Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks from Selected Regions of Namibia
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Sites
2.2. Molecular Screening and Identification of Rickettsia Species
2.3. Phylogenetic Analysis
2.4. Statistical Analysis
3. Results
3.1. Tick Sampling and Identification
3.2. Rickettsia Screening and Identification
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Piotrowski, M.; Rymaszewska, A. Expansion of Tick-Borne Rickettsioses in the World. Microorganisms 2020, 8, 1906. [Google Scholar] [CrossRef] [PubMed]
- Sonenshine, D.E. Range Expansion of Tick Disease Vectors in North America: Implications for Spread of Tick-Borne Disease. Int. J. Environ. Res. Public Health 2018, 15, 478. [Google Scholar] [CrossRef]
- Merhej, V.; Angelakis, E.; Socolovschi, C.; Raoult, D. Genotyping, evolution and epidemiological findings of Rickettsia species. Infect. Genet. Evol. 2014, 25, 122–137. [Google Scholar] [CrossRef] [PubMed]
- Pfäffle, M.; Littwin, N.; Muders, S.V.; Petney, T.N. The ecology of tick-borne diseases. Int. J. Parasitol. 2013, 43, 1059–1077. [Google Scholar] [CrossRef]
- Kong, Y.; Zhang, G.; Jiang, L.; Wang, P.; Zhang, S.; Zheng, X.; Li, Y. Metatranscriptomics Reveals the Diversity of the Tick Virome in Northwest China. Microbiol. Spectr. 2022, 10, e0111522. [Google Scholar] [CrossRef]
- Tijsse-Klasen, E.; Koopmans, M.P.; Sprong, H. Tick-borne pathogen—Reversed and conventional discovery of disease. Front. Public Health 2014, 2, 73. [Google Scholar] [CrossRef]
- Raoult, D.; Roux, V. Rickettsioses as paradigms of new or emerging infectious diseases. Clin. Microbiol. Rev. 1997, 10, 694–719. [Google Scholar] [CrossRef] [PubMed]
- Weinert, L.A.; Werren, J.A.; Aebi, A.; Stone, G.N.; Jiggins, F.M. Evolution and diversity of Rickettsiabacteria. BMC Biol. 2009, 7, 6. [Google Scholar] [CrossRef] [PubMed]
- Chaparro-Gutiérrez, J.J.; Acevedo-Gutiérrez, L.Y.; Mendell, N.L.; Robayo-Sánchez, L.N.; Rodríguez-Durán, A.; Cortés-Vecino, J.A.; Fernández, D.; Ramírez-Hernández, A.; Bouyer, D.H. First isolation of Rickettsia amblyommatis from Amblyomma mixtum in Colombia. Parasit. Vectors 2023, 16, 332. [Google Scholar] [CrossRef]
- Fang, R.; Blanton, L.S.; Walker, D.H. Rickettsiae as Emerging Infectious Agents. Clin. Lab. Med. 2017, 37, 383–400. [Google Scholar] [CrossRef]
- Fournier, P.E.; Dumler, J.S.; Greub, G.; Zhang, J.; Wu, Y.; Raoult, D. Gene sequence-based criteria for identification of new rickettsia isolates andnov description of Rickettsia heilongjiangensis sp. J. Clin. Microbiol. 2003, 41, 5456–5465. [Google Scholar] [CrossRef] [PubMed]
- Fournier, P.E.; Raoult, D. Current knowledge on phylogeny and taxonomy of Rickettsia spp. Ann. N. Y. Acad. Sci. 2009, 1166, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Parola, P.; Paddock, C.D.; Socolovschi, C.; Labruna, M.B.; Mediannikov, O.; Kernif, T.; Abdad, M.Y.; Stenos, J.; Bitam, I.; Fournier, P.E.; et al. Update on tick-borne rickettsioses around the world: A geographic approach. Clin. Microbiol. Rev. 2013, 26, 657–702. [Google Scholar] [CrossRef] [PubMed]
- Parola, P.; Paddock, C.D.; Raoult, D. Tick-borne rickettsioses around the world: Emerging diseases challenging old concepts. Clin. Microbiol. Rev. 2005, 18, 719–756. [Google Scholar] [CrossRef] [PubMed]
- Jia, N.; Jiang, J.F.; Huo, Q.B.; Jiang, B.G.; Cao, W.C. Rickettsia sibirica subspecies sibirica BJ-90 as a cause of human disease. N. Engl. J. Med. 2013, 369, 1176–1178. [Google Scholar] [CrossRef] [PubMed]
- Satjanadumrong, J.; Robinson, M.T.; Hughes, T.; Blacksell, S.D. Distribution and Ecological Drivers of Spotted Fever Group Rickettsia in Asia. Ecohealth 2019, 16, 611–626. [Google Scholar] [CrossRef] [PubMed]
- Chao, L.L.; Erazo, E.; Robinson, M.; Liang, Y.F.; Shih, C.M. First detection and molecular identification of a pathogenic spotted fever group Rickettsia, R. massiliae, from Rhipicephalus haemaphysaloides ticks infesting dogs in southern Taiwan. Acta Trop. 2022, 236, 106666. [Google Scholar] [CrossRef] [PubMed]
- Horta, M.C.; Pinter, A.; Schumaker, T.T.; Labruna, M.B. Natural infection, transovarial transmission, and transstadial survival of Rickettsia bellii in the Tick Ixodes loricatus (Acari: Ixodidae) from Brazil. Ann. N. Y. Acad. Sci. 2006, 1078, 285–290. [Google Scholar] [CrossRef] [PubMed]
- Socolovschi, C.; Huynh, T.P.; Davoust, B.; Gomez, J.; Raoult, D.; Parola, P. Transovarial and trans-stadial transmission of Rickettsiae africae in Amblyomma variegatum ticks. Clin. Microbiol. Infect. 2009, 15 (Suppl. S2), 317–318. [Google Scholar] [CrossRef]
- Azad, A.F.; Beard, C.B. Rickettsial pathogens and their arthropod vectors. Emerg. Infect. Dis. 1998, 4, 179–186. [Google Scholar] [CrossRef]
- Zhang, Y.Y.; Sun, Y.Q.; Chen, J.J.; Teng, A.Y.; Wang, T.; Li, H.; Hay, S.I.; Fang, L.Q.; Yang, Y.; Liu, W. Mapping the global distribution of spotted fever group rickettsiae: A systematic review with modelling analysis. Lancet Digit. Health 2023, 5, e5–e15. [Google Scholar] [CrossRef] [PubMed]
- Jensenius, M.; Fournier, P.E.; Vene, S.; Hoel, T.; Hasle, G.; Henriksen, A.Z.; Hellum, K.B.; Raoult, D.; Myrvang, B. African tick bite fever in travelers to rural sub-Equatorial Africa. Clin. Infect. Dis. 2003, 36, 1411–1417. [Google Scholar] [CrossRef] [PubMed]
- Bitam, I. Vectors of rickettsiae in Africa. Ticks Tick Borne Dis. 2012, 3, 382–386. [Google Scholar] [CrossRef] [PubMed]
- Pillay, A.; Manyangadze, T.; Mukaratirwa, S. Prevalence of Rickettsia africae in tick vectors collected from mammalian hosts in sub-Saharan Africa: A systematic review and meta-analysis. Ticks Tick Borne Dis. 2022, 13, 101960. [Google Scholar] [CrossRef] [PubMed]
- Chitanga, S.; Chibesa, K.; Sichibalo, K.; Mubemba, B.; Nalubamba, K.S.; Muleya, W.; Changula, K.; Simulundu, E. Molecular detection and characterization of Rickettsia species in Ixodid ticks collected from cattle in southern Zambia. Front. Vet. Sci. 2021, 8, 684487. [Google Scholar] [CrossRef] [PubMed]
- Phiri, B.S.J.; Kattner, S.; Chitimia-Dobler, L.; Woelfel, S.; Albanus, C.; Dobler, G.; Küpper, T. Rickettsia spp. in Ticks of South Luangwa Valley, Eastern Province, Zambia. Microorganisms, 2023; 11, 167. [Google Scholar] [CrossRef]
- Qiu, Y.; Simuunza, M.; Kajihara, M.; Ndebe, J.; Saasa, N.; Kapila, P.; Furumoto, H.; Lau, A.C.C.; Nakao, R.; Takada, A.; et al. Detection of Tick-Borne Bacterial and Protozoan Pathogens in Ticks from the Zambia-Angola Border. Pathogens 2022, 11, 566. [Google Scholar] [CrossRef] [PubMed]
- Noden, B.H.; Tshavuka, F.I.; van der Colf, B.E.; Chipare, I.; Wilkinson, R. Exposure and risk factors to coxiella burnetii, spotted fever group and typhus group Rickettsiae, and Bartonella henselae among volunteer blood donors in Namibia. PLoS ONE 2014, 9, e108674. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Essbauer, S.; Hofmann, M.; Kleinemeier, C.; Wolfel, S.; Matthee, S. Rickettsia diversity in southern Africa: A small mammal perspective. Ticks Tick Borne Dis. 2018, 9, 288–301. [Google Scholar] [CrossRef]
- Walker, A.R.; Bouattour, A.; Camicas, J.L.; Estrada-Pena, A.; Horak, I.G.; Latif, A.A.; Pegram, R.G.; Preston, P.M. Ticks of Domestic Animals in Africa: A Guide to Identification of Species; Bioscience Reports; The University of Edinburgh: Edinburgh, UK, 2003. [Google Scholar]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. Available online: https://github.com/ablab/spades (accessed on 12 January 2024). [CrossRef]
- Tamura, K. Estimation of the number of nucleotide substitutions when there are strong transition-transversion and G+C-content biases. Mol. Biol. Evol. 1992, 9, 678–687. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
- Burket, C.T.; Vann, C.N.; Pinger, R.R.; Chatot, C.L.; Steiner, F.E. Minimum infection rate of Ambylomma americanum (Acari: Ixodidae) by Ehrlichia chaffeensis (Rickettsiales: Ehrlichieae) in southern Indiana. J. Med. Entomol. 1998, 35, 653–659. [Google Scholar] [CrossRef] [PubMed]
- Sergeant, E.S.G. EpiTools Epidemiological Calculators. Ausvet. 2018. Available online: http://epitools.ausvet.com.au (accessed on 12 December 2023).
- Portillo, A.; Perez-Martinez, L.; Santibanez, S.; Blanco, J.R.; Ibarra, V.; Oteo, J.A. Detection of Rickettsia africae in Rhipicephalus (Boophilus) decoloratus ticks from the Republic of Botswana, South Africa. Am. J. Trop. Med. Hyg. 2007, 77, 376–377. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Iweriebor, B.C.; Nqoro, A.; Obi, C.L. Rickettsia africae an Agent of African Tick Bite Fever in Ticks Collected from Domestic Animals in Eastern Cape, South Africa. Pathogens 2020, 9, 631. [Google Scholar] [CrossRef] [PubMed]
- Mazhetese, E.; Lukanji, Z.; Byaruhanga, C.; Neves, L.; Morar-Leather, D. Rickettsia africae infection rates and transovarial transmission in Amblyomma hebraeum ticks in Mnisi, Bushbuckridge, South Africa. Exp. Appl. Acarol. 2022, 86, 407–418. [Google Scholar] [CrossRef] [PubMed]
- Thekisoe, O.; Ramatla, T.; Ringo, A.; Mnisi, S.; Mphuthi, N.; Mofokeng, L.; Lekota, K.; Xuan, X. Molecular detection of Rickettsia africae from Amblyomma hebraeum ticks in Mafikeng city of North West Province, South Africa. Res. Vet. Sci. 2023, 164, 105027. [Google Scholar] [CrossRef] [PubMed]
- Barradas, P.F.; Mesquita, J.R.; Ferreira, P.; Gärtner, F.; Carvalho, M.; Inácio, E.; Chivinda, E.; Katimba, A.; Amorim, I. Molecular identification and characterization of Rickettsia spp. and other tick-borne pathogens in cattle and their ticks from Huambo, Angola. Ticks Tick Borne Dis. 2021, 12, 101583. [Google Scholar] [CrossRef] [PubMed]
- Corrigan, J.; Marion, B.; English, J.; Eneku, W.; Weng, J.L.; Rugg, M.; Dotrang, T.; Dunford, J.; Byaruhanga, A.M.; Byarugaba, D.K.; et al. Minimal Rickettsial Infection Rates and Distribution of Ticks in Uganda: An Assessment of the Seasonal Effects and Relevance to Tick-Borne Disease Risk in East Africa. J. Med. Entomol. 2023, 60, 185–192. [Google Scholar] [CrossRef] [PubMed]
- Krücken, J.; Czirják, G.; Ramünke, S.; Serocki, M.; Heinrich, S.K.; Melzheimer, J.; Costa, M.C.; Hofer, H.; Aschenborn, O.H.K.; Barker, N.A.; et al. Genetic diversity of vector-borne pathogens in spotted and brown hyenas from Namibia and Tanzania relates to ecological conditions rather than host taxonomy. Parasit. Vectors 2021, 14, 328. [Google Scholar] [CrossRef]
- Mediannikov, O.; Diatta, G.; Zolia, Y.; Balde, M.C.; Kohar, H.; Trape, J.F.; Raoult, D. Tick-borne rickettsiae in Guinea and Liberia. Ticks Tick Borne Dis. 2012, 3, 43–48. [Google Scholar] [CrossRef]
- Cordeiro, M.D.; de Azevedo Baêta, B.; Cepeda, P.B.; Teixeira, R.C.; Ribeiro, C.; de Almeida Valim, J.R.; Pinter, A.; da Fonseca, A.H. Experimental infection of Rickettsia parkeri in the Rhipicephalus microplus tick. Ticks Tick Borne Dis. 2018, 9, 93–96. [Google Scholar] [CrossRef] [PubMed]
- Olivieri, E.; Wijnveld, M.; Bonga, M.; Berger, L.; Manfredi, M.T.; Veronesi, F.; Jongejan, F. Transmission of Rickettsia raoultii and Rickettsia massiliae DNA by Dermacentor reticulatus and Rhipicephalus sanguineus (s.l.) ticks during artificial feeding. Parasit. Vectors 2018, 11, 494. [Google Scholar] [CrossRef] [PubMed]
- Palomar, A.M.; Molina, I.; Bocanegra, C.; Portillo, A.; Salvador, F.; Moreno, M.; Oteo, J.A. Old zoonotic agents and novel variants of tick-borne microorganisms from Benguela (Angola), July 2017. Parasit. Vectors 2022, 15, 140. [Google Scholar] [CrossRef] [PubMed]
- Mahlobo-Shwabede, S.I.C.; Zishiri, O.T.; Thekisoe, O.M.M.; Makalo, M.J.R. Molecular Detection of Coxiella burnetii, Rickettsia africae and Anaplasma Species in Ticks from Domestic Animals in Lesotho. Pathogens 2021, 10, 1186. [Google Scholar] [CrossRef] [PubMed]
- Beerntsen, B.T.; James, A.A.; Christensen, B.M. Genetics of mosquito vector competence. Microbiol. Mol. Biol. Rev. 2000, 64, 115–137. [Google Scholar] [CrossRef] [PubMed]
- Medlock, J.M.; Hansford, K.M.; Bormane, A.; Derdakova, M.; Estrada-Peña, A.; George, J.C.; Golovljova, I.; Jaenson, T.G.; Jensen, J.K.; Jensen, P.M.; et al. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. Parasit. Vectors 2013, 6, 1. [Google Scholar] [CrossRef] [PubMed]
- Clay, K.; Fuqua, C. The Tick Microbiome: Diversity, Distribution and Influence of the Internal Microbial Community for a Blood-Feeding Disease Vector. Critical Needs and Gaps in Understanding Prevention, Amelioration and Resolution of Lyme and Other Tick-Borne Diseases: The Short-Term and Long-Term Outcomes; Institute of Medicine Committee on Lyme Disease and Other Tick-Borne Diseases: The State of the Science: Washington DC, USA, 2010; pp. 1–22. [Google Scholar]
- Moron, C.G.; Bouyer, D.H.; Yu, X.J.; Foil, L.D.; Crocquet-Valdes, P.; Walker, D.H. Phylogenetic analysis of the rompB genes of Rickettsia felis and Rickettsia prowazekii European-human and North American flying-squirrel strains. Am. J. Trop. Med. Hyg. 2000, 62, 598–603. [Google Scholar] [CrossRef]
- Ishikura, M.; Ando, S.; Shinagawa, Y.; Matsuura, K.; Hasegawa, S.; Nakayama, T.; Fujita, H.; Watanabe, M. Phylogenetic analysis of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA genes amplified by nested PCR from ticks in Japan. Microbiol. Immunol. 2003, 47, 823–832. [Google Scholar] [CrossRef]
- Freedman, D.O.; Weld, L.H.; Kozarsky, P.E.; Fisk, T.; Robins, R.; von Sonnenburg, F.; Keystone, J.S.; Pandey, P.; Cetron, M.S. Spectrum of disease and relation to place of exposure among ill returned travelers. N. Engl. J. Med. 2006, 354, 119–130. [Google Scholar] [CrossRef]
- Wessels, G.; Hesseling, P.B.; Cooper, R.C. Q-fever, OX19, OX2 and leptospirosis antibodies in patients with onyalai and in negroid, bushman and white inhabitants of Kavango, Namibia. Trans. R. Soc. Trop. Med. Hyg. 1986, 80, 847–848. [Google Scholar] [CrossRef]
- Méchaï, F.; Han, Y.; Gachot, B.; Consigny, P.H.; Viard, J.P.; Lecuit, M.; Lortholary, O. Pristinamycin for Rickettsia africae infection. J. Travel. Med. 2009, 16, 136–137. [Google Scholar] [CrossRef]
- Pijper, A. Tick-bite fever: A clinical lecture. S. Afr. Med. J. 1934, 8, 551–556. [Google Scholar]
- Kelly, P.J.; Beati, L.; Mason, P.R.; Matthewman, L.A.; Roux, V.; Raoult, D. Rickettsia africae sp. nov., the etiological agent of African tick bite fever. Int. J. Syst. Bacteriol. 1996, 46, 611–614. [Google Scholar] [CrossRef]
- Raoult, D.; Fournier, P.E.; Abboud, P.; Caron, F. First documented human Rickettsia aeschlimannii infection. Emerg. Infect. Dis. 2002, 8, 748–749. [Google Scholar] [CrossRef]
- Mokrani, N.; Parola, P.; Tebbal, S.; Dalichaouche, M.; Aouati, A.; Raoult, D. Rickettsia aeschlimannii infection, Algeria. Emerg. Infect. Dis. 2008, 14, 1814–1815. [Google Scholar] [CrossRef]
- Germanakis, A.; Chochlakis, D.; Angelakis, E.; Tselentis, Y.; Psaroulaki, A. Rickettsia aeschlimannii Infection in a Man, Greece. Emerg. Infect. Dis. 2013, 19, 1176–1177. [Google Scholar] [CrossRef]
- Igolkina, Y.; Rar, V.; Krasnova, E.; Filimonova, E.; Tikunov, A.; Epikhina, T.; Tikunova, N. Occurrence and clinical manifestations of tick-borne rickettsioses in Western Siberia: First Russian cases of Rickettsia aeschlimannii and Rickettsia slovaca infections. Ticks Tick Borne Dis. 2022, 13, 101927. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence | Target Gene |
---|---|---|
Rick_ompB_2 | GGTGTAGGAACAATAGACTT | ompB 1 |
Rick_ompB_R2 | ATCTACGCTAACAACAAAT | |
Rick_gltA_F1 | TGCGGAAGCCGATTGCTTTA | gltA 2 |
Rick_gltA_R3 | ATCCAGCCTACGGTTCTTGC | |
Rick_ompA_F1 | ACGGACCTCTTGATGGTGGT | ompA 3 |
Rick_ompA_R6 | CCATTGCGTAAAGCTCAGGTG |
Sample ID | Outer Membrane Protein A (ompA) Gene | Citrate Synthase (gltA) Gene | ||||||
---|---|---|---|---|---|---|---|---|
BLAST Result | Accession Number | % Identity | Fragment Length (bp) | BLAST Result | Accession Number | % Identity | Fragment Length (bp) | |
T176 | R. aeschlimannii | OR687032 | 99.9 | 2896 | R. aeschlimannii | OR687023 | 99.91 | 1064 |
T177 | R. africae | CP001612 | 98.92 | 2871 | R. africae | HQ335126 | 99.91 | 1056 |
T189 | R. aeschlimannii | OR687032 | 99.9 | 2900 | R. aeschlimannii | OR687023 | 99.91 | 1054 |
T198 | R. aeschlimannii | OR687032 | 99.55 | 2889 | R. aeschlimannii | HQ335153 | 100 | 1057 |
T200 | R. aeschlimannii | OR687032 | 99.72 | 2890 | R. aeschlimannii | OR687023 | 99.9 | 1048 |
T201 | R. aeschlimannii | OR687032 | 99.55 | 2891 | R. aeschlimannii | HQ335153 | 100 | 1058 |
T281 | R. aeschlimannii | OR687023 | 99.9 | 1277 | ||||
T282 | R. aeschlimannii | OR687032 | 99.93 | 2966 | R. aeschlimannii | OR687023 | 99.91 | 1185 |
T285 | R. aeschlimannii | OR687023 | 99.91 | 1245 | ||||
T286 | R. aeschlimannii | OR687023 | 99.91 | 1465 | ||||
T287 | R. africae | CP001612 | 99.24 | 2968 | ||||
T294 | R. aeschlimannii | OR687032 | 99.62 | 3065 | R. aeschlimannii | HQ335153 | 100 | 1647 |
T296 | R. aeschlimannii | HQ335153 | 99.91 | 1073 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mbiri, P.; Matomola, O.C.; Muleya, W.; Mhuulu, L.; Diegaardt, A.; Noden, B.H.; Changula, K.; Chimwamurombe, P.; Matos, C.; Weiss, S.; et al. Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks from Selected Regions of Namibia. Microorganisms 2024, 12, 912. https://doi.org/10.3390/microorganisms12050912
Mbiri P, Matomola OC, Muleya W, Mhuulu L, Diegaardt A, Noden BH, Changula K, Chimwamurombe P, Matos C, Weiss S, et al. Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks from Selected Regions of Namibia. Microorganisms. 2024; 12(5):912. https://doi.org/10.3390/microorganisms12050912
Chicago/Turabian StyleMbiri, Pricilla, Ophelia Chuma Matomola, Walter Muleya, Lusia Mhuulu, Azaria Diegaardt, Bruce Howard Noden, Katendi Changula, Percy Chimwamurombe, Carolina Matos, Sabrina Weiss, and et al. 2024. "Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks from Selected Regions of Namibia" Microorganisms 12, no. 5: 912. https://doi.org/10.3390/microorganisms12050912
APA StyleMbiri, P., Matomola, O. C., Muleya, W., Mhuulu, L., Diegaardt, A., Noden, B. H., Changula, K., Chimwamurombe, P., Matos, C., Weiss, S., Nepolo, E., & Chitanga, S. (2024). Molecular Detection and Characterization of Rickettsia Species in Ixodid Ticks from Selected Regions of Namibia. Microorganisms, 12(5), 912. https://doi.org/10.3390/microorganisms12050912