showed that β-glucan had no significant effect on splenic cytokine mRNA expressions of broiler chickens. Carotenoids decreased splenic IL-1β (p = 0.0114) and IL-6 (p = 0.0325) gene expressions compared to the LPS injected control group, but none of the splenic IFN-α, IFN-γ and TLR-4 were influenced by the treatment under the challenge. IL-1β gene expression was also inhibited (p = 0.0497) by oligosaccharide supplementation. No significant effects were observed on chicken splenic IL-6, IFN-α, IFN-γ or TLR-4 by oligosaccharide supplementation. Anthocyanins resulted in decreased IL-1β level (p = 0.0303), but levels of other cytokines, such as IL-6, IFN-α, IFN-γ, TLR-4, TLR-5 did not differ significantly compared to the control (LPS) group.
Results of ileal gene expression analyses are shown in Figure 4. In the terminal part of the ileum, supplementation of β-glucan inhibited TLR-5 gene expression (p = 0.0387) compared to the anthocyanin treatment, but no significant differences were observed in IL-1β-, IFN-α-, IFN-γ- and TLR-4 mRNA expression levels. Effects of carotenoids or oligosaccharides were not observed on ileal interleukin-, interferon- and toll-like receptor profiles. Anthocyanins did not affect ileal cytokine mRNA expressions either, but increased ileal TLR-5 mRNA expression was measured in anthocyanin treatment compared to β-glucan. Unlikely the spleen, IL-6 was not expressed in the ileum.

3.4. Intestine Morphometric Measurements

Ileal villus height was significantly higher in treatments of β-glucan (p < 0.0001), carotenoid (p < 0.0001), oligosaccharide (p < 0.0001) and anthocyanin (p < 0.0001) (Table 7). Height of villi did not differ significantly in control groups (p = 0.212). Significantly higher crypt depth was measured in oligosaccharide supplementation (p < 0.0001). Depth of crypt was lower in saline inoculated control group (p = 0.0009) compared to LPS inoculated birds. Crypt depth did not vary in β-glucan and anthocyanin treatments. Villus height to crypt depth (VH:CD) ratio was higher in β-glucan (p < 0.0001) and anthocyanin (p = 0.0063) supplementations contrasted to lipopolysaccharide injected control group. No difference in VH:CD ratio was observed in control-saline, carotenoid- and oligosaccharide supplemented diets. Higher total mucosa thickness of ileum was observed in β-glucan (p < 0.0001), oligosaccharide (p < 0.0001) and anthocyanin (p = 0.048) supplementations, but no variations were found in control-saline and carotenoid groups.

4. Discussion

Experiments were conducted to examine the effects of four bioactive compounds on growth performance, spleen weight, immunological parameters and intestinal morphology. The effect of feed supplemented with carotenoids, oligosaccharides, anthocyanins using Escherichia coli lipopolysaccharide challenge was investigated BW, ADG and ADFI of broiler chicken. None of the treatments impacted BW of chickens compared to control birds, but β-glucan could significantly impact the BW of broilers on day 21, compared to anthocyanin supplementation. Zhang et al. [7] proved the same, when β-1,3/1,6-glucan supplementations in 50 and 75 mg/kg could increase BW of chicken. None of the compounds applied in this study could increase ADG of chickens. Similarly, Rezaei et al. [56] defined no significant differences in ADG of broilers, when diet was supplemented using 0.5% and 1% oligosaccharides extract, which could have been due to the low concentration of the used supplementation. Thus, the growth and activity of beneficial bacteria could not have been promoted. In this study, anthocyanin supplementation increased ADFI between days 22–31, and β-glucan, oligosaccharides and anthocyanins additionally affected ADFI positively through the whole experimental period (day 1–42). Similarly, Zhang et al. [7] measured enhanced feed intake of chickens after 50 and 75 mg/kg β(1-3)(1-6)-d-glucan feed supplementations were used. Rezaei et al. [56] also reported altered animal production during the finisher period and through the entire experiment (day 1–35) after 1% oligosaccharide addition to diet, so higher feed efficiency was observed at oligosaccharide-fed birds compared to control ones.
Effects of mentioned supplementations were also examined on the weight of chicken spleen. Relative weight of spleen of broiler chickens were not different among diets supplemented with bioactive compounds. A similar result was reported by Shang et al. [27] who discussed healthy immune status of broiler chickens, when relative weights of spleen and bursa of the Fabricius of chicken did not differ significantly on day 21 when diet was supplemented with fructooligosaccharide and chickens challenged with Salmonella enteritidis lipopolysaccharide. Rathgeber et al. [57] also found that when diet was supplemented with β-glucan was not affected broiler spleen weights compared to body weight between the treatment and control groups on experimental days 14 and 38. Wang et al. [13] also reported live yeast addition did not affect spleen weights of broilers. Kamboh et al. [58] measured higher spleen indices (p < 0.01) in broilers under LPS challenge on day 21 when diet was supplemented with bioflavonoids (genistein and hesperidin = 1:4, 20 mg/kg), although spleen indices were not influenced when genistein and hesperidin were used at lower concentrations or alone.
β-glucan was applied as a positive control in this study, whereas previous ones reported it could maintain a beneficial immune status in chickens under a microbial challenge [59] and found β(1-3)(1-6)-d-glucan could reduce pro-inflammatory TNF-α and cortisol levels in serum. Another study showed yeast cell wall could increase the cutaneous hypersensitivity reaction, which was explained as an indirect factor in cellular immune response and a positive effect of yeast cell wall was defined [60]. Shen et al. [61] reported elevated effect of Saccharomicces cerevisiae supplementation in pigs that resulted in a low pro-inflammatory IFN-γ level in serum. Live yeast also reduced serum IL-1β level in pigs under LPS challenge [12]. Wang et al. [13] highlighted live yeast (S. cerevisiae) improved immune status of broilers infected with lipopolysaccharide by reduction of inflammatory interleukin-1β. In our study β-glucan neither have any effect on chicken splenic or ileal cytokines and receptors (IL-1β, IL-6, IFN-α, IFN-γ, TLR-4, TLR-5) compared to LPS-injected control birds. Similarly, Markazi et al. [9] found yeast cell wall products could not affect inflammatory IL-1β mRNA expression in chicken cecal tonsils under a coccidial challenge. Kumar et al. [62] also discussed that β-glucan treatment did not produce different expressions of IL-1β, TLR-4 and TLR-5 in chicken spleen compared to LPS challenged birds. However, this study shows β-glucan supplementation could decrease the ileal gene expression level of TLR-5 compared to anthocyanin-fed birds. Sheoran et al. [63] explained reduced TLR-5 mRNA expression with the decreasing colonization of pathogens and Shanmugasundaram et al. [64] reported whole yeast cell product supplementation could influence the growth of beneficial bacteria, such as Lactobacillus and Bifidobacterium. Therefore, downregulation of TLR-5 mRNA level in β-glucan treatment could have been due to the same fact in this study.
The effect of carotenoid supplementation was also investigated on chicken immune cytokines. As we predicted, both splenic and ileal IL-1β gene expression levels were high in LPS-injected birds compared to saline-inoculated controls, whereby Escherichia coli lipopolysaccharide could induce an acute immune response and a bacterial illness [8]. Munyaka et al. [49] found the same and reported higher IL-1β gene expression levels in spleens of lipopolysaccharide-injected chickens compared to saline-inoculated ones. In our study, carotenoids could inhibit splenic IL-1β gene expression, though it did not influence the ileal IL-1β gene expression level compared to lipopolysaccharide-treated control birds. Gao et al. [19] also examined the impact of xanthophyll—a class of carotenoids—on chicken pro-inflammatory cytokines in ileum and reported no significant effects of 20 or 40 mg/kg xanthophyll supplementation. Similar to IL-1β, up-regulation of pro-inflammatory IL-6 can be explained as an acute-phase reaction [65]. This study shows a high-expression of interleukin-6, and carotenoids could reach low gene expression level of IL-6 in the spleen. These results suggest carotenoids are useful in reducing the effect of inflammation through decreasing inflammatory parameters. Shanmugasundaram and Selvaraj et al. [66] discussed the same, when lutein supplementation decreased pro-inflammatory IL-1β gene expression in turkeys under LPS challenge.
The impact of oligosaccharides with high arabino-galactose content were also investigated in this study. Applied oligosaccharides could reach a low gene expression level of pro-inflammatory IL-1β in spleen, which result shows oligosaccharides can be also effective in mitigating the inflammation. It could not influence mRNA expression level of IL-1β in ileum.
The effects of anthocyanins were also examined on chicken immune response. Our research shows anthocyanins could reduce the amount of IL-1β mRNA in chicken spleen. Changxing et al. [29] also studied the effect of anthocyanins and described anthocyanin-supplementation could reduce cyclo-oxygenase-1 (COX-1) and cyclo-oxygenase (COX-2) inflammatory enzymes, which could inhibit expressions of pro-inflammatory interleukins. Anthocyanin-rich fragment was also applied by Li et al. [28] and it could prevent IL-1β mRNA expression in mice, similarly. These findings suggest the anti-inflammatory effect of anthocyanins confirmed by Carvalho et al. [67] when anthocyanin supplementation decreased the level of pro-inflammatory cytokines (IL-1β, IL-6, IFN-γ) in ethidium-bromide induced rats. Effect on ileal interleukin-1β gene expression level was not observed in our study.
Except carotenoids, no other compounds could influence splenic IL-6 gene expression. Accordingly, a study conducted to analyze the effect of galactoglucomannan oligosaccharide-arabinoxylan had no effect on mRNA expression of IL-6 in chicken spleen [68]. However, xylooligosaccharides at 2 g/kg in diet could reach a low IL-6 mRNA expression in cecal tonsils of chicken under Salmonella challenge [69]. In addition, none of carotenoids, oligosaccharides or anthocyanins influenced gene expression levels of splenic and ileal toll-like receptor 4 (TLR-4), ileal toll-like receptor 5 (TLR-5), splenic and ileal interferon-α (IFN-α) and splenic interferon-γ (IFN-γ) in the recent study. In our study, higher relative expression level of TLR-4 was expected in the control treatment that involved LPS challenge compared to control-saline birds, since Tan et al. [70] measured higher TLR-4 gene expression in spleen, when chickens were injected with LPS. In the same study, authors defined decreased TLR-4 expression when dietary supplementation was applied. Nevertheless, no significant differences were observed in spleen or ileum in our study. Similarly, Kumar et al. [62] identified that β-glucan in 0.10% could not alter TLR-4 mRNA expression in chicken spleen; however, no LPS challenge was involved in that study. Gene expression level of TLR-5 in this study was not altered significantly among the treatments. In contrast with our result, Sheoran et al. [63] experienced the down-regulation of TLR-5 mRNA in chicken blood, when mannan-oligosaccharide-based prebiotic product was applied at 0.5, 1 and 2 g/kg in the diet. Therefore, the impact of mannan-oligosaccharides in that study was discussed as it was capable of reducing colonization of Gram-negative pathogens, as well as those involving flagellin, such as E. coli or Salmonella spp. In this case, no significant differences were detected in IFN-α gene expression levels. In contrast, Khan et al. [71] studied higher IFN-α gene expression in spleen of laying hens under Infectious Bronchitis Virus (IBV) T strain challenge, so viral RNA was recognized and immune system of hens activated the defense mechanisms. Significant differences in splenic or ileal IFN-γ expressions were not measured among treatments. In contrast, Li et al. [72] showed increased IFN-γ gene expression level in spleen of chicken under LPS challenge. Cox et al. [73] also reported higher IFN-γ expression in intestinal segments of chicken challenged with Eimeira oocysts and expression level of mentioned cytokine was down-regulated by β-glucan supplementation. Pourabedin et al. [69] reported mannan-oligosaccharides supplementation in 1 g/kg in diet could inhibit the gene expression level of pro-inflammatory IFN-γ in chicken cecal tonsils under Salmonella enteritidis challenge and discussed that IFN-γ enhances the activation of macrophages and the production of nitric oxide.
Intestinal morphological measurements were also carried out to define changes in terminal ileum tissues which can refer to digestive functions. Increased villus heights and decreased depth of crypt can provide a larger surface for digestion and absorption of nutrients [49]. In our study, β-glucan, carotenoid, oligosaccharide and anthocyanin supplementation influenced positively the length of villus in terminal ileum segments which can point to a beneficial effect in absorption functions. Among treatments, oligosaccharides increased the depth of the crypt in the ileum. No other alterations were observed on crypt depth except in ileum of saline-injected birds where shorter crypt depth was measured, in contrast to the intestinal segments of LPS inoculated birds. Higher villus height to crypt depth ratios (VH:CD) were shown only in the β-glucan and anthocyanin treatment. Diets supplemented with β-glucan, oligosaccharide and anthocyanin thickened the mucosa. These findings indicate an increased absorption area in the ileum of treated birds. Similarly to our results, villus height, crypt depth and total mucosa thickness were significantly higher after 0.5% fructooligosaccharide supplementation in the diet of chickens challenged with Escherichia coli LPS [27]. Xu et al. [26] reported the same, when 0.4% fructooligosaccharide supplementation resulted in higher villus length and VH:CD ratio in ileum in broilers. Shanmugasundaram et al. [74] also reported higher VH:CD ratios in chicken fed yeast cell wall supplemented diet.

5. Conclusions

In conclusion, bioactive compounds, such as β-glucan, carotenoids, oligosaccharides and anthocyanins, could partially affect growth performance, inflammatory parameters and intestinal morphology in broilers under LPS challenge. β-glucan can be useful for improving the body weight of chickens, for maintaining beneficial microflora by eliminating pathogens and increasing the ileal absorption surface by influencing villus height, VH:CD ratio and total mucosa thickness. Carotenoids are being suggested to decrease inflammation through an acute phase response and to increase the villus length. Oligosaccharides could also alleviate an inflammatory parameter and additionally affect morphometric factors by improving villus length and mucosa thickness. Anti-inflammatory effect of anthocyanins is also proved by decreasing inflammation and effective absorption functions are also indicated by longer villi, increased VH:CD ratio and thickened mucosa.

Author Contributions

Conceptualization, S.B., L.S., J.R. and L.C.; Data curation, B.C., L.B. and G.P.-A.; Formal analysis, J.R. and L.C.; Funding acquisition, S.B., L.S. and J.R.; Investigation, B.C., J.O., G.P.-A. and L.C.; Methodology, B.C., L.B., P.B., J.O. and L.C.; Project administration, L.S.; Resources, I.K. and A.J.; Software, P.B.; Supervision, P.B. and J.O.; Validation, L.C.; Writing—original draft, B.C. and L.C.; Writing—review & editing, S.B., L.B., I.K. and J.R. All authors have read and agreed to the published version of the manuscript.

Funding

The work was supported by the GINOP-2.3.2-15-2016-00042 and EFOP-3.6.3-VEKOP-16-2017-00008, K123975, NKM-26/2019 projects. The projects are co-financed by the European Union and the European Social Fund. The research was financed by the Higher Education Institutional Excellence Programme (NKFIH-1150-6/2019) of the Ministry of Innovation and Technology in Hungary, within the framework of the Biotechnology thematic programme of the University of Debrecen.

Acknowledgments

The authors are grateful to Katalin Nagy (University of Debrecen) for hematoxylin-eosin stain and to Szabolcs Tarapcsák (University of Debrecen) for image capturing of stained ileal segments.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Klasing, K.C. Nutrition and the immune system. Br. Poult. Sci. 2007, 48, 525–537. [Google Scholar] [CrossRef] [PubMed]
  2. Zhang, B.; Guo, Y.; Wang, Z. The modulating effect of β-1,3/1,6-glucan supplementation in the diet on performance and immunological responses of broiler chickens. Asian-Australas. J. Anim. Sci. 2008, 21, 237–244. [Google Scholar] [CrossRef]
  3. Hoelzer, K.; Wong, N.; Thomas, J. Antimicrobial drug use in food-producing animals and associated human health risks: What, and how strong, is the evidence? BMC Vet. Res. 2017, 13, 211. [Google Scholar] [CrossRef] [PubMed]
  4. Chang, Q.; Wang, W.; Regev-Yochay, G.; Lipsitch, M.; Hanage, W.P. Antibiotics in agriculture and the risk to human health: How worried should we be? Evol. Appl. 2015, 8, 240–245. [Google Scholar] [CrossRef] [PubMed]
  5. Bartholomew, M.J.; Hollinger, K.; Vose, D. Characterizing the risk of antimicrobial use in food animals: Fluoroquinolone-resistant Campylobacter from consumption of chicken. In Microbial Food Safety in Animal Agriculture: Current Topics; Torrence, M.E., Isaacson, R.E., Eds.; Iowa State Press: Ames, IA, USA, 2003; pp. 293–301. [Google Scholar]
  6. Wang, Y.; Wu, C.; Zhang, Q.; Qi, J.; Liu, H.; Wang, Y.; He, T. Identification of New Delhi metallo-b-lactamase 1 in Acinetobacter lwoffii of food animal origin. PLoS ONE 2012, 7, e37152. [Google Scholar] [CrossRef] [PubMed]
  7. Zhang, X.; Zhao, L.; Cao, F.; Ahmad, H.; Wang, G.; Wang, T. Effects of feeding fermented Gingko biloba leaves on small intestinal morphology, absorption, and immunomodulation of early lipopolysaccharide-challenged chicks. Poult. Sci. 2013, 92, 119–130. [Google Scholar] [CrossRef] [PubMed]
  8. Wu, Q.J.; Wang, Y.Q.; QI, Y.X. Influence of procyanidin supplementation on the immune responses of broilers challenged with lipopolysaccharide. Anim. Sci. J. 2017, 88, 983–990. [Google Scholar] [CrossRef]
  9. Markazi, A.D.; Perez, V.; Sifri, M.; Shanmugasundaram, R.; Selvaraj, R.K. Effect of whole yeast cell product supplementation (CitriStim®) on immune responses and cecal microflora species in pullet and layer chickens during an experimental coccidial challenge. Poult. Sci. 2017, 96, 2049–2056. [Google Scholar] [CrossRef]
  10. Novak, M.; Vetvicka, V. β-Glucans, history, and the present: Immunomodulatory aspects and mechanisms of actions. J. Immunotoxicol. 2008, 5, 47–57. [Google Scholar] [CrossRef]
  11. Alexandra, C.; Weaver, M.; See, T.; Kim, S.W. Protective effect of two yeast-based feed additives on pigs chronically exposed to deoxynivalenol and zearalenone. Toxins 2014, 6, 3336–3353. [Google Scholar]
  12. Collier, C.T.; Carrol, J.A.; Ballou, M.A.; Starkey, J.D.; Sparks, J.C. Oral administration of Saccharomyces cerevisiae boulardii reduces mortality associated with immune and cortisol responses to Escherichia coli endotoxin in pigs. J. Anim. Sci. 2011, 89, 52–58. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, W.; Li, Z.; Ren, W.; Yue, Y.; Guo, Y. Effects of live yeast supplementation on lipopolysaccharide-induced inflammatory responses in broilers. Poult. Sci. 2016, 95, 2557–2564. [Google Scholar] [CrossRef] [PubMed]
  14. Shao, Y.; Wang, Z.; Tian, X.; Guo, Y.; Zhang, H. Yeast β-d-glucans induced antimicrobial peptide expressions against Salmonella infection in broiler chickens. Int. J. Biol. Macromol. 2016, 85, 573–584. [Google Scholar] [CrossRef] [PubMed]
  15. Wils-Plotz, E.L.; Klasing, K.C. Effects of immunomodulatory nutrients on growth performance and immune-related gene expression in layer chicks challenged with lipopolyssaccharide. Poult. Sci. 2017, 96, 548–555. [Google Scholar] [CrossRef] [PubMed]
  16. Feltl, L.; Pacakova, V.; Stulik, K.; Volka, K. Reliability of carotenoid analysis: A review. Curr. Anal. Chem. 2005, 1, 93–102. [Google Scholar] [CrossRef]
  17. Goodwin, T.W. Metabolism, nutrition, and function of carotenoids. Ann. Rev. Nutr. 1986, 6, 273–297. [Google Scholar] [CrossRef]
  18. Lee, S.-J.; Bai, S.-K.; Lee, K.-S.; Namkoong, S.; Na, H.-J.; Ha, K.-S.; Han, J.-A.; Yim, S.-V.; Chang, K.; Kwon, Y.-G.; et al. Astaxanthin Inhibits Nitric Oxide Production and Inflammatory Gene Expression by Suppressing IκB Kinase-dependent NF-κB Activation. Mol. Cells 2003, 16, 97–105. [Google Scholar]
  19. Gao, Y.-Y.; Xie, Q.-M.; Jin, L.; Sun, B.-L.; Ji, J.; Chen, F.; Ma, J.-Y.; Bi, Y.-Z. Supplementation of xanthophylls decreased proinflammatory and increased anti-inflammatory cytokines in hens and chicks. Br. J. Nutr. 2012, 108, 1746–1755. [Google Scholar] [CrossRef]
  20. Gomes, A.M.P.; Malcata, F.X. Bifidobacterium spp. and Lactobacillus acidophilus: Biological, biochemical, technological and therapeutical properties relevant for use as probiotics. Trends Food Sci. Technol. 1999, 10, 139–157. [Google Scholar] [CrossRef]
  21. Cross, D.E.; McDevitt, R.M.; Hillman, K.; Acamovic, T. The effect of herbs and their associated essential oils on performance, dietary digestibility and gut microflora in chickens from 7 to 28 days of age. Br. Poult. Sci. 2007, 48, 496–506. [Google Scholar] [CrossRef]
  22. Yang, Y.; Iji, P.A.; Kocher, A.; Mikkelsen, L.L.; Choct, M. Effects of mannanoligosaccharide and fructooligosaccharide on the response of broilers to pathogenic Escherichia coli challenge. Br. Poult. Sci. 2008, 49, 550–559. [Google Scholar] [CrossRef] [PubMed]
  23. Shashidhara, R.G.; Devegowda, G. Effect of dietary mannanoligosaccharide on broiler breeder production traits and immunity. Poult. Sci. 2003, 82, 1319–1325. [Google Scholar] [CrossRef] [PubMed]
  24. Guo, F.C.; Kwakkel, R.P.; Williams, B.A.; Parmentier, H.K.; Li, W.K.; Yang, Z.Q.; Verstegen, M.W.A. Effects of mushroom and herb polysaccharides on cellular and humoral immune responses of Eimeria tenella-infected chickens. Poult. Sci. 2004, 83, 1124–1132. [Google Scholar] [CrossRef] [PubMed]
  25. Iji, P.A.; Saki, A.A.; Tivey, D.R. Intestinal structure and function of broiler chickens on diets supplemented with a mannan oligosaccharide. J. Sci. Food Agric. 2001, 81, 1186–1192. [Google Scholar] [CrossRef]
  26. Xu, Z.R.; Hu, C.H.; Xia, M.S.; Zhan, X.A.; Wang, M.Q. Effects of dietary fructooligsaccharide on digestive enzyme activities, intestinal microflora and morphology of male broilers. Poult. Sci. 2003, 82, 1030–1036. [Google Scholar] [CrossRef] [PubMed]
  27. Shang, Y.; Regassa, A.; Kim, J.H.; Kim, W.K. The effect of dietary fructooligosaccharide supplementation on growth performance, intestinal morphology, and immune responses in broiler chickens challenged with Salmonella Enteritidis lipopolysaccharides. Poult.Sci. 2015, 94, 2887–2897. [Google Scholar] [CrossRef]
  28. Li, L.; Wang, L.; Wu, Z.; Yao, L.; Wu, Y.; Huang, L.; Liu, K.; Zhou, X.; Gou, D. Anthocyanin-rich fractions from red raspberries attenuate inflammation in both RAW264.7 macrophages and a mouse model of colitis. Sci. Rep. 2014, 4, 6234. [Google Scholar] [CrossRef]
  29. Changxing, L.; Chenling, M.; Alagawany, M.; Jianhua, L.; Dongfang, D.; Gaichao, W.; Wenyin, Z.; Syed, S.F.; Arain, M.A.; Saeed, M.; et al. Health benefits and potential applications of anthocyanins in poultry feed industry. World’s Poult. Sci. J. 2018, 74, 251–264. [Google Scholar] [CrossRef]
  30. Kaiser, P.; Stӓheli, P. Avian cytokines and chemokines. In Avian Immunol.; Davison, F., Kaspers, B., Schat, K.A., Eds.; Elsevier: London, UK, 2008; p. 203. [Google Scholar]
  31. Dinarello, C.A. Proinflammatory cytokines. Chest 2000, 118, 503–508. [Google Scholar] [CrossRef]
  32. Lotz, M.; Jirik, F.; Kabouridis, P.; Tsoukas, P.; Hirano, T.; Kishimoto, T.; Carson, D.A. B cell stimulating factor 2/Interleukin 6 is a co-stimulant for human thymocytes and T lymphocytes. J. Exp. Med. 1988, 167, 1253–1268. [Google Scholar] [CrossRef]
  33. Klasing, K.C. Nutritional aspects of leukocytic cytokine cytokines. J. Nutr. 1988, 118, 1436–1446. [Google Scholar] [CrossRef] [PubMed]
  34. Diehl, S.; Anguita, J.; Hoffmeyer, A.; Zapton, T.; Ihle, J.N.; Fikrig, E.; Rincon, M. Inhibition of Th1 differentation by IL-6 is mediated by SOCSI. Immunity 2000, 13, 805–815. [Google Scholar] [CrossRef]
  35. Corwin, E.J. Understanding cytokines part I: Physiology and mechanisms of action. Biol. Res. Nurs. 2000, 2, 30. [Google Scholar] [CrossRef] [PubMed]
  36. Kambayashi, T.; Jacob, C.O.; Zhou, D.; Mazurek, N.; Fong, M.; Strassmann, G. Cyclic nucleotide phosphodiesterase type IV participates in the regulation of IL-10 and in the subsequent inhibition of TNF-alpha and IL-6 release by endotoxin-stimulated macrophages. J. Immun. 1995, 155, 4909–4916. [Google Scholar] [PubMed]
  37. Sekellick, M.J.; Ferrandino, A.F.; Hopkins, D.A.; Marcus, P.I. Chicken interferon gene: Cloning, expression, and analysis. J. Interferon Cytokine Res. 1994, 14, 71–79. [Google Scholar] [CrossRef] [PubMed]
  38. Sick, C.; Schultz, U.; Staeheli, P. A family of genes coding for two serologically distinct chicken interferons. J. Biol. Chem. 1996, 271, 7635–7639. [Google Scholar] [CrossRef] [PubMed]
  39. Jiang, H.; Yang, H.; Kapczynski, D.R. Chicken interferon alpha pretreatment reduces virus replication of pandemic H1N1 and H5N9 avian influenza viruses in lung cell cultures from different avian species. Virol. J. 2011, 8, 447. [Google Scholar] [CrossRef]
  40. Göbel, T.W.; Schneider, K.; Schaerer, B.; Mejri, I.; Puehler, F.; Weigend, S.; Staeheli, P.; Kaspers, B. IL-18 stimulates the proliferation and IFN-gamma release of CD4 + T cells in the chicken: Conservation of a Th1-like system in a non mammalian species. J. Immunol. 2003, 171, 1809–1815. [Google Scholar] [CrossRef]
  41. Akira, S.; Takeda, K.; Kaisho, T. Toll-like receptors: Critical proteins linking innate and acquired immunity. Nat. Immunol. 2001, 2, 675–680. [Google Scholar] [CrossRef]
  42. Akira, S.; Takeda, K. Toll-like receptor signalling. Nat. Rev. Immunol. 2004, 4, 499–511. [Google Scholar] [CrossRef]
  43. Keestra, A.M.; de Zoete, M.R.; van Aubel, R.A.M.H.; van Putten, J.P.M. Functional characterization of chicken TLR5 reveals species-specific recognition of flagellin. Mol. Immunol. 2007, 45, 1298–1307. [Google Scholar] [CrossRef] [PubMed]
  44. Hayashi, F.; Smith, K.D.; Ozinsky, A.; Hawn, T.R.; Yi, E.C.; Goodlett, D.R. The innate immune response to bacterial flagellin is mediated by Toll-like receptor-5. Nature 2001, 410, 1099. [Google Scholar] [CrossRef] [PubMed]
  45. Kogut, M.H.; Iqbal, M.; He, H.; Philbin, V.; Kaiser, P.; Smith, A. Expression and function of Toll-like receptors in chicken heterophils. Dev. Comp. Immunol. 2005, 29, 791–807. [Google Scholar] [CrossRef] [PubMed]
  46. Olanrewaju, H.A.; Thaxton, J.P.; Dozier, W.A., III; Purswell, J.; Roush, W.B.; Branton, S.L. A rewiev of lightning programs for broiler production. Int. J. Poult. Sci. 2006, 4, 301–308. [Google Scholar]
  47. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, 2002–2007. [Google Scholar] [CrossRef]
  48. Fischer, A.H.; Jacobson, K.A.; Rose, J.; Zeller, R. Hematoxylin and eosin staining of tissue and cell sections. CSH Protoc. 2008. [Google Scholar] [CrossRef]
  49. Munyaka, P.M.; Echeverry, H.; Yitbarek, A.; Camelo-Jaimes, G.; Sharif, S.; Guenter, W.; House, J.D.; Rodriguez-Lecompte, J.C. Local and systemic innate immunity in broiler chickens supplemented with yeast-derived carbohydrates. Poult. Sci. 2012, 91, 2164–2172. [Google Scholar] [CrossRef]
  50. Nagy, Z.; Daood, H.; Koncsek, A.; Molnár, H.; Helyes, L. The simultaneous determination of capsaicinoids, tocopherols, and carotenoids in pungent pepper powder. J. Liq. Chromatogr. Relat. Technol. 2017, 40, 199–209. [Google Scholar] [CrossRef]
  51. Nemes, A.; Szőllősi, E.; Stündl, L.; Biró, A.; Homoki, J.R.; Szarvas, M.M.; Balogh, P.; Cziáky, Z.; Remenyik, J. Determination of flavonoid and proanthocyanidin profile of Hungarian sour cherry. Molecules 2018, 23, 3278. [Google Scholar] [CrossRef]
  52. Homoki, J.R.; Nemes, A.; Fazekas, E.; Gyémánt, G.; Balogh, P.; Gál, F.; Al-Asri, J.; Mortier, J.; Wolber, G.; Babinszky, L.; et al. Anthocyanin composition, antioxidant efficiency, and α-amylase inhibitor activity of different Hungarian sour cherry varieties (Prunus cerasus L.). Food Chem. 2016, 194, 222–229. [Google Scholar] [CrossRef]
  53. Salim, H.M.; Kang, H.K.; Akter, N.; Kim, D.W.; Kim, J.H.; Kim, M.J.; Na, J.C.; Jong, H.B.; Choi, H.C.; Suh, O.S.; et al. Supplementation of direct-fed microbials as an alternative to antibiotic on growth performance, immune response, cecal microbial population, and ileal morphology of broiler chickens. Poult. Sci. 2013, 92, 2084–2090. [Google Scholar] [CrossRef] [PubMed]
  54. Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
  55. Simon, A.; Jávor, A.; Bai, P.; Oláh, J.; Czeglédi, L. Reference genes selection for reverse transcription quantitative polimerase chain reaction in chicken hypothalamus under different feeding status. J. Anim. Phys. Anim. Nutr. 2018, 102, 286–296. [Google Scholar] [CrossRef] [PubMed]
  56. Rezaei, S.; Jahromi, M.F.; Liang, J.B.; Zulkifli, I.; Farjam, A.S.; Laudadio, V.; Tufarelli, V. Effect of oligosaccharides extract from palm kernel expeller on growth performance, gut microbiota and immune response in broiler chickens. Poult. Sci. 2015, 94, 2414–2420. [Google Scholar] [CrossRef]
  57. Rathgeber, B.M.; Budgell, K.L.; Maclsaac, J.L.; Mirza, M.A.; Doncaster, K.L. Growth performance and spleen and bursa weight of broilers fed yeast beta-glucan. Can. J. Anim. Sci. 2008, 88, 469–473. [Google Scholar] [CrossRef]
  58. Kamboh, A.A.; Hang, S.-Q.; Khan, M.A.; Zhu, W.-Y. In vivo immunmodulatory effects of plant flavonoids in lipopolysaccharid-challenged broilers. Animal 2016, 10, 1619–1625. [Google Scholar] [CrossRef]
  59. Vetvicka, V.; Oliveira, C. β(1-3)(1-6)-d-glucan with strong effects on immune status in chicken: Potential importance for efficiancy of commercial farming. J. Nutr. Health Sci. 2014, 1, 309. [Google Scholar]
  60. Morales-Lopez, R.; Brufau, J. Immune-modulatory effects of dietary Saccharomices cerevisiae cell wall in broiler chickens inoculated with Escherichia coli lipopolysaccharide. Br. Poult. Sci. 2013, 54, 247–251. [Google Scholar] [CrossRef]
  61. Shen, Y.B.; Piao, X.S.; Kim, S.W.; Wang, L.; Liu, P.; Yoon, I.; Zhen, Y.G. Effects of yeast culture supplementation on growth performance, intestinal health, and immune response of nursery pigs. J. Anim. Sci. 2009, 87, 2614–2624. [Google Scholar] [CrossRef]
  62. Kumar, S.; Ciraci, C.; Redmond, S.B.; Chuammitri, P.; Andreasen, C.B.; Palic, D.; Lamont, S.J. Immune response gene expression in spleens of diverse chicken lines fed dietary immunomodulators. Poult. Sci. 2011, 90, 1009–1013. [Google Scholar] [CrossRef]
  63. Sheoran, N.; Sihag, S.; Maan, N.S. Expression analysis of immunity related genes in White Leghorn layers supplemented with probiotics and prebiotics. Pharm. Innov. 2017, 6, 14–18. [Google Scholar]
  64. Shanmugasundaram, R.; Sifri, M.; Jeyabalan, R.; Selvaraj, R.K. Effect of yeast cell product (CitriStim) supplementation on turkey performance and intestinal immune cell parameters during an experimental lipopolysaccharide injection. Poult. Sci. 2014, 93, 2763–2771. [Google Scholar] [CrossRef] [PubMed]
  65. Hong, Y.H.; Lillehoj, H.S.; Lillehoj, E.P.; Lee, S.H. Changes in immune-related gene expression and intestinal lymphocyte subpopulations following Eimeria maxima infection in chickens. Vet. Immunol. Immunopathol. 2006, 114, 259–272. [Google Scholar] [CrossRef] [PubMed]
  66. Shanmugasundaram, R.; Selvaraj, R.K. Lutein supplementation alters inflammatory cytokine production and antioxidant status in F-line turkeys. Poult. Sci. 2011, 90, 971–976. [Google Scholar] [CrossRef] [PubMed]
  67. Carvalho, F.B.; Gutierres, J.M.; Bohnert, C.; Zago, A.M.; Abdalla, F.H.; Vieira, J.M.; Palma, H.E.; Oliveira, S.M.; Spanello, R.M.; Duarte, M.M.; et al. Anthocyanins suppress the secretion of proinflammatory mediators and oxidative stress, and restore ion pump activities in demyelination. J. Nutr. Biochem. 2015, 26, 378–390. [Google Scholar] [CrossRef] [PubMed]
  68. Faber, T.A.; Dilger, R.N.; Hopkins, A.C.; Price, N.P.; Fahej, G.C., Jr. The effects of a galactoglucomannan oligosaccharide-arabinoxylan (GGMO-AX) complex in broiler chicks challenged with Eimeria acervulina. Poult. Sci. 2012, 91, 1089–1096. [Google Scholar] [CrossRef] [PubMed]
  69. Pourabedin, M.; Chen, Q.; Yang, M.; Zhao, X. Mannan- and xylooligosaccharides modulatecaecal microbiota and expression of inflammatory-related cytokines and reduce caecal Salmonella enteritidis colonization in young chickens. FEMS Microbiol. Ecol. 2017, 93, 1–11. [Google Scholar] [CrossRef]
  70. Tan, J.; Liu, S.; Guo, Y.; Applegate, T.J.; Eicher, S.D. Dietary L-arginine supplementation attenuates lipopolysaccharide-induced inflammatory response in broiler chickens. Br. J. Nutr. 2014, 111, 1394–1404. [Google Scholar] [CrossRef]
  71. Khan, S.; Roberts, J.; Wu, S.-B. Regulation of Immunity-Related Genes by Infectious Bronchitis Virus Challenge in Spleen of Laying Chickens. Viral. Immunol. 2020. [Google Scholar] [CrossRef]
  72. Li, Y.; Zhang, H.; Chen, Y.P.; Yang, M.X.; Zhang, L.L.; Lu, Z.X.; Zhou, Y.M.; Wang, T. Bacillus amyloliquefaciens supplementation alleviates immunological stress in lipopolysaccharide-challenged broilers at early age. Poult. Sci. 2015, 94, 1504–1511. [Google Scholar] [CrossRef]
  73. Cox, C.M.; Sumners, L.H.; Kim, S.; McElroy, A.P.; Bedford, M.R.; Dalloul, R.A. Immune responses to dietary β-glucan in broiler chicks during an Eimeria challenge. Poult. Sci. 2010, 89, 2597–2607. [Google Scholar] [CrossRef] [PubMed]
  74. Shanmugasundaram, R.; Sifri, M.; Selvaraj, R.K. Effect of yeast cell product (CitriStim) supplementation on broiler performance and intestinal immune cell parameters during an experimental coccidial infection. Poult. Sci. 2013, 92, 358–363. [Google Scholar] [CrossRef] [PubMed]
Figure 1. HPLC profile of DAD detection of carotenoids on 460 nm from Hungarian red sweet pepper.
Figure 1. HPLC profile of DAD detection of carotenoids on 460 nm from Hungarian red sweet pepper.
Animals 10 00347 g001
Figure 2. Relative spleen weight (spleen weight compared to live weight) of chickens fed basal diet under Escherichia coli O55:B5 LPS challenge, basal diet under isotonic saline challenge, diet supplemented with 0.05% β-glucan-, diet supplemented with 0.5 % carotenoids-, diet supplemented with 0.5% oligosaccharides- and diet supplemented with 0.5% anthocyanins under Escherichia coli O55:B5 LPS challenge (n = 6/treatment). Error bars represent means ± standard errors of the mean. The effects were analyzed by One-way ANOVA and differences among treatments were considered significant at p < 0.05. Dietary effects were not significant.
Figure 2. Relative spleen weight (spleen weight compared to live weight) of chickens fed basal diet under Escherichia coli O55:B5 LPS challenge, basal diet under isotonic saline challenge, diet supplemented with 0.05% β-glucan-, diet supplemented with 0.5 % carotenoids-, diet supplemented with 0.5% oligosaccharides- and diet supplemented with 0.5% anthocyanins under Escherichia coli O55:B5 LPS challenge (n = 6/treatment). Error bars represent means ± standard errors of the mean. The effects were analyzed by One-way ANOVA and differences among treatments were considered significant at p < 0.05. Dietary effects were not significant.
Animals 10 00347 g002
Figure 3. Relative interleukin-1β (a), interleukin-6 (b), interferon-α (c), interferon-γ (d), toll-like receptor 4 (e) and toll-like receptor 5 (f) mRNA expression in spleen of chickens fed basal diet under Escherichia coli LPS challenge, basal diet under isotonic saline challenge, diet supplemented with 0.05% β-glucan-, diet supplemented with 0.5% carotenoids-, diet supplemented with 0.5% oligosaccharides- and diet supplemented with 0.5% anthocyanins under Escherichia coli O55:B5 LPS challenge (n = 6/treatment). Error bars represent means ± standard errors of the mean. The effects were analyzed by One-way ANOVA and groups that do not share a letter are significantly different (p < 0.05).
Figure 3. Relative interleukin-1β (a), interleukin-6 (b), interferon-α (c), interferon-γ (d), toll-like receptor 4 (e) and toll-like receptor 5 (f) mRNA expression in spleen of chickens fed basal diet under Escherichia coli LPS challenge, basal diet under isotonic saline challenge, diet supplemented with 0.05% β-glucan-, diet supplemented with 0.5% carotenoids-, diet supplemented with 0.5% oligosaccharides- and diet supplemented with 0.5% anthocyanins under Escherichia coli O55:B5 LPS challenge (n = 6/treatment). Error bars represent means ± standard errors of the mean. The effects were analyzed by One-way ANOVA and groups that do not share a letter are significantly different (p < 0.05).
Animals 10 00347 g003aAnimals 10 00347 g003b
Figure 4. Relative interleukin-1β (a), interferon-α (b), interferon-γ (c), toll-like receptor 4 (d) and toll-like receptor 5 (e) mRNA expression in ileum of chickens fed basal diet under Escherichia coli LPS challenge, basal diet under isotonic saline challenge, diet supplemented with 0.05% β-glucan-, diet supplemented with 0.5% carotenoids-, diet supplemented with 0.5% oligosaccharides- and diet supplemented with 0.5% anthocyanins under Escherichia coli O55:B5 LPS challenge (n = 6/treatment). Error bars represent means ± standard errors of the mean. The effects were analyzed by One-way ANOVA and groups that do not share a letter are significantly different (p < 0.05).
Figure 4. Relative interleukin-1β (a), interferon-α (b), interferon-γ (c), toll-like receptor 4 (d) and toll-like receptor 5 (e) mRNA expression in ileum of chickens fed basal diet under Escherichia coli LPS challenge, basal diet under isotonic saline challenge, diet supplemented with 0.05% β-glucan-, diet supplemented with 0.5% carotenoids-, diet supplemented with 0.5% oligosaccharides- and diet supplemented with 0.5% anthocyanins under Escherichia coli O55:B5 LPS challenge (n = 6/treatment). Error bars represent means ± standard errors of the mean. The effects were analyzed by One-way ANOVA and groups that do not share a letter are significantly different (p < 0.05).
Animals 10 00347 g004aAnimals 10 00347 g004b
Table 1. Identified carotenoid compounds with relative percentage of areas.
Table 1. Identified carotenoid compounds with relative percentage of areas.
Retention TimeName of CompoundRelative Percentage of Areas (%)
11.163β-carotene9.965
16.054cis-capsanthin10.743
17.17capsanthin10.854
18.462zeaxanthin4.503
Table 2. Identified oligosaccharide monomers with relative percentage of areas.
Table 2. Identified oligosaccharide monomers with relative percentage of areas.
Name of MonomersRelative Percentage of Areas (%)
Glucose71.310
Arabinose8.993
Xylose8.697
Galactose6.815
Mannose4.185
Table 3. Identified anthocyanin compounds [52].
Table 3. Identified anthocyanin compounds [52].
Name of Anthocyanin CompoundsQuantity (mg/100 g)
cyanidin-3-O-glucosyl-rutinoside2.77–10.31
cyanidin-3-O-rutinoside4.93–14.56
cyanidin-3-O-monoglucoside2.02–7.79
Table 4. Composition and nutrient level of the basal diets.
Table 4. Composition and nutrient level of the basal diets.
Basal IngredientsValue
Pre-Starter (Day 1–9)Starter
(Day 10–21)
Grower
(Day 22–31)
Finisher
(Day 32–42)
Corn, %33343332
Wheat, %27293132
Soybean meal, solvent extracted (46.0% CP), %29242016
Soybean meal, extruded (46.0% CP), %4644
Sunflower meal, extracted, % 134
Feed yeast, %1
DDGS, % 135
Plant fats, %2134
Premix, %4433
Total, %100100100100
Nutrient Level
Dry matter, %89.0689.0389.1589.15
AMEn poultry, MJ/kg12.2312.4712.8113.01
Crude protein, %21.5820.2819.0518.28
Crude fat, %4.614.836.226.83
Crude fibre, %3.373.513.73.88
Lysine, %1.371.271.171.09
Methionine, %0.570.540.530.49
Methionine + Cysteine, %0.940.90.870.83
Calcium, %0.850.730.710.67
Phosphorus, %0.630.550.520.49
Table 5. Primer sequences of chicken cytokines.
Table 5. Primer sequences of chicken cytokines.
Accesion No. or ReferencePrimer Sequences (5′→3′)GeneAmplicon Length (bp)Annealing Temperature (°C)
XM_015297469.1F: TGCTTCGTGCTGGAGTCACCCIL-1β9859.93
R: GGCCGGTACAGCGCAATGTT59.02
XM_015281283.2F: AGCGAAAAGCAGAACGTCGAGTCIL-610758.73
R: GCCGAGTCTGGGATGACCACTTC59.94
AM049251.1F: ACTTCAGCTGCCTCCACACCTTIFN-α9259.14
R: CAGGAACCAGGCACGAGCTT57.74
NM_205149.1F: AACAACCTTCCTGATGGCGTGAIFN-γ8957.46
R: GCTTTGCGCTGGATTCTCAAGT57.02
NM_001030693.1F: ACCCGAACTGCAGTTTCTGGATTLR-412057.20
R: AGGTGCTGGAGTGAATTGGC55.61
XM_025148815.1F: ATGAGCTGAGGCTTTAGTTGGAGATLR-510856.61
R: CCAGCTAGTGCTATTCCAAAGACA55.62
[55]F: GCTGGCATTGCACTGAATGACGAPDH11355.73
R: CACTCCTTGGATGCCATGT52.42
[55]F: AGATCACAGCCCTGGCACCTAGACTB6158.80
R: TTGCGCTCAGGTGGGGCAAT60.22
Table 6. Effect of natural compounds on growth performance of broiler chickens.
Table 6. Effect of natural compounds on growth performance of broiler chickens.
Diet
ParametersControlβ-GlucanCarotenoidsOligosaccharidesAnthocyaninsRMSE *
BW (g/bird)
Day 138.937.938.638.638.50.5
Day 1023222622122222714
Day 21759 a,b795 b769 a,b715 a,b726 a38
Day 3217131767.71709.91735.31705.366
Day 422758272727482618259098
ADG (g/day/bird)
Pre-starter (Day 1–9)19191818191
Starter (Day 10–21)47.9 a,b,c51.8 c49.8 a,c44.9 b45.3 a,b3
Grower (Day 22–31)87888693895
Finisher (Day 32–42)10496104888910
Day 1–4265646561612
ADFI (g/day/bird)
Pre-starter (Day 1–9)433452
Starter (Day 10–21)505858566115
Grower (Day 22–31)130 a144 a,b148 a,b149 a,b159 b16
Finisher (Day 32–42)11413212412713215
Day 1–4273 a83 b81 a,b82 b88 b6
* Root mean square error; BW and ADG is based on individual values (n = 18), ADFI is calculated for pens (n = 3); a,b,c Mean values within a row with different superscript letters are significantly different (p < 0.05).
Table 7. Effect of natural compounds on ileum morphology of broiler chickens at 27 days of age.
Table 7. Effect of natural compounds on ileum morphology of broiler chickens at 27 days of age.
Ileum MorphologyDietSEMp-Value
Control (LPS)Control (Saline)β-GlucanCarotenoidsOligosaccharidesAnthocyanins
Villus height (µm)774.31 a712.02 a998.93 b908.94 b977.08 b921.84 b27.42<0.0001
Crypt depth (µm)140.38 b,c107.31 a120.43 a,b160.27 c179.90 d134.47 b8.086<0.0001
VH:CD ratio5.83 a,b6.81 b,c8.57 d6.19 a,b,c5.70 a7.12 c0.3625<0.0001
Total mucosa thickness (µm)1156.89 a,c1137.47 a1350.07 b1251.06 b,c1346.49 b1286.38 b35.63<0.0001
Mean values with their standard errors, n = 3/treatment; a,b,c,d Mean values within a row with different superscript letters are significantly different (p < 0.05) Ileal villus height was significantly higher in treatments of β-glucan (p < 0.0001), carotenoid (p < 0.0001), oligosaccharide (p < 0.0001) and anthocyanin (p < 0.0001). Height of villi did not differ significantly in control groups (p = 0.212). Significantly higher crypt depth was measured in oligosaccharide supplementation (p < 0.0001). Depth of crypt was lower in saline inoculated control group (p = 0.0009) compared to LPS inoculated birds. Crypt depth did not vary in β-glucan and anthocyanin treatments. Villus height to crypt depth (VH:CD) ratio was higher in β-glucan (p < 0.0001) and anthocyanin (p = 0.0063) supplementations contrasted to lipopolysaccharide injected control group. No difference in VH:CD ratio was observed in control-saline, carotenoid and oligosaccharide supplemented diets. Higher total mucosa thickness of ileum was observed in β-glucan (p < 0.0001), oligosaccharide (p < 0.0001) and anthocyanin (p = 0.048) supplementations, but no variations were found in control-saline and carotenoid groups.

Share and Cite

MDPI and ACS Style

Csernus, B.; Biró, S.; Babinszky, L.; Komlósi, I.; Jávor, A.; Stündl, L.; Remenyik, J.; Bai, P.; Oláh, J.; Pesti-Asbóth, G.; et al. Effect of Carotenoids, Oligosaccharides and Anthocyanins on Growth Performance, Immunological Parameters and Intestinal Morphology in Broiler Chickens Challenged with Escherichia coli Lipopolysaccharide. Animals 2020, 10, 347. https://doi.org/10.3390/ani10020347

AMA Style

Csernus B, Biró S, Babinszky L, Komlósi I, Jávor A, Stündl L, Remenyik J, Bai P, Oláh J, Pesti-Asbóth G, et al. Effect of Carotenoids, Oligosaccharides and Anthocyanins on Growth Performance, Immunological Parameters and Intestinal Morphology in Broiler Chickens Challenged with Escherichia coli Lipopolysaccharide. Animals. 2020; 10(2):347. https://doi.org/10.3390/ani10020347

Chicago/Turabian Style

Csernus, Brigitta, Sándor Biró, László Babinszky, István Komlósi, András Jávor, László Stündl, Judit Remenyik, Péter Bai, János Oláh, Georgina Pesti-Asbóth, and et al. 2020. "Effect of Carotenoids, Oligosaccharides and Anthocyanins on Growth Performance, Immunological Parameters and Intestinal Morphology in Broiler Chickens Challenged with Escherichia coli Lipopolysaccharide" Animals 10, no. 2: 347. https://doi.org/10.3390/ani10020347

APA Style

Csernus, B., Biró, S., Babinszky, L., Komlósi, I., Jávor, A., Stündl, L., Remenyik, J., Bai, P., Oláh, J., Pesti-Asbóth, G., & Czeglédi, L. (2020). Effect of Carotenoids, Oligosaccharides and Anthocyanins on Growth Performance, Immunological Parameters and Intestinal Morphology in Broiler Chickens Challenged with Escherichia coli Lipopolysaccharide. Animals, 10(2), 347. https://doi.org/10.3390/ani10020347

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop