Next Article in Journal
Coastal Bacterial Community Response to Glacier Melting in the Western Antarctic Peninsula
Next Article in Special Issue
Kinetic Modeling and Meta-Analysis of the Bacillus subtilis SigB Regulon during Spore Germination and Outgrowth
Previous Article in Journal
Type IA Topoisomerases as Targets for Infectious Disease Treatments
Previous Article in Special Issue
The ComX Quorum Sensing Peptide of Bacillus subtilis Affects Biofilm Formation Negatively and Sporulation Positively
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of DNA Topology on Transcription from rRNA Promoters in Bacillus subtilis

Institute of Microbiology of the Czech Academy of Sciences, 142 00 Prague, Czech Republic
*
Author to whom correspondence should be addressed.
Microorganisms 2021, 9(1), 87; https://doi.org/10.3390/microorganisms9010087
Submission received: 2 December 2020 / Revised: 17 December 2020 / Accepted: 17 December 2020 / Published: 1 January 2021
(This article belongs to the Special Issue Bacillus subtilis as a Model Organism to Study Basic Cell Processes)

Abstract

The expression of rRNA is one of the most energetically demanding cellular processes and, as such, it must be stringently controlled. Here, we report that DNA topology, i.e., the level of DNA supercoiling, plays a role in the regulation of Bacillus subtilis σA-dependent rRNA promoters in a growth phase-dependent manner. The more negative DNA supercoiling in exponential phase stimulates transcription from rRNA promoters, and DNA relaxation in stationary phase contributes to cessation of their activity. Novobiocin treatment of B. subtilis cells relaxes DNA and decreases rRNA promoter activity despite an increase in the GTP level, a known positive regulator of B. subtilis rRNA promoters. Comparative analyses of steps during transcription initiation then reveal differences between rRNA promoters and a control promoter, Pveg, whose activity is less affected by changes in supercoiling. Additional data then show that DNA relaxation decreases transcription also from promoters dependent on alternative sigma factors σB, σD, σE, σF, and σH with the exception of σN where the trend is the opposite. To summarize, this study identifies DNA topology as a factor important (i) for the expression of rRNA in B. subtilis in response to nutrient availability in the environment, and (ii) for transcription activities of B. subtilis RNAP holoenzymes containing alternative sigma factors.

1. Introduction

Bacterial cells need to adapt to environmental changes. In nutrient-rich environments, cells grow and divide rapidly, and this requires a large number of ribosomes to satisfy the need for new proteins. In nutritionally poor environments, the synthesis of new ribosomes stops. As the production of new ribosomes is energetically costly for the cell, it must be tightly regulated. The number of ribosomes in the cell is regulated mainly on the level of transcription initiation of ribosomal RNA (rRNA) [1].
Transcription initiation can be divided into several steps. First, when the RNA polymerase (RNAP) holoenzyme (the core RNAP subunits [α2ββ´ω] in complex with a σ factor) binds to specific DNA sequences, promoters, it forms the closed complex where DNA is still in the double-helical form [2]. The specificity of RNAP for promoter sequences is provided by the σ factor [3,4,5,6]. Subsequently, this complex isomerizes and forms the open complex where the two DNA strands are unwound, and the transcription bubble is formed. At this stage, initiating nucleoside triphosphates NTPs (iNTPs) can enter the active site and transcription can begin. RNAP then leaves the promoter and enters the elongation phase of transcription [7].
In bacteria, the concentrations of iNTPs act as key regulators of transcription and directly affect RNAP at some promoters. These promoters form relatively unstable open complexes where the time window available to iNTPs to penetrate into the active site and initiate transcription is relatively short. The higher the concentration of the respective iNTP, the higher the chance that it penetrates into the active site while the transcription bubble is still open. Hence, increases in intracellular concentrations of iNTPs stimulate transcription whereas low levels of iNTPs result in inefficient transcription initiation [8,9,10].
rRNA promoters are prime examples of where transcription initiation is regulated by the concentration of the iNTP. In Bacillus subtilis, a model soil-dwelling, spore-forming Gram-positive bacterium, the iNTP of the tandem rRNA promoters of all 10 rRNA operons is exclusively GTP [11]. The GTP level in B. subtilis is affected by (p)ppGpp, an alarmone that is produced at times of stress, such as amino acid starvation or heat shock. (p)ppGpp inhibits GuaB, the first enzyme in the de novo GTP biosynthesis pathway, which results in decreased GTP levels and increased ATP levels as more of the last common intermediate for the synthesis of both GTP and ATP, inosine monophosphate (IMP), is now available for ATP synthesis only [12,13]. By affecting the GTP level (p)ppGpp indirectly affects the activity of rRNA promoters in B. subtilis [14,15,16]. This might be similar in other Gram-positive microorganisms, such as Staphylococcus aureus, where the GTP concentration ([GTP]) affects rRNA promoter activity under stringent conditions [17].
Another important factor for transcription initiation in bacteria is the topological state of DNA, i.e., the levels of supercoiling. DNA in the cells is usually underwound and this results in negative supercoiling [18]. Negative supercoiling then helps RNAP to melt DNA in promoter regions. In general, bacterial cells display more pronounced negative supercoiling in exponential than in stationary phase of growth and initiation from a number of promoters is sensitive to this parameter [19,20,21,22,23].
Here, we investigated how the activity of rRNA promoters in B. subtilis changes when the cells transition from exponential to stationary phase. These promoters depend on the primary σ factor, σA. We show that their activity decreases during the transition and this correlates with a decrease in the GTP concentration. Nevertheless, there is a point in the process where the level of GTP does not decrease any further but the activity of rRNA promoters does. We show that besides [GTP], B. subtilis rRNA promoters are regulated by the level of their supercoiling, and we dissect the effects of supercoiling on the formation of closed and open complexes, thereby providing mechanistic insights into the process. Finally, we show that supercoiled (SC) DNA is a more efficient template for transcription for all alternative σ factors tested with the exception of σN, a recently discovered sigma factor encoded on the pBS32 plasmid of the NCIB 3610 strain [24,25]. In summary, a newly updated model of B. subtilis promoter regulation is presented here.

2. Materials and Methods

2.1. Media and Growth Conditions

Cells were grown at 37 °C, either in LB or in rich MOPS supplemented with 20 amino acids: 50 mM MOPS (pH 7.0), 1 mM (NH4)2SO4, 0.5 mM KH2PO4, 2 mM MgCl2, 2 mM CaCl2, 50 μM MnCl2, 5 μM FeCl3, amino acids (50 μg/mL each), and 0.4% glucose. Antibiotics used: ampicillin 100 μg/mL, chloramphenicol 5 μg/mL, novobiocin 5 μg/mL, and rifampicin 2 μg/mL. Strains used are listed in Table 1.

2.2. Bacterial Strains

2.3. Determination of ATP, GTP, and ppGppconcentrations

Strains of B. subtilis (LK134, for rrnB P1 and LK135 for Pveg) were grown in the MOPS 20 AA medium supplemented with [32P] KH2PO4 (100 μCi/mL) until early exponential phase (OD600 ~0.3). Samples were taken until 250 min after OD600 ~0.3 (time 0). Samples (100 μL) were pipetted into 100 μL 11.5 M formic acid, vortexed, left on ice for 20 min, and stored overnight at −80 °C [29]. After microcentrifugation (5 min, 4 °C) to remove cell debris, the samples (5 μL) were spotted on TLC (thin-layer chromatography) plates (Polygram®CEL 300 PEI, purchased from Macherey-Nagel), developed in 0.85 M (for ATP and GTP) or 1.5 M (for ppGpp) KH2PO4 (pH 3.4) and quantified by phosphorimaging. The identities of ATP, GTP, and ppGpp were verified by comparison with commercial preparations of these compounds run in parallel and visualized by UV shadowing [8].
To determine the relative ATP/GTP concentrations after novobiocin treatment, LK134 was grown to OD600 ~0.3 (time 0) in medium supplemented with [32P] H3PO4 (100 μCi/mL), and at time 5 min treated with novobiocin (5 μg/mL). Samples were taken at time points 0, 5, 10, 20, and 30 min and processed in the same way as above.

2.4. Promoter Activity Monitored by Quantitative Primer Extension (qPE)

Promoter constructs were fused to lacZ and activities were assayed by primer extension of the short-lived lacZ mRNA that allows to observe rapid decreases in promoter activity in time. The experiments were conducted as described in [15]. Typically, 1 mL of cells was pipetted directly into 2 mL phenol/chloroform (1:1) and 0.25 mL lysis buffer (50 mM Tris–HCl pH 8.0, 500 mM LiCl, 50 mM EDTA pH 8.0, 5% SDS). After brief vortexing, the recovery marker (RM) was added. The RM RNA was made from B. subtilis strain LK41 as described in [15]. This was followed by immediate sonication. Water was then added to increase the aqueous volume to 6 mL to prevent precipitation of salts, followed by two extractions with phenol/chloroform, two precipitations with ethanol, and suspension of the pellet in 20–50 μL 10 mM Tris–HCl, pH 8.0.
Primer extension was performed with M-MLV reverse transcriptase as recommended by the manufacturer (Promega) with 1–10 μL purified RNA. The 32P 5’-labeled primer (#2973) hybridized 89 nt downstream from the junction of the promoter fragment used for the creation of the lacZ fusion. Samples were electrophoresed on 7 M urea 5.5% or 9% polyacrylamide gels. The gels were exposed to Fuji Imaging Screens. The screens were scanned with Molecular Imager FX (Bio-Rad, Berkeley, CA, USA) and were visualized and analysed using the Quantity One software (Bio-Rad), and normalized to cell number (OD600) and RM.

2.5. Promoter Activity Monitored by RT–qPCR

rrnB P1 and Pveg promoters were fused to the marker lacZ gene (LK134 and LK135), yielding identical transcripts. The strains were grown to exponential phase (OD600 ~0.5)—time point 0. Each culture was then divided into two flasks. Cells in one flask were treated with novobiocin (5 μg/mL) and cells in the other flask were left non-treated. At time points 0, 10, 20, and 30 min, 2 mL of cells were withdrawn and treated with RNAprotect Bacteria reagent (QIAGEN, Hilden, Germany), pelleted and immediately frozen. RNA was isolated with RNeasy Mini Kit (QIAGEN) and recovery marker RNA (RM RNA) was added at the time of extraction to control for differences in degradation and pipetting errors during extraction. The RM RNA was prepared from B. subtilis strain LK41 as for qPE. Finally, RNA was DNase treated according to manufacturers’ instructions (TURBO DNA-free Kit, Ambion). Total RNA was then reverse transcribed to cDNA with reverse transcriptase (SuperScript™ III Reverse Transcriptase, Invitrogen, Waltham, MA, USA) using primer #2973 that targets lacZ (both in the test mRNA and RM). This was followed by qPCR in a LightCycler 480 System (Roche Applied Science, Penzberg, Germany) containing LightCycler® 480 SYBR Green I Master and 0.5 μM primers (each). RM cDNA was amplified with primers #2974 and #2973, and the test lacZ cDNA with primers #2975 and #2973. Sequences of primers were originally published in [15]. The final data were normalized to RM and the amount of cells (OD600).

2.6. 3H-Incorporation in Total RNA

This experiment was conducted as described previously [30]. Briefly, strain LK134 was grown in LB medium to OD600 ~0.3 (early exponential phase). Newly synthesized RNA in the cells was labeled with 3H-uridine (1 μCi/mL) (cold [non-radioactive] uridine was added to a final concentration of 100 μM); time point 0. The bacterial culture was divided into three flasks—non-treated, treated with novobiocin (5 μg/mL), and treated with rifampicin (2 μg/mL), respectively (time point 5). At 0, 5, 10, 20 and 30 min, 100 μL and 250 μL of cells were withdrawn to measure cell density and determine 3H-incorporation, respectively. The 250 μL cell sample was mixed with 1 mL of 10% trichloroacetic acid (TCA) and kept on ice for at least 1 h. Thereafter, each sample was vacuum filtered, using Glass Microfiber Filters (Whatman, Little Chalfont, UK), washed twice with 1 ml of 10% TCA and three times with 1 mL of ethanol. The filters were dried, scintillation liquid was added, and the radioactivity was measured. The signal was normalized to cell density (OD600).

2.7. RNAP Levels in Time

Cells (strain LK134) were grown in LB rich medium to OD600 0.3 (time point 0). Subsequently, every 30 min 10 mL of cells were pelleted and OD600 was measured. Pellets were washed with Lysis Buffer (20 mM Tris-HCl, pH 8, 150 mM KCl, 1 mM MgCl2) and frozen. Next day, pellets were resuspended in Lysis Buffer (100–500 μL, according to the size of pellet) and disrupted by sonication 2 × 1 min, with 1 min pause on ice between the pulses. After centrifugation (5 min, 4 °C) to remove cell debris, the amounts of proteins were measured with the Bradford protein assay and 5 μg was resolved by SDS-PAGE and analyzed by Western blotting, using mouse monoclonal antibodies against the β subunit of RNAP (clone name 8RB13, dilution 1:1000, Genetex, Irvine, CA, USA) and anti-mouse secondary antibody conjugated with HRP (dilution 1:800,000, Sigma, Munich, Germany). Subsequently, the blot was incubated for 5 min with SuperSignalTM West Femto PLUS Chemiluminiscent substrate (Thermo scientific, Waltham, MA, USA), exposed on film and developed.

2.8. Proteins and DNA for Transcription In Vitro

2.8.1. Strain Construction

Genes encoding σB, σE, σF and σH were amplified from genomic wt DNA by PCR with Expand High Fidelity PCR System (Roche) with respective primers (Table 1, Material and Methods section) and cloned into pET-22b(+) via NdeI/XhoI restriction sites and verified by sequencing. Primers for cloning of σE were designed for the active form of protein, as its first 27 AA are in the cell posttranslationally removed [31,32]. The resulting plasmids were transformed into expression strain BL21(DE3), yielding strains LK1207 (σB), LK2580 (σE), LK1425 (σF), and LK1208 (σH). His-SUMO-σN fusion protein in an expression plasmid pBM05 [25] was transformed to BL21(DE3), resulting in strain LK2531.

2.8.2. Protein Purification

Wild type RNAP, containing a His10x-tagged β’ subunit was purified from LK1723 as described [26].
The SigA subunit of RNAP (LK22) was overproduced a purified as described [27].
σB, σE, σF, σH expression strains were grown to OD600 ~0.5 when IPTG was added to a final concentration of 0.8 mM. Cells were allowed to grow for 3 h at room temperature, cells were harvested, washed and resuspended in P buffer (300 mM NaCl, 50 mM Na2HPO4, 3 mM β-mercaptoethanol, 5% glycerol). Cells were then disrupted by sonication and the supernatant was mixed with 1 mL Ni-NTA agarose (QIAGEN, Hilden, Germany) and incubated for 1 h at 4 °C with gentle shaking. Ni-NTA agarose with the bound protein was loaded on a Poly-Prep® Chromatography Column (Bio-Rad, Berkeley, CA, USA), washed with P buffer and subsequently with the P buffer with the 30 mM imidazole. The protein was eluted with P buffer containing 400 mM imidazole and fractions containing σ factor were pooled together and dialyzed against storage buffer (50 mM Tris-HCl, pH 8.0, 100 mM NaCl, 50% glycerol and 3 mM β-ME). The proteins were stored at −20 °C.
σD was purified from inclusion bodies as described in [28].
Cells containing the plasmid for overproduction of σN were grown to OD600 ~0.5 and IPTG was added to final concentration 0.3 mM. Cells were then allowed to grow for 3 h at room temperature; afterwards the cells were harvested, washed, and resuspended in P buffer. All purification steps were done in P2 buffer (the same composition as P buffer, but pH 9.5). Cells were then disrupted by sonication and the supernatant was mixed with 1 mL Ni-NTA agarose (QIAGEN) and incubated for 1 h at 4 °C with gentle shaking. Ni-NTA agarose with the bound His-SUMO-σN was loaded on a Poly-Prep® Chromatography Column (Bio-Rad), washed with P2 buffer and subsequently with the P2 buffer with the 30 mM imidazole. The protein was eluted with P2 buffer containing 400 mM imidazole and fractions containing His-SUMO-σN were pooled together and dialyzed against P2 buffer.
The SUMO tag was subsequently removed by using SUMO protease (Invitrogen). The cleavage reaction mixture was again mixed with the 1 mL Ni-NTA agarose and allowed to bind for 1 h at 4 °C and centrifuged to pellet the resin. Supernatant was removed, the resin was washed once more with P2 buffer with 3 mM β-ME. The supernatants (containing σN) were pooled together and dialysed against storage P2 buffer (P2 buffer and 50% glycerol). The protein was stored at −20 °C.
The purity of all proteins was checked by SDS-PAGE.

2.8.3. Promoter DNA Construction

Promoter regions of alternative σ-dependent genes were amplified from genomic wt DNA of B. subtilis with primers listed in Table 2 (Material and Methods section) by PCR. All fragments were then cloned into p770 (pRLG770 [33]) using EcoRI/HindIII restriction sites and transformed into DH5α. All constructs were verified by sequencing.
Supercoiled plasmids (SC) were obtained using the Wizard® Plus Midipreps DNA Purification System, for higher yields Wizard® Plus Maxipreps DNA Purification System (both Promega, Madison, WI, USA) were used and subsequently phenol-chloroform extracted, precipitated with ethanol, and dissolved in water. Aliquots of plasmids were linearized with the PstI restriction enzyme (TaKaRa, Saint-Germain-en-Laye, Francie), resulting in linear form (LIN), and again precipitated with ethanol to remove salts.
The state of DNA topology (linear, supercoiled) was checked on agarose gels.

2.8.4. List of Primers

2.9. Transcription In Vitro

Transcription experiments were performed with the B. subtilis RNAP core reconstituted with a saturating concentration of σA (ratio 1:5) in storage buffer (50 mM Tris-HCl, pH 8.0, 0.1 M NaCl, 50% glycerol) for 15 min at 30 °C. The 1:5 ratio was used also for σB, σD, σE, σF, and σH. For σN, the ratio was 1:8. Multiple round transcription reactions were carried out in 10 μL reaction volumes with 30 nM RNAP holoenzyme. The transcription buffer contained 40 mM Tris-HCl pH 8.0, 10 mM MgCl2, 1 mM dithiothreitol (DTT), 0.1 mg/mL BSA and 150 mM KCl, and all four NTPs and 2 μM radiolabeled [α-32P] UTP.
In KGTP determination experiments, the amount of DNA (SC or LIN form) was 100 ng, ATP, CTP were 200 μM; UTP was 10 μM and GTP was titrated from 0 to 2000 μM. To determine the affinity of RNAP to DNA, ATP, CTP were at 200 μM; UTP was 10 μM, GTP was 1000 μM and DNA (SC/LIN) was titrated from 0 to 900 ng per reaction. In reactions with alternative σ, DNA (SC or LIN form) was 100 ng, CTP were at 200 μM; UTP was 10 μM and GTP/ATP was 1000 μM, depending on the identity of the base in the +1 position of the transcript.
All transcription reactions were allowed to proceed for 15 min at 30 °C and then stopped with equal volumes of formamide stop solution (95% formamide, 20 mM EDTA, pH 8.0). Samples were loaded onto 7 M urea-7% polyacrylamide gels and electrophoresed. The dried gels were scanned with Molecular Imager FX (Bio-Rad) and were visualized and analysed using the Quantity One software (Bio-Rad).

3. Results

3.1. The Activity of rrnB P1 Decreases during Entry into Stationary Phase

As the main model rRNA promoter, we selected the rrnB P1 promoter as it is one of the best-characterized rRNA promoters in B. subtilis that is regulated by [iNTP], [11,34,35,36]. Furthermore, the dynamic range of the activity of rrnB P1 is wide, which facilitated the design and interpretation of the experiments. As the main control promoter, we selected the strong Pveg promoter that forms stable open complexes and is saturated with a relatively low level of its iNTP. This promoter drives transcription of the veg gene that is involved in biofilm formation [37,38]. Promoter sequences are shown in Figure 1A.
To monitor promoter activities, we used core promoter-lacZ fusions. The endogenous copy of Pveg initiates transcription with ATP (+1A). Here, we used a +1G variant of Pveg so that both transcripts (from rrnB P1-lacZ and Pveg-lacZ) were identical, excluding any effects due to, e.g., potentially differential decay of the transcripts. The +1G Pveg promoter variant behaves identically with the +1A variant [11]. Throughout the study, promoter activity was determined by quantitative primer extension (qPE) or reverse transcription followed by quantitative PCR (RT-qPCR).
We used defined rich MOPS medium to grow the cells and measured (i) relative GTP level ([GTP]) and (ii) relative promoter activity (rrnB P1 and Pveg) from early exponential phase till approximately two hours into stationary phase by qPE (Figure 1).
We detected a moderate decrease in [GTP] already during exponential phase (Figure 1B). This moderate decrease was followed by a precipitous decline during the transition between the two phases. This correlated with a sharp spike in the (p)ppGpp level (Supplementary Figure S1). However, early on in the stationary phase, [GTP] even slightly increased and then remained at the same level till the end of the experiment. The activities of both rrnB P1 and Pveg decreased during the time course of the experiment—the activity of the former more than of the latter, consistent with the behavior of these promoters as reported in previous studies [10,11].
Surprisingly and interestingly, the activity rrnB P1 decreased even after the relative GTP concentration had been stabilized at a constant level. This strongly suggested that another mechanism, besides rRNA promoter regulation by [GTP], exists in the cell. DNA supercoiling is known to change between growth phases, typically the negative supercoiling from exponential phase becomes more relaxed in stationary phase, as demonstrated for Escherichia coli [39] and also B. subtilis [40]. Also, we noticed that the activity of Pveg significantly decreased, although the decrease was not as pronounced as that of the ribosomal promoter. As DNA topology is an important factor for gene expression regulation, we decided to address the potential of B. subtilis rRNA promoters to be regulated by the level of supercoiling.

3.2. Chromosome Relaxation Inhibits Total RNA Synthesis In Vivo

To test whether DNA topology could affect rRNA expression in vivo, we used novobiocin. Novobiocin is an antimicrobial compound that binds to the β subunit of gyrase and blocks its function by inhibiting ATP hydrolysis [41,42,43]. Gyrase relieves tension in DNA caused by transcribing RNAPs or helicases by creating more negatively supercoiled DNA. Hence, the inhibition of gyrase causes DNA in the cell to be more relaxed [44].
In this experiment, we first used total RNA as a proxy for rRNA synthesis as in exponential phase most of RNA synthesis comes for rRNA operons (~80% of RNA in cell is rRNA and tRNA [29,45]). We treated early-exponentially growing cells (OD600 ~0.3) with novobiocin or mock-treated them, and measured the rates of total RNA synthesis by following incorporation of radiolabeled 3H-uridine into RNA. As a positive control, where we expected cessation of RNA synthesis, we treated cells with rifampicin, a well-characterized inhibitor of bacterial RNAP.
Figure 2 shows that in the presence of novobiocin the synthesis of total RNA decreased/stopped, similarly as in the presence of rifampicin, suggesting that relaxation of the chromosome affects total RNA synthesis in the cell (Figure 2A).

3.3. Novobiocin-Induced Relaxation of DNA Affects the Activity of rrnB P1 In Vivo

Next, by RT-qPCR we monitored the response of rrnB P1 and Pveg to novobiocin treatment, using the same conditions as in the previous experiment. We grew cells carrying the appropriate fusions (rrnB P1-lacZ (LK134) and Pveg-lacZ (LK135)) to early-exponential phase (OD600 ~0.3) and either treated them with novobiocin or mock-treated them. In the case of rrnB P1, the promoter activity decreased after novobiocin treatment (as opposed to mock treatment), but in the case of Pveg, the promoter activity displayed the same moderate decline regardless of the novobiocin treatment, suggesting that rrnB P1 is more sensitive to changes in DNA topology (Figure 2B,C).
We also measured the GTP levels in novobiocin treated cells. We observed that novobiocin-induced relaxation resulted in a massive increase in the GTP level in cell (Figure 2D). The levels of ATP increased only slightly (Supplementary Figure S2). Thus, the activity of rrnB P1 and the level of GTP became uncoupled. These experiments suggested that DNA topology might affect the activity rRNA promoters, but it was also possible that unknown, secondary effects of the novobiocin treatment could be the cause.

3.4. Changes in DNA Topology Affect the Affinity of RNAP for iNTP In Vitro

To test directly whether DNA topology affects the activity of rRNA promoters, we performed in vitro transcription experiments. We had speculated that the in vivo decrease in the activity of rrnB P1 during stationary phase and in response to novobiocin treatment could be due to altered affinity of RNAP for iGTP at this promoter (induced by changes in supercoiling levels): the GTP level does not change but the open promoter becomes less stable, requiring more iGTP for maximal transcription. To address this hypothesis experimentally, we performed in vitro transcriptions with defined components. We used promoter core variants of rrnB P1 and Pveg cloned in the pRLG770 plasmid [11] (for details see Table 1 in Material and Methods section). The DNA templates were used in two different topological forms—in the negatively supercoiled plasmid form (SC), and in the relaxed form (LIN), using the same DNA construct but linearized with the PstI restriction enzyme (Supplementary Figure S3).
We performed multiple round transcriptions in vitro with increasing [GTP] (Figure 3). The GTP concentration required for half-maximal transcription (KGTP) was used as a measure of the affinity of RNAP for iGTP at the promoter. A characteristic of rRNA promoters is their requirement for relatively high levels of iGTP for maximal transcription (due to unstable open complexes), reflected in high values of KGTP in vitro. Pveg, to the contrary, has a low value of KGTP.
Experiments with SC templates confirmed previously published results [46], the KGTP for rrnB P1 was 277 ± 24 μM, and for Pveg 36 ± 9 μM. Experiments with the LIN templates then revealed that KGTP values for both promoters increased (rrnB P1 = 440 ± 25 μM, Pveg = 511 ± 78 μM). In the case of rrnB P1 the KGTP increased from SC to LIN ~1.5x, and in the case of Pveg KGTP ~14x. Surprisingly, the KGTP value of LIN Pveg was even higher than the value for rrnB P1 (Figure 3B).
Importantly, the experiments showed that the strength (the maximal level of transcription) of the rrnB P1 promoter dramatically decreased on the LIN template whereas in the case of Pveg the maximal level of transcription was comparable for both types of the template (Figure 3A, primary data), confirming the hypothesis that DNA relaxation decreases the activity of rrnB P1 more than the activity of Pveg.
As the preceding experiments were done with the core version of the rrnB P1 promoter, we also decided to use an extended version of the promoter region to assess whether the surrounding sequence has significant effects. Therefore, we used a DNA fragment containing both rrnB P1 and rrnB P2 promoters in their native tandem arrangement. Each of them contained their respective native -60 to -40 regions encompassing the UP elements. UP elements are A/T-rich sequences that enhance promoter activity by binding the C-terminal domains of α-subunits of RNAP [47,48,49]. Although their stimulatory effect on rRNA promoters in B. subtilis is less pronounced than, e.g., in E. coli (~30x), it is still significant [11]. Experiments with these promoter versions yielded virtually the same results as with the core version (Figure 3C). The KGTP for rrnB P1 (from the tandem promoter fragment) was 242 ± 31 μM for SC and 361 ± 46 μM for LIN. KGTP for rrnB P2 was 62 ± 13 μM for SC and 427 ± 61 μM for LIN (see Supplementary Table S1 and Supplementary Figure S4A,B). Similar results were obtained also with rrnO P1 and rrnO P2 promoters (Supplementary Figure S4C,D).
Hence, we concluded that for transcription from LIN templates higher concentrations of GTP are needed, regardless of the promoter. The increased KGTP of Pveg suggested that this change in RNAP affinity for the substrate iNTP might be responsible, at least in part, for the decrease in its activity during the transition from exponential to stationary phase. However, the moderate increase in KGTP of rrnB P1 suggested that other factor(s) must be involved in the decrease of this promoter’s activity in vivo. A likely candidate factor was the affinity of RNAP for promoter DNA, i.e., formation of the closed complex or/and the intracellular level of RNAP.

3.5. Pveg and rRNA Promoter Affinities for RNAP Change with DNA Relaxation In Vitro

We tested the relative affinity of RNAP for promoter DNA by performing in vitro transcriptions as a function of increasing promoter DNA concentration. We used the tandem rrnB P1+P2 DNA fragment and Pveg. The GTP concentration was set to 1 mM to ensure high efficiency of open complex formation for the tested promoters. Affinity for RNAP of both rRNA promoters was unchanged or slightly decreased on relaxed templates, but this effect was not statistically significant (Figure 4). Therefore, it is possible that the observed decrease in bulk transcription from rrnB P1 (SC vs LIN) in vitro could be due to yet another factor (e.g., promoter escape).
The opposite trend was observed with Pveg: a relatively low level of the relaxed promoter DNA was able to saturate RNAP compared to the supercoiled template. This behavior could then explain why the activity of Pveg decreased less than the activity of rrnB P1 both in vitro and in vivo. Importantly, it was previously reported that the levels of RNAP subunits decrease from exponential to stationary phase [50,51] and we also observed this trend (Figure 5).

3.6. The Effect of Supercoiling on Transcription In Vitro with Alternative Sigma Factors

To extend the study, we tested the effect of supercoiling on transcription from promoters dependent on alternative sigma factors: σB, σD, σE, σF and σH. σB is a general stress response sigma factor [52,53], σD transcribes genes linked with the cell motility and flagella formation [54]. σE and σF are sigma factors of early sporulation [55,56]. σH is responsible for transcription of early stationary genes [57].
We tested also σN (ZpdN) that is present only in the B. subtilis NCIB 3610 strain. This strain possesses a large, low-copy-number plasmid pBS32, which was lost during domestication of the commonly used laboratory strains [58]. pBS32 carries genes responsible for cell death after mitomycin C (MMC) treatment, and this effect is dependent on σN [24,25]. MMC is an antitumor antibiotic that induces DNA strand scission by DNA alkylation leading to crosslinking [59,60,61]. This DNA damage could lead to the formation of linear DNA fragments.
Sequences of respective promoters are listed in Supplementary Table S2. We performed transcriptions in vitro on SC and LIN DNA templates with saturating concentration of iNTP. In all but one cases it was the SC DNA that was the better template for transcription, similarly to what we observed with σA (Figure 6).
The exception was σN, which displayed about the same or higher activity on LIN DNA than on SC DNA, depending on the promoter (Figure 6B). To show that this effect was not due to some unknown properties of the plasmid DNA bearing these promoters, we also tested a longer sigN promoter construct (sigN P2+P3). This construct contains σA-dependent sigN P2 and σΝ-dependent sigN P3 promoters [25] and allowed us to test the effect of SC vs LIN topology for two sigmas with the same template. The results are shown in Figure 6C: σA-dependent P2 is more active on SC DNA whereas σN-dependent P3 prefers LIN DNA for efficient transcription.

4. Discussion

In this study we have identified the supercoiling level of DNA as a factor affecting the ability of Bacillus subtilis RNAP to transcribe from σA-dependent rRNA promoters as well as from selected promoters depending on alternative σ factors.

4.1. rRNA Promoters and Pveg

In our experiments, the drop in rRNA promoter activity during transition to stationary phase was pronounced and concurrent with the onset of stationary phase. A decrease in the activity of B. subtilis rRNA promoters in stationary phase was also observed in [62]. However, they used promoter constructs fused with GFP and monitored promoter activity by measuring the intensity of fluorescent signal. GFP is relatively stable, so the decreases they reported were less pronounced than those observed in our experiments.
Here, we propose an updated model of regulation of B. subtilis rRNA promoters, revealing supercoiling as a factor involved in their control. The more negatively supercoiled DNA in exponential phase contributes to the high activity of B. subtilis rRNA promoters. As this negative supercoiling becomes more relaxed when the cell transitions into stationary phase, this likely contributes to the decrease in the activity of RNAP at rRNA promoters. This is in part due to the decreased affinity of RNAP at rRNA promoters for the initiating GTP but also to a so far unknown step during transcription initiation (e.g., isomerization, promoter escape). The activity of rRNA promoters in stationary phase is also likely affected by the decreased RNAP concentration. The decrease in the available RNAP pool is further exacerbated by the association of the RNAP:σA holoenzyme with 6S-1 RNA that sequesters it in an inactive form in stationary phase [63]. The combined effect results in the shut-off of rRNA synthesis. Previously, for E. coli rRNA promoters, the decreased stability of the open complex was identified as the main kinetic intermediate affected by supercoiling [64]. We also note that in S. aureus in post-exponential growth phase the downregulation of rRNA is independent of ppGpp or NTP pools [17], and it is possible that DNA topology might be a factor contributing to this downregulation.
In B. subtilis, correlations between the supercoiling level and rRNA activity could be found also in the forespore. Within the developing spore, DNA becomes more negatively supercoiled then in stationary phase [40] and this correlates with an increase in rRNA activity in the forespore [62]. Interestingly, during novobiocin treatment the GTP level increases in B. subtilis and the changes in DNA topology override its stimulatory effect so that the net result is a decrease in the activity of rrnB P1. This is the first observation of a situation where the GTP level and rRNA promoter activity do not correlate in B. subtilis. We note that supercoiling was also reported to be involved in rRNA expression in yeast although the mechanistic aspects of this regulation are less understood [65].
The activity of the control Pveg promoter also decreases from exponential to stationary phase but the decrease is not as pronounced as in the case of rrnB P1. The decrease in the activity of Pveg can be attributed, at least in part, to its increased requirement for the concentration of the iNTP when DNA supercoiling relaxes. Nevertheless, the affinity of Pveg for RNAP seems to increase with DNA relaxation and this likely partially counteracts the negative effect on open complex formation.

4.2. Transcription with Selected Alternative σ Factors

Transcription experiments with promoters dependent on alternative σ factors revealed that linear templates are poorer substrates for the majority of them (σB, σD, σE, σF, and σH). This trend was previously reported also for RNAP:σH transcribing from the spoIIA promoter [66]. For forespore-specific σF, this is consistent with the DNA supercoiling increase in the forespore [40]. For σH and σE that are active in stationary phase, although activities of respective promoters strongly decreased with reduced supercoiling in vitro, this likely reflects the physiologically relevant requirements for their activities in the cell in stationary phase. Also, the decrease in the level of supercoiling in stationary phase is likely not as extreme as in our in vitro experiments where it was used to better visualize the effects.
The exception was σN, where transcription (SC vs. LIN) is either relatively unaffected or even increased on linear templates. This is likely physiologically important as mitomycin, which induces σN expression [24], causes also DNA relaxation and σN may have evolved to be most active under such conditions. The proficiency of RNAP:σN on linear templates then may stem from the relatively short spacers of σN dependent promoters (15 bp compared to 17 bp for σA, [67]), analogously to σ70 and σS of E. coli where the different σ activities were proposed to be due to preferences for differently DNA supercoiled templates [68,69,70].

5. Conclusions

To conclude, our findings extend the current model of rRNA promoter regulation in B. subtilis and reveal the effect of supercoiling on transcription with main and alternative σ factors.

Supplementary Materials

The following are available online at https://www.mdpi.com/2076-2607/9/1/87/s1, Figure S1: Relative GTP and (p)ppGpp levels after entry into stationary phase. Figure S2: Effect of novobiocin-induced relaxation of chromosome on ATP levels. Figure S3: SC and LIN promoter DNA on agarose gel. Figure S4: The affinity of RNAP for iNTP in vitro changes on different DNA templates. Table S1: The KGTP values for the promoters tested in the transcriptions in vitro. Table S2: Alternative σ factor-dependent promoters used in the study.

Author Contributions

L.K. supervised the project; L.K. and P.S. conceptualized the experiments; L.K. performed qPE and TLC experiments; P.S. performed novobiocin studies (RT-PCR, TLC), purified proteins, and performed transcriptions in vitro; O.R., M.B., and H.Š. cloned and purified alternative σ factors and their respective promoters. M.K. cloned, purified, and performed experiments with σN and its respective promoters; P.S. and L.K. wrote the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by 20-12109S to LK from the Czech Science Foundation.

Acknowledgments

We would like to acknowledge the Czech Research Infrastructure for Systems Biology C4SYS (project LM2015055). We thank J.D. Helmann for providing the σD overproducing strain, and D. Kearns for the pBM05 plasmid used for construction of σN overproducing strain..

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Gourse, R.L.; Gaal, T.; Bartlett, M.S.; Appleman, J.A.; Ross, W. rRNA Transcription and growth rate–dependent regulation of ribosome synthesis in Escherichia Coli. Annu. Rev. Microbiol. 1996, 50, 645–677. [Google Scholar] [CrossRef] [PubMed]
  2. Lee, J.; Borukhov, S. Bacterial RNA Polymerase-DNA interaction-the driving force of gene expression and the target for drug action. Front. Mol. Biosci. 2016, 3, 73. [Google Scholar] [CrossRef] [PubMed]
  3. Helmann, J.D. Where to begin? Sigma factors and the selectivity of transcription initiation in bacteria. Mol. Microbiol. 2019, 112, 335–347. [Google Scholar] [CrossRef] [PubMed]
  4. Gross, C.A.; Chan, C.; Dombroski, A.; Gruber, T.; Sharp, M.; Tupy, J.; Young, B. The functional and regulatory roles of sigma factors in transcription. Cold Spring Harb. Symp. Quant. Biol. 1998, 63, 141–155. [Google Scholar] [CrossRef] [PubMed]
  5. Paget, M.S. Bacterial sigma factors and anti-sigma factors: Structure, function and distribution. Biomolecules 2015, 5, 1245–1265. [Google Scholar] [CrossRef] [PubMed]
  6. Feklistov, A.; Darst, S.A. Structural basis for promoter -10 element recognition by the bacterial RNA polymerase σ subunit. Cell 2011, 147, 1257–1269. [Google Scholar] [CrossRef]
  7. Mustaev, A.; Roberts, J.; Gottesman, M. Transcription elongation. Transcription 2017, 8, 150–161. [Google Scholar] [CrossRef]
  8. Schneider, D.A.; Murray, H.D.; Gourse, R.L. Measuring control of transcription initiation by changing concentrations of nucleotides and their derivatives. Methods Enzymol. 2003, 370, 606–617. [Google Scholar] [CrossRef]
  9. Turnbough, C.L. Regulation of bacterial gene expression by the NTP substrates of transcription initiation. Mol. Microbiol. 2008, 69, 10–14. [Google Scholar] [CrossRef]
  10. Murray, H.D.; Schneider, D.A.; Gourse, R.L. Control of rRNA expression by small molecules is dynamic and nonredundant. Mol. Cell 2003, 12, 125–134. [Google Scholar] [CrossRef]
  11. Krásný, L.; Gourse, R.L. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation. EMBO J. 2004, 23, 4473–4483. [Google Scholar] [CrossRef] [PubMed]
  12. Bittner, A.N.; Kriel, A.; Wang, J.D. Lowering GTP Level increases survival of amino acid starvation but slows growth rate for Bacillus subtilis cells lacking (p)ppGpp. J. Bacteriol. 2014, 196, 2067–2076. [Google Scholar] [CrossRef] [PubMed]
  13. Kriel, A.; Bittner, A.N.; Kim, S.H.; Liu, K.; Tehranchi, A.K.; Zou, W.Y.; Rendon, S.; Chen, R.; Tu, B.P.; Wang, J.D. Direct regulation of GTP homeostasis by (p)ppGpp: A critical component of viability and stress resistance. Mol. Cell 2012, 48, 231–241. [Google Scholar] [CrossRef] [PubMed]
  14. Henkin, T.M.; Yanofsky, C. Regulation by transcription attenuation in bacteria: How RNA provides instructions for transcription termination/antitermination decisions. BioEssays 2002, 24, 700–707. [Google Scholar] [CrossRef]
  15. Krásný, L.; Tišerová, H.; Jonák, J.; Rejman, D.; Šanderová, H. The identity of the transcription +1 position is crucial for changes in gene expression in response to amino acid starvation in Bacillus subtilis. Mol. Microbiol. 2008, 69, 42–54. [Google Scholar] [CrossRef]
  16. Natori, Y.; Tagami, K.; Murakami, K.; Yoshida, S.; Tanigawa, O.; Moh, Y.; Masuda, K.; Wada, T.; Suzuki, S.; Nanamiya, H.; et al. Transcription activity of individual rrn operons in Bacillus subtilis mutants deficient in (p)ppGpp synthetase genes, relA, yjbM, and ywaC. J. Bacteriol. 2009, 191, 4555–4561. [Google Scholar] [CrossRef][Green Version]
  17. Kästle, B.; Geiger, T.; Gratani, F.L.; Reisinger, R.; Goerke, C.; Borisova, M.; Mayer, C.; Wolz, C. rRNA regulation during growth and under stringent conditions in S taphylococcus aureus. Environ. Microbiol. 2015, 17, 4394–4405. [Google Scholar] [CrossRef]
  18. Zechiedrich, E.L.; Khodursky, A.B.; Bachellier, S.; Schneider, R.; Chen, D.; Lilley, D.M.J.; Cozzarelli, N.R. Roles of topoisomerases in maintaining steady-state DNA supercoiling in Escherichia coli. J. Biol. Chem. 2000, 275, 8103–8113. [Google Scholar] [CrossRef]
  19. Higgins, C.F.; Dorman, C.J.; Stirling, D.A.; Waddell, L.; Booth, I.R.; May, G.; Bremer, E. A physiological role for DNA supercoiling in the osmotic regulation of gene expression in S. typhimurium and E. coli. Cell 1988, 52, 569–584. [Google Scholar] [CrossRef]
  20. Richardson, S.M.; Higgins, C.F.; Lilley, D.M. The genetic control of DNA supercoiling in Salmonella typhimurium. EMBO J. 1984, 3, 1745–1752. [Google Scholar] [CrossRef]
  21. McClure, W.R. Mechanism and control of transcription initiation in prokaryotes. Annu. Rev. Biochem. 1985, 54, 171–204. [Google Scholar] [CrossRef] [PubMed]
  22. Schnetz, K.; Wang, J.C. Silencing of the Escherichia Coli bgl promoter: Effects of template supercoiling and cell extracts on promoter activity in vitro. Nucleic Acids Res. 1996, 24, 2422–2428. [Google Scholar] [CrossRef] [PubMed][Green Version]
  23. Sioud, M.; Boudabous, A.; Cekaite, L. Transcriptional responses of Bacillus subtillis and thuringiensis to antibiotics and anti-tumour drugs. Int. J. Mol. Med. 2009, 23, 33–39. [Google Scholar] [CrossRef] [PubMed]
  24. Myagmarjav, B.-E.; Konkol, M.A.; Ramsey, J.; Mukhopadhyay, S.; Kearns, D.B. ZpdN, a Plasmid-encoded sigma factor homolog, induces pBS32-dependent cell death in Bacillus subtilis. J. Bacteriol. 2016, 198, 2975–2984. [Google Scholar] [CrossRef]
  25. Burton, A.T.; DeLoughery, A.; Li, G.W.; Kearns, D.B. Transcriptional regulation and mechanism of sigN (ZpdN), a pBS32-encoded sigma factor in bacillus subtilis. MBio 2019, 10, e01899-19. [Google Scholar] [CrossRef]
  26. Qi, Y.; Hulett, F.M. PhoP~P and RNA polymerase sigma(A) holoenzyme are sufficient for transcription of Pho regulon promoters in Bacillus subtilis: PhoP~P activator sites within the coding region stimulate transcription in vitro. Mol. Microbiol. 1998, 28, 1187–1197. [Google Scholar] [CrossRef]
  27. Chang, B.-Y.; Doi, R.H. Overproduction, Purification, and Characterization of Bacillus subtilis RNA Polymerase SigA Factor. J. Bacteriol. 1990, 172, 3257–3263. [Google Scholar] [CrossRef]
  28. Chen, Y.-F.; Helmann, J.D. The Bacillus subtilis Flagellar Regulatory Protein SigmaD: Overproduction, Domain Analysis and DNA-binding Properties. J. Mol. Biol. 1995, 249, 743–753. [Google Scholar] [CrossRef]
  29. Paul, B.J.; Ross, W.; Gaal, T.; Gourse, R.L. rRNA Transcription in Escherichia coli. Annu. Rev. Genet. 2004, 38, 749–770. [Google Scholar] [CrossRef]
  30. Panova, N.; Zborníková, E.; Šimák, O.; Pohl, R.; Kolář, M.; Bogdanová, K.; Večeřová, R.; Seydlová, G.; Fišer, R.; Hadravová, R.; et al. Insights into the mechanism of action of bactericidal Lipophosphonoxins. PLoS ONE 2015, 10, e0145918. [Google Scholar] [CrossRef][Green Version]
  31. Imamura, D.; Zhou, R.; Feig, M.; Kroos, L. Evidence that the Bacillus subtilis SpoIIGA protein is a novel type of signal-transducing aspartic protease. J. Biol. Chem. 2008, 283, 15287–15299. [Google Scholar] [CrossRef] [PubMed]
  32. LaBell, T.L.; Trempy, J.E.; Haldenwang, W.G. Sporulation-specific σ factor σ29 of Bacillus subtilis is synthesized from a precursors protein, P31. Proc. Natl. Acad. Sci. USA 1987, 84, 1784–1788. [Google Scholar] [CrossRef] [PubMed]
  33. Ross, W.; Thompson, J.F.; Newlands, J.T.; Gourse, R.L.E. E. coli Fis protein activates ribosomal RNA transcription in vitro and in vivo. EMBO J. 1990, 9, 3733–3742. [Google Scholar] [CrossRef] [PubMed]
  34. Deneer, H.G.; Spiegelman, G.B. Bacillus subtilis rRNA promoters are growth rate regulated in Escherichia coli. J. Bacteriol. 1987, 169, 995–1002. [Google Scholar] [CrossRef]
  35. Samarrai, W.; Liu, D.X.; White, A.M.; Studamire, B.; Edelstein, J.; Srivastava, A.; Widom, R.L.; Rudner, R. Differential responses of Bacillus subtilis rRNA promoters to nutritional stress. J. Bacteriol. 2011, 193, 723–733. [Google Scholar] [CrossRef]
  36. Wellington, S.R.; Spiegelman, G.B. The kinetics of formation of complexes between Escherichia coli RNA polymerase and the rrnB P1 and P2 promoters of Bacillus subtilis. Effects of guanosine tetraphosphate on select steps of transcription initiation. J. Biol. Chem. 1993, 268, 7205–7214. [Google Scholar]
  37. Fukushima, T.; Ishikawa, S.; Yamamoto, H.; Ogasawara, N.; Sekiguchi, J. Transcriptional, functional and cytochemical analyses of the veg gene in Bacillus subtilis. J. Biochem. 2003, 133, 475–483. [Google Scholar] [CrossRef]
  38. Lei, Y.; Oshima, T.; Ogasawara, N.; Ishikawa, S. Functional analysis of the protein veg, which stimulates biofilm formation in Bacillus subtilis. J. Bacteriol 2013, 195, 1697–1705. [Google Scholar] [CrossRef]
  39. Conter, A.; Menchon, C.; Gutierrez, C. Role of DNA supercoiling and RpoS sigma factor in the osmotic and growth phase-dependent induction of the gene osmE of Escherichia coli K12. J. Mol. Biol. 1997, 273, 75–83. [Google Scholar] [CrossRef]
  40. Nicholson, W.L.; Setlow, P. Dramatic increase in negative superhelicity of plasmid DNA in the forespore compartment of sporulating cells of Bacillus subtilis. J. Bacteriol. 1990, 172, 7–14. [Google Scholar] [CrossRef]
  41. Alice, A.F.; Sanchez-Rivas, C. DNA supercoiling and osmoresistance in Bacillus subtilis 168. Curr. Microbiol. 1997, 35, 309–315. [Google Scholar] [CrossRef] [PubMed]
  42. Lewis, R.J.; Singh, O.M.P.; Smith, C.V.; Skarzynski, T.; Maxwell, A.; Wonacott, A.J.; Wigley, D.B. The nature of inhibition of DNA Gyrase by the Coumarins and the Cyclothialidines revealed by X-ray crystallography. Embo J. 1996, 15, 1412–1420. [Google Scholar] [CrossRef] [PubMed]
  43. Sugino, A.; Higginst, N.P.; Brownt, P.O.; Peeblesf, C.L.; Cozzarellitf, N.R. Energy coupling in DNA gyrase and the mechanism of action of novobiocin. Biochemistry 1978, 75, 4838–4842. [Google Scholar] [CrossRef] [PubMed]
  44. Gellert, M.; O’Dea, M.H.; Itoh, T.; Tomizawa, J.I. Novobiocin and coumermycin inhibit DNA supercoiling catalyzed by DNA gyrase. Proc. Natl. Acad. Sci. USA 1976, 73, 4474–4478. [Google Scholar] [CrossRef]
  45. Dennis, P.P.; Bremer, H. Modulation of chemical composition and other parameters of the cell at different exponential growth rates. EcoSal Plus 2008, 3, 1553–1569. [Google Scholar] [CrossRef]
  46. Sojka, L.; Kouba, T.; Barvík, I.; Šanderová, H.; Maderová, Z.; Jonák, J.; Krásný, L. Rapid changes in gene expression: DNA determinants of promoter regulation by the concentration of the transcription initiating NTP in Bacillus subtilis. Nucleic Acids Res. 2011, 39, 4598–4611. [Google Scholar] [CrossRef]
  47. Estrem, S.T.; Gaal, T.; Ross, W.; Gourse, R.L. Identification of an UP element consensus sequence for bacterial promoters. Proc. Natl. Acad. Sci. USA 1998, 95, 9761–9766. [Google Scholar] [CrossRef]
  48. Meng, W.; Belyaeva, T.; Savery, N.J.; Busby, S.J.W.; Ross, W.E.; Gaal, T.; Gourse, R.L.; Thomas, M.S. UP element-dependent transcription at the Escherichia coli rrnB P1 promoter: Positional requirements and role of the RNA polymerase α subunit linker. Nucleic Acids Res. 2001, 29, 4166–4178. [Google Scholar] [CrossRef]
  49. Rao, L.; Ross, W.; Appleman, J.A.; Gaal, T.; Leirmo, S.; Schlax, J.P.; Record, M.; Thomas, J.; Gourse, R.L. Factor independent activation of rrnB P1: An “extended” promoter with an upstream element that dramatically increases promoter strength. J. Mol. Biol. 1994, 235, 1421–1435. [Google Scholar] [CrossRef]
  50. Klumpp, S.; Hwa, T. Growth-rate-dependent partitioning of RNA polymerases in bacteria. Proc. Natl. Acad. Sci. USA 2008, 105, 20245–20250. [Google Scholar] [CrossRef]
  51. Liang, S.T.; Bipatnath, M.; Xu, Y.C.; Chen, S.L.; Dennis, P.; Ehrenberg, M.; Bremer, H. Activities of constitutive promoters in Escherichia coli. J. Mol. Biol. 1999, 292, 19–37. [Google Scholar] [CrossRef] [PubMed]
  52. Haldenwang, W.G.; Losick, R. Novel RNA polymerase σ factor from Bacillus subtilis. Proc. Natl. Acad. Sci. USA 1980, 77, 7000–7004. [Google Scholar] [CrossRef] [PubMed]
  53. Hecker, M.; Völker, U. General stress response of Bacillus subtilis and other bacteria. Adv. Microb. Physiol. 2001, 44, 35–91. [Google Scholar] [CrossRef] [PubMed]
  54. Jaehning, J.A.; Wiggs, J.L.; Chamberlin, M.J. Altered promoter selection by a novel form of Bacillus subtilis RNA polymerase. Proc. Natl. Acad. Sci. USA 1979, 76, 5470–5474. [Google Scholar] [CrossRef] [PubMed]
  55. Haldenwang, W.G.; Lang, N.; Losick, R. A sporulation-induced sigma-like regulatory protein from b. subtilis. Cell 1981, 23, 615–624. [Google Scholar] [CrossRef]
  56. Partridge, S.R.; Foulger, D.; Errington, J. The role of σF in prespore-specific transcription in Bacillus subtilis. Mol. Microbiol. 1991, 5, 757–767. [Google Scholar] [CrossRef] [PubMed]
  57. Johnson, W.C.; Moran, C.P.; Losick, R. Two RNA polymerase sigma factors from Bacillus subtilis discriminate between overlapping promoters for a developmentally regulated gene. Nature 1983, 302, 800–804. [Google Scholar] [CrossRef]
  58. Earl, A.M.; Losick, R.; Kolter, R. Bacillus subtilis genome diversity. J. Bacteriol. 2007, 189, 1163–1170. [Google Scholar] [CrossRef]
  59. Burby, P.E.; Simmons, L.A. A bacterial DNA repair pathway specific to a natural antibiotic. Mol. Microbiol. 2019, 111, 338–353. [Google Scholar] [CrossRef]
  60. Lee, Y.J.; Park, S.J.; Ciccone, S.L.M.; Kim, C.R.; Lee, S.H. An in vivo analysis of MMC-induced DNA damage and its repair. Carcinogenesis 2006, 27, 446–453. [Google Scholar] [CrossRef]
  61. Ueda, K.; Morita, J.; Komano, T. Phage inactivation and DNA strand scission activities of 7-N-(p-hydroxyphenyl)mitomycin C. J. Antibiot. 1982, 35, 1380–1386. [Google Scholar] [CrossRef] [PubMed]
  62. Rosenberg, A.; Sinai, L.; Smith, Y.; Ben-Yehuda, S. Dynamic expression of the translational machinery during Bacillus subtilis life cycle at a single cell level. PLoS ONE 2012, 7, 41921. [Google Scholar] [CrossRef] [PubMed]
  63. Burenina, O.Y.; Hoch, P.G.; Damm, K.; Salas, M.; Zatsepin, T.S.; Lechner, M.; Oretskaya, T.S.; Kubareva, E.A.; Hartmann, R.K. Mechanistic comparison of Bacillus subtilis 6S-1 and 6S-2 RNAs-commonalities and differences. RNA 2014, 20, 348–359. [Google Scholar] [CrossRef]
  64. Glaser, G.; Sarmientos, P.; Cashel, M. Functional interrelationship between two tandem E. coli ribosomal RNA promoters. Nature 1983, 302, 74–76. [Google Scholar] [CrossRef] [PubMed]
  65. Schultz, M.C.; Brill, S.J.; Ju, Q.; Sternglanz, R.; Reeder, R.H. Topoisomerases and yeast rRNA transcription: Negative supercoiling stimulates initiation and topoisomerase activity is required for elongation. Genes Dev. 1992, 6, 1332–1341. [Google Scholar] [CrossRef] [PubMed]
  66. Bird, T.; Burbulys, D.; Wu, J.; Strauch, M.; Hoch, J.; Spiegelman, G. The effect of supercoiling on the in vitro transcription of the spoIIA operon from Bacillus subtilis. Biochimie 1992, 74, 627–634. [Google Scholar] [CrossRef]
  67. Helmann, J.D. Compilation and analysus of Bacillus Subtilis σA-dependent promoter sequences: Evidence for extended contact between RNA polymerse and upstream promoter DNA. Nucleic Acids Res. 1995, 23, 2351–2360. [Google Scholar] [CrossRef]
  68. Typas, A.; Hengge, R. Role of the spacer between the -35 and -10 regions in sigmaS promoter selectivity in Escherichia coli. Mol. Microbiol. 2006, 59, 1037–1051. [Google Scholar] [CrossRef]
  69. Bordes, P.; Conter, A.; Morales, V.; Bouvier, J.; Kolb, A.; Gutierrez, C. DNA supercoiling contributes to disconnect σS accumulation from σS-dependent transcription in Escherichia coli. Mol. Microbiol. 2003, 48, 561–571. [Google Scholar] [CrossRef]
  70. Kusano, S.; Ding, Q.; Fujita, N.; Ishihama, A. Promoter selectivity of Escherichia coli RNA Polymerase E and E Holoenzymes. J. Biol. Chem. 1996, 271, 1998–2004. [Google Scholar] [CrossRef]
Figure 1. Correlation between GTP concentration and promoter activity after entry into the stationary phase. (A) Sequences of Pveg and rrnB P1. (B) Relative promoter activities of rrnB P1 (black circles) and Pveg promoters (open circles) after entry into stationary phase, relative GTP concentration (green squares), and optical density (dashed grey line). Promoter activities and GTP concentrations were normalized to 1 at time 0. Promoter activities were measured by qPE from wt B. subtilis strains: rrnB P1 (LK134), Pveg (LK135). Promoter activities were calculated from three independent experiments, the error bars show ±SD. The GTP concentrations are from two independent experiments, showing the mean, the bars show the range. A representative bacterial growth curve is shown. The vertical arrow indicates the entry into stationary phase.
Figure 1. Correlation between GTP concentration and promoter activity after entry into the stationary phase. (A) Sequences of Pveg and rrnB P1. (B) Relative promoter activities of rrnB P1 (black circles) and Pveg promoters (open circles) after entry into stationary phase, relative GTP concentration (green squares), and optical density (dashed grey line). Promoter activities and GTP concentrations were normalized to 1 at time 0. Promoter activities were measured by qPE from wt B. subtilis strains: rrnB P1 (LK134), Pveg (LK135). Promoter activities were calculated from three independent experiments, the error bars show ±SD. The GTP concentrations are from two independent experiments, showing the mean, the bars show the range. A representative bacterial growth curve is shown. The vertical arrow indicates the entry into stationary phase.
Microorganisms 09 00087 g001
Figure 2. Effect of novobiocin-induced relaxation of chromosome on total RNA synthesis, selected promoter activities, and GTP level. (AD) Cells were grown to early exponential phase (OD600 ~0.3), and at time 5 min they were treated with novobiocin (5 μg/mL). (A) Total RNA synthesis after novobiocin treatment. After 3H-uridine had been added (time 0), the culture was divided into three flasks. At time 5 min the cells were treated with novobiocin (blue line) or with rifampicin (red line) as a control, or left untreated (black line). The amount of radiolabeled RNA at 5 min was set as 1. Black circles, mock-treated; blue triangles, treated with novobiocin; red squares, treated with rifampicin. The values are averages of three independent experiments ±SD. (B,C) The relative activities of rrnB P1 and Pveg promoters after novobiocin treatment. Cells were grown and at 5 min treated with novobiocin or not. RNA was extracted and determination of promoter activity was done by RT-qPCR. Promoter activities were set as 1 at time 5 min. Blue lines are novobiocin-treated samples, black lines are untreated samples. The experiment was performed three times. The error bars show ±SD. (D) GTP concentration after novobiocin treatment. Cells were grown in the presence of [32P] H3PO4 and treated with novobiocin. Levels of GTP were determined by TLC. The GTP level at 5 min was set as 1. Results are averages from two measurements. The error bars show the range.
Figure 2. Effect of novobiocin-induced relaxation of chromosome on total RNA synthesis, selected promoter activities, and GTP level. (AD) Cells were grown to early exponential phase (OD600 ~0.3), and at time 5 min they were treated with novobiocin (5 μg/mL). (A) Total RNA synthesis after novobiocin treatment. After 3H-uridine had been added (time 0), the culture was divided into three flasks. At time 5 min the cells were treated with novobiocin (blue line) or with rifampicin (red line) as a control, or left untreated (black line). The amount of radiolabeled RNA at 5 min was set as 1. Black circles, mock-treated; blue triangles, treated with novobiocin; red squares, treated with rifampicin. The values are averages of three independent experiments ±SD. (B,C) The relative activities of rrnB P1 and Pveg promoters after novobiocin treatment. Cells were grown and at 5 min treated with novobiocin or not. RNA was extracted and determination of promoter activity was done by RT-qPCR. Promoter activities were set as 1 at time 5 min. Blue lines are novobiocin-treated samples, black lines are untreated samples. The experiment was performed three times. The error bars show ±SD. (D) GTP concentration after novobiocin treatment. Cells were grown in the presence of [32P] H3PO4 and treated with novobiocin. Levels of GTP were determined by TLC. The GTP level at 5 min was set as 1. Results are averages from two measurements. The error bars show the range.
Microorganisms 09 00087 g002
Figure 3. The affinity of RNAP for iNTP in vitro changes on different DNA templates. (A) Multiple-round transcriptions as a function of GTP concentration: representative primary data and their graphical comparison for rrnB P1core and Pveg. The maximum signal was set as 1. (B) Graphical comparison of KGTP values for SC and LIN DNA templates. The values are calculated from at least four experiments, the error bars show ±SD. (C) Low affinity for LIN templates of full-length rrn promoter variants. Representative primary data are shown.
Figure 3. The affinity of RNAP for iNTP in vitro changes on different DNA templates. (A) Multiple-round transcriptions as a function of GTP concentration: representative primary data and their graphical comparison for rrnB P1core and Pveg. The maximum signal was set as 1. (B) Graphical comparison of KGTP values for SC and LIN DNA templates. The values are calculated from at least four experiments, the error bars show ±SD. (C) Low affinity for LIN templates of full-length rrn promoter variants. Representative primary data are shown.
Microorganisms 09 00087 g003
Figure 4. The affinity of RNAP for promoter DNA. Multiple-round transcriptions were carried as a function of the increasing DNA/RNAP ratio. The tested promoters were rrnB P1+P2 (A) and Pveg (B). Primary data are shown above the graphs. The maximum signal in the plateau phase was set as 1. SC—supercoiled and LIN—linear DNA templates. The experiments were conducted at least four times with similar results. Representative primary data are shown. (C) Graphical comparison of relative affinities of RNAP for Pveg and rrnB P1+P2 promoters. The bars show relative concentrations of promoter DNA at which the activity of RNAP was 50%. The affinity of RNAP for SC promoter DNA was set as 1 for each promoter.
Figure 4. The affinity of RNAP for promoter DNA. Multiple-round transcriptions were carried as a function of the increasing DNA/RNAP ratio. The tested promoters were rrnB P1+P2 (A) and Pveg (B). Primary data are shown above the graphs. The maximum signal in the plateau phase was set as 1. SC—supercoiled and LIN—linear DNA templates. The experiments were conducted at least four times with similar results. Representative primary data are shown. (C) Graphical comparison of relative affinities of RNAP for Pveg and rrnB P1+P2 promoters. The bars show relative concentrations of promoter DNA at which the activity of RNAP was 50%. The affinity of RNAP for SC promoter DNA was set as 1 for each promoter.
Microorganisms 09 00087 g004
Figure 5. RNAP levels during bacterial growth. Amounts of RNAP were detected by Western blotting from 5 μg of total protein per lane. Representative primary data are shown above the graph. The RNAP level from time point 1 was set as a 1. STA—stationary phase (indicated with the arrow). The experiment was conducted in two independents replicas. The points are averages, the error bars show the range. The dashed line shows a representative bacterial growth.
Figure 5. RNAP levels during bacterial growth. Amounts of RNAP were detected by Western blotting from 5 μg of total protein per lane. Representative primary data are shown above the graph. The RNAP level from time point 1 was set as a 1. STA—stationary phase (indicated with the arrow). The experiment was conducted in two independents replicas. The points are averages, the error bars show the range. The dashed line shows a representative bacterial growth.
Microorganisms 09 00087 g005
Figure 6. Transcription in vitro with alternative σ factors on different DNA templates. Representative primary data are shown (radioactively labelled transcripts resolved by polyacrylamide electrophoresis). SC stands for supercoiled promoter DNA, LIN for linear DNA. Letters above the gels indicate the sigma factor used—A for σA, B for σB etc. Each sigma factor is depicted with different color (σA, black; σB, dark blue; σD, green; σE, yellow; σF, brown; σH, red and σN, purple). For each promoter three independent experiments were performed. Transcription from SC was set as 1 for each promoter. Quantitation of results is shown in graphs below the respective primary data. The graphs show averages ±SD. The reactions with σA on all promoter fragments were used to show that the observed transcription was due to the addition of the specific σ factors and not due to (theoretical) contamination of the core with σA. (A) Transcription in vitro from selected σB, σD, σE, σF and σH -dependent promoters. (B) Transcription in vitro from σN-dependent promoters. (C) Transcription in vitro using a longer construct, sigN P2+P3. P2 is σA-dependent, P3 is σN-dependent.
Figure 6. Transcription in vitro with alternative σ factors on different DNA templates. Representative primary data are shown (radioactively labelled transcripts resolved by polyacrylamide electrophoresis). SC stands for supercoiled promoter DNA, LIN for linear DNA. Letters above the gels indicate the sigma factor used—A for σA, B for σB etc. Each sigma factor is depicted with different color (σA, black; σB, dark blue; σD, green; σE, yellow; σF, brown; σH, red and σN, purple). For each promoter three independent experiments were performed. Transcription from SC was set as 1 for each promoter. Quantitation of results is shown in graphs below the respective primary data. The graphs show averages ±SD. The reactions with σA on all promoter fragments were used to show that the observed transcription was due to the addition of the specific σ factors and not due to (theoretical) contamination of the core with σA. (A) Transcription in vitro from selected σB, σD, σE, σF and σH -dependent promoters. (B) Transcription in vitro from σN-dependent promoters. (C) Transcription in vitro using a longer construct, sigN P2+P3. P2 is σA-dependent, P3 is σN-dependent.
Microorganisms 09 00087 g006
Table 1. Bacterial strains used in a study.
Table 1. Bacterial strains used in a study.
NameOriginal codeConstructDescriptionReference
B. subtilis
LK134RLG7554rrnB P1-lacZMO1099 amyE::Cm rrnB P1 (−39/+1)-lacZ[11]
LK135RLG7555Pveg-lacZMO1099 amyE::Cm Pveg (−38/−1, +1G)-lacZ[11]
LK41RLG6943RM-lacZMO1099 amyE::Cm rrnO P2 (−77/+50)-lacZ[11]
LK1723RLG7024wt RNAPβ’ with C-ter. His10x; MH5636[26]
E. coli
LK22 SigASigA; BL21(DE3)[27]
LK1207 SigBSigB with C-ter. His6x; BL21(DE3)This work
LK1187 SigDSigD; BL21(DE3)[28]
LK2580 SigESigE with C-ter. His6x; BL21(DE3)This work
LK1425 SigFSigF with C-ter. His6x; BL21(DE3)This work
LK1208 SigHSigH with C-ter. His6x; BL21(DE3)This work
LK2531 SigNHis-SUMO-SigN in pBM05; BL21(DE3)This work
LK1177RLG7558PvegpRLG770 with Pveg (−38/+1) +1G; DH5α[11]
LK1522RLG7596rrnB P1corepRLG770 with rrnB P1 (−39/+1); DH5α[11]
LK28RLG6927rrnB P1+P2pRLG770 with rrnB P1+P2 (−248/+8); DH5α[15]
LK17RLG6916rrnO P1+P2pRLG770 with rrnO P1+P2 (−314/+9); DH5αThis work
LK1231 PtrxApRLG770 with PtrxA (−249/+11); DH5αThis work
LK1233 PmotApRLG770 with PmotA (−249/+11); DH5αThis work
LK2594 PspoIIIDpRLG770 with PspoIIID (−150/+10); DH5αThis work
LK1495 PspoIIQpRLG770 with PspoIIQ (−251/+9); DH5αThis work
LK1235 PspoVGpRLG770 with PspoVG (−94/+11); DH5αThis work
LK2672 sigN P2+P3pRLG770 with sigN P2+P3 (−247/+159); DH5αThis work
LK2673 PzpaBpRLG770 with PzpaB (−266/+175); DH5αThis work
LK2608 PzpbYpRLG770 with PzpbY (−304/+155); DH5αThis work
LK2609 PzpdGpRLG770 with PzpdG (−244/+170); DH5αThis work
Table 2. List of primers.
Table 2. List of primers.
Primer No (#)Sequence 5′→ 3′
#1001GGAATTCCATATGAATCTACAGAACAACAAGGPrimers for sigH cloning into pET-22b(+)
#1002CCGCTCGAGCTATTACAAACTGATTTCGCG
#1004GGAATTCCATATGACACAACCATCAAAAACPrimers for sigB cloning into pET-22b(+)
#1006CCGCTCGAGCATTAACTCCATCGAGGGATC
#1069CCGGAATTCATTCCGGAGTCATTCTTACGGPrimers for PtrxA cloning into pRLG770
#1070CCCAAGCTTCACTGTCATGTACTTTACCATG
#1075CCGGAATTCCTTTACACTTTTTTAAGGAGGPrimers for PmotA cloning into pRLG770
#1076CCCAAGCTTCTAGCTTGTCTATGGTTAATATC
#1079CCGGAATTCTTTATGACCTAATTGTGTAACPrimers for PspoVG cloning into pRLG770
#1080CCCAAGCTTATAAAAGCATTAGTGTATC
#1309GGAATTCCATATGGATGTGGAGGTTAAGAAAAACPrimers for sigF cloning into pET-22b(+)
#1311CCGCTCGAGGCCATCCGTATGATCCATTTG
#1425CCGGAATTCCATTCCATCCGGTCTTCAGG Primers for PspoIIQ cloning into pRLG770
#1426CCCAAGCTTCATCACCTCAGCAACATTCTG
#2973CAGTAACTTCCACAGTAGTTCACCACuniversal reverse primer for PE and qPCR
#2974TCTAAGCTTCTAGGATCCCCtest RNA-specific forward primer for PE and qPCR
#2975GTCGCTTTGAGAGAAGCACARM RNA-specific forward primer for PE and qPCR
#3109GCGAATTCCGTGTCGGTCAACATAATAAAGGPrimers for sigN P2+P3 cloning into pRLG770
#3110GCAAGCTTCGGCAAAAATCTTTCTCTCACC
#3111GCGAATTCGCGATGAATGAAGAGACACGGPrimers for PzpaB cloning into pRLG770
#3112GCAAGCTTAGTCCATCTCGAAGATCTGGT
#3113GCGAATTCGACTCCAACATTTCTATTCCPrimers for PzpbY cloning into pRLG770
#3114GCAAGCTTGGTCTTCTTCACTTAATTCA
#3117GCGAATTCTCAAAGATCTTCTAACTTGTPrimers for PzpdG cloning into pRLG770
#3118GCAAGCTTGGCAGTAATCAATCAATTCT
#3166CGGCATATGTACATAGGCGGGAGTGAAGCCPrimers for sigE active form cloning into pET-22b(+)
#3167CCGCTCGAGCACCATTTTGTTGAACTCTTTTC
#3170GGCGAATTCGCTTATTTCATTTTACAGGAGPrimers for PspoIIID cloning into pRLG770
#3171CCGAAGCTTTGTTAGGTTTGTAACAGTGT
primer AGGGAATTCATGGACATCAATGATATCTCPrimers for rrnO P1+P2 cloning into pRLG770
primer BGGAAGCTTTCAAAGCGACTACTTAATAG
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Sudzinová, P.; Kambová, M.; Ramaniuk, O.; Benda, M.; Šanderová, H.; Krásný, L. Effects of DNA Topology on Transcription from rRNA Promoters in Bacillus subtilis. Microorganisms 2021, 9, 87. https://doi.org/10.3390/microorganisms9010087

AMA Style

Sudzinová P, Kambová M, Ramaniuk O, Benda M, Šanderová H, Krásný L. Effects of DNA Topology on Transcription from rRNA Promoters in Bacillus subtilis. Microorganisms. 2021; 9(1):87. https://doi.org/10.3390/microorganisms9010087

Chicago/Turabian Style

Sudzinová, Petra, Milada Kambová, Olga Ramaniuk, Martin Benda, Hana Šanderová, and Libor Krásný. 2021. "Effects of DNA Topology on Transcription from rRNA Promoters in Bacillus subtilis" Microorganisms 9, no. 1: 87. https://doi.org/10.3390/microorganisms9010087

APA Style

Sudzinová, P., Kambová, M., Ramaniuk, O., Benda, M., Šanderová, H., & Krásný, L. (2021). Effects of DNA Topology on Transcription from rRNA Promoters in Bacillus subtilis. Microorganisms, 9(1), 87. https://doi.org/10.3390/microorganisms9010087

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop