Lactobacillus salivarius WZ1 Inhibits the Inflammatory Injury of Mouse Jejunum Caused by Enterotoxigenic Escherichia coli K88 by Regulating the TLR4/NF-κB/MyD88 Inflammatory Pathway and Gut Microbiota
Abstract
1. Introduction
2. Materials and Methods
2.1. Strains and Culture Growth Conditions
2.2. Test Grouping
2.3. Histological Evaluation (HE) of Jejunum
2.4. Detection of Inflammatory Factors by RT-qPCR
2.5. Western Blot
2.6. Analysis of Gut Microbiota
2.7. Data Statistics and Analysis
3. Results
3.1. Pathological Changes in Jejunum
3.2. The mRNA Expression of Inflammatory Factors
3.3. Inflammatory Pathway Protein Expression
3.4. Tight Junction Protein Expression
3.5. Gut Microbiota Analysis
3.5.1. OTU Analysis
3.5.2. Species Distribution Histogram
3.5.3. Alpha Diversity Analysis
3.5.4. Beta Diversity Analysis
3.5.5. LEfSe Analysis
3.5.6. ANOVA Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Viidu, D.A.; Motus, K. Implementation of a pre-calving vaccination programme against rotavirus, coronavirus and enterotoxigenic Escherichia coli (F5) and association with dairy calf survival. BMC Vet. Res. 2022, 18, 59. [Google Scholar] [CrossRef] [Scilit]
- Foster, D.M.; Smith, G.W. Pathophysiology of diarrhea in calves. Vet. Clin. N. Am. Food Anim. Pract. 2009, 25, 13–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fesseha, H.; Mathewos, M.; Aliye, S.; Mekonnen, E. Isolation and antibiogram of Escherichia coli O157: H7 from diarrhoeic calves in urban and peri-urban dairy farms of Hawassa town. Vet. Med. Sci. 2022, 8, 864–876. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cho, Y.I.; Yoon, K.J. An overview of calf diarrhea—Infectious etiology, diagnosis, and intervention. J. Vet. Sci. 2014, 15, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Prieto, A.; Lopez-Novo, C.; Diaz, P.; Diaz-Cao, J.M.; Lopez-Lorenzo, G.; Anton, C.; Remesar, S.; Garcia-Dios, D.; Lopez, C.; Panadero, R.; et al. Antimicrobial Susceptibility of Enterotoxigenic Escherichia coli from Diarrhoeic Neonatal Calves in Spain. Animals 2022, 12, 264. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Orden, J.A.; Ruiz-Santa-Quiteria, J.A.; García, S.; Cid, D.; De La Fuente, R. In vitro susceptibility of Escherichia coli strains isolated from diarrhoeic dairy calves to 15 antimicrobial agents. J. Vet. Med. 2000, 47, 329–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, D.; Ba, Y.; Li, Y.; Huang, Y.; Li, L.; Wang, G.; Qu, Y.; Wang, J.; Yu, L.Y.; Hou, X. Changes in Gut Microbiota by the Lactobacillus casei Anchoring the K88 Fimbrial Protein Prevented Newborn Piglets from Clinical Diarrhea. Front. Cell. Infect. Microbiol. 2022, 12, 842007. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Tan, P.; Zhao, Y.; Ma, X. Enterotoxigenic Escherichia coli: Intestinal pathogenesis mechanisms and colonization resistance by gut microbiota. Gut Microbes 2022, 14, 2055943. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; He, Y.; Liu, K.; Deng, S.; Fan, Y.; Liu, Y. Sodium Humate Alleviates Enterotoxigenic Escherichia coli-Induced Intestinal Dysfunction via Alteration of Intestinal Microbiota and Metabolites in Mice. Front. Microbiol. 2022, 13, 809086. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Nie, C.; Luo, R.; Qi, F.; Bai, X.; Chen, H.; Niu, J.; Chen, C.; Zhang, W. Effects of Multispecies Probiotic on Intestinal Microbiota and Mucosal Barrier Function of Neonatal Calves Infected with E. coli K99. Front. Microbiol. 2021, 12, 813245. [Google Scholar] [CrossRef] [Scilit]
- Neveling, D.P.; Dicks, L.M.T. Probiotics: An Antibiotic Replacement Strategy for Healthy Broilers and Productive Rearing. Probiotics Antimicrob. Proteins 2021, 13, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lukic, J.; Jancic, I.; Mirkovic, N.; Bufan, B.; Djokic, J.; Milenkovic, M.; Begovic, J.; Strahinic, I.; Lozo, J. Lactococcus lactis and Lactobacillus salivarius differently modulate early immunological response of Wistar rats co-administered with Listeria monocytogenes. Benef. Microbes 2017, 8, 809–822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fuochi, V.; Petronio, G.P.; Lissandrello, E.; Furneri, P.M. Evaluation of resistance to low pH and bile salts of human Lactobacillus spp. isolates. Int. J. Immunopathol. Pharmacol. 2015, 28, 426–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruszczynski, M.; Radzikowski, A.; Szajewska, H. Clinical trial: Effectiveness of Lactobacillus rhamnosus (strains E/N, Oxy and Pen) in the prevention of antibiotic-associated diarrhoea in children. Aliment. Pharmacol. Ther. 2008, 28, 154–161. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.Y.; Han, G.G.; Kim, E.B.; Choi, Y.J. Comparative genomics of Lactobacillus salivarius strains focusing on their host adaptation. Microbiol. Res. 2017, 205, 48–58. [Google Scholar] [CrossRef] [Scilit]
- Messaoudi, S.; Manai, M.; Kergourlay, G.; Prevost, H.; Connil, N.; Chobert, J.M.; Dousset, X. Lactobacillus salivarius: Bacteriocin and probiotic activity. Food Microbiol. 2013, 36, 296–304. [Google Scholar] [CrossRef] [Scilit]
- Corr, S.; Li, Y.; Riedel, C.; O’Toole, P.; Hill, C.; Gahan, C. Bacteriocin production as a mechanism for the antiinfective activity of Lactobacillus salivarius UCC118. Proc. Natl. Acad. Sci. USA 2007, 104, 7617–7621. [Google Scholar] [CrossRef] [Scilit]
- Sanudo, A.I.; Luque, R.; Diaz-Ropero, M.P.; Fonolla, J.; Banuelos, O. In vitro and in vivo anti-microbial activity evaluation of inactivated cells of Lactobacillus salivarius CECT 5713 against Streptococcus mutans. Arch. Oral Biol. 2017, 84, 58–63. [Google Scholar] [CrossRef] [Scilit]
- Drago, L.; De Vecchi, E.; Gabrieli, A.; De Grandi, R.; Toscano, M. Immunomodulatory Effects of Lactobacillus salivarius LS01 and Bifidobacterium breve BR03, Alone and in Combination, on Peripheral Blood Mononuclear Cells of Allergic Asthmatics. Allergy Asthma Immunol. Res. 2015, 7, 409–413. [Google Scholar] [CrossRef] [Scilit]
- Zhai, Q.; Shen, X.; Cen, S.; Zhang, C.; Tian, F.; Zhao, J.; Zhang, H.; Xue, Y.; Chen, W. Screening of Lactobacillus salivarius strains from the feces of Chinese populations and the evaluation of their effects against intestinal inflammation in mice. Food Funct. 2020, 11, 221–235. [Google Scholar] [CrossRef] [Scilit]
- Neville, B.A.; O’Toole, P.W. Probiotic properties of Lactobacillus salivarius and closely related Lactobacillus species. Future Microbiol. 2010, 5, 759–774. [Google Scholar]
- Lee, M.C.; Hsu, Y.J.; Ho, H.H.; Hsieh, S.H.; Kuo, Y.W.; Sung, H.C.; Huang, C.C. Lactobacillus salivarius Subspecies salicinius SA-03 is a New Probiotic Capable of Enhancing Exercise Performance and Decreasing Fatigue. Microorganisms 2020, 8, 545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsieh, P.S.; Ho, H.H.; Hsieh, S.H.; Kuo, Y.W.; Tseng, H.Y.; Kao, H.F.; Wang, J.Y. Lactobacillus salivarius AP-32 and Lactobacillus reuteri GL-104 decrease glycemic levels and attenuate diabetes-mediated liver and kidney injury in db/db mice. BMJ Open Diabetes Res. Care 2020, 8, e001028. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Ishfaq, M.; Guo, Y.; Chen, C.; Li, J. Assessment of Probiotic Properties of Lactobacillus salivarius Isolated From Chickens as Feed Additives. Front. Vet. Sci. 2020, 7, 415. [Google Scholar] [CrossRef] [Scilit]
- Dong, H.; Liu, B.; Li, A.; Iqbal, M.; Mehmood, K.; Jamil, T.; Chang, Y.F.; Zhang, H.; Wu, Q. Microbiome Analysis Reveals the Attenuation Effect of Lactobacillus from Yaks on Diarrhea via Modulation of Gut Microbiota. Front. Cell. Infect. Microbiol. 2020, 10, 610781. [Google Scholar] [CrossRef] [Scilit]
- Liu, Q.; Ni, X.; Wang, Q.; Peng, Z.; Niu, L.; Wang, H.; Zhou, Y.; Sun, H.; Pan, K.; Jing, B.; et al. Lactobacillus plantarum BSGP201683 Isolated from Giant Panda Feces Attenuated Inflammation and Improved Gut Microflora in Mice Challenged with Enterotoxigenic Escherichia coli. Front. Microbiol. 2017, 8, 1885. [Google Scholar] [CrossRef] [Scilit]
- Caspary, W.F. Physiology and pathophysiology of intestinal absorption. Am. J. Clin. Nutr. 1992, 55 (Suppl. S1), 299S–308S. [Google Scholar] [CrossRef] [Scilit]
- Yun, S.; Guo, Y.; Yang, L.; Zhang, X.; Shen, W.; Wang, Z.; Wen, S.; Zhao, D.; Wu, H.; Chen, J.; et al. Effects of oral florfenicol on intestinal structure, function and microbiota in mice. Arch. Microbiol 2020, 202, 161–169. [Google Scholar] [CrossRef] [Scilit]
- Qin, S.M.; Zhang, K.Y.; Ding, X.M.; Bai, S.P.; Wang, J.P.; Zeng, Q.F. Effect of dietary graded resistant potato starch levels on growth performance, plasma cytokines concentration, and intestinal health in meat ducks. Poult. Sci. 2019, 98, 3523–3532. [Google Scholar] [CrossRef] [Scilit]
- Turner, J.R. Intestinal mucosal barrier function in health and disease. Nat. Rev. Immunol. 2009, 9, 799–809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liao, L.; Li, J.; Li, J.; Huang, Y.; Wu, Y. Effects of Astragalus polysaccharides on intestinal morphology and intestinal immune cells of Muscovy ducklings infected with Muscovy duck reovirus. Poult. Sci. 2021, 100, 64–72. [Google Scholar] [CrossRef] [Scilit]
- Song, G.; Huang, J.; Deng, Y.; Liang, Z.; Lin, Y. The Expression of Calprotectin and Factors in TLR4/NF-kappaB/MyD88 Pathway in Patients with Idiopathic Acute Anterior Uveitis. Ocul. Immunol. Inflamm. 2019, 27, 1144–1148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Y.Z.; Li, C.; Gu, J.; Lv, S.C.; Song, J.Y.; Tang, Z.B.; Duan, G.X.; Qin, L.Q.; Zhao, L.; Xu, J.Y. Anti-Oxidative and Immuno-Protective Effect of Camel Milk on Radiation-Induced Intestinal Injury in C57BL/6 J Mice. Dose-Response 2021, 19, 15593258211003798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J.; Lu, C.; Liu, Z.; Zhang, P.; Guo, H.; Wang, T. Schizandrin B protects LPS-induced sepsis via TLR4/NF-κB/MyD88 signaling pathway. Am. J. Transl. Res. 2018, 10, 1155–1163. [Google Scholar] [PubMed]
- Qiao, J.; Sun, Z.; Liang, D.; Li, H. Lactobacillus salivarius alleviates inflammation via NF-kappaB signaling in ETEC K88-induced IPEC-J2 cells. J. Anim. Sci. Biotechnol. 2020, 11, 76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olivier, S.; Diounou, H.; Pochard, C.; Frechin, L.; Durieu, E.; Foretz, M.; Neunlist, M.; Rolli-Derkinderen, M.; Viollet, B. Intestinal Epithelial AMPK Deficiency Causes Delayed Colonic Epithelial Repair in DSS-Induced Colitis. Cells 2022, 11, 590. [Google Scholar] [CrossRef] [Scilit]
- Li, S.; Sun, Y.; Hu, X.; Qin, W.; Li, C.; Liu, Y.; Liu, A.; Zhao, Y.; Wu, D.; Lin, D.; et al. Effect of arabinoxylan on colonic bacterial metabolites and mucosal barrier in high-fat diet-induced rats. Food Sci. Nutr. 2019, 7, 3052–3061. [Google Scholar] [CrossRef] [Scilit]
- Lin, N.; Xu, L.F.; Sun, M. The protective effect of trefoil factor 3 on the intestinal tight junction barrier is mediated by toll-like receptor 2 via a PI3K/Akt dependent mechanism. Biochem. Biophys. Res. Commun. 2013, 440, 143–149. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Rao, J.N.; Zou, T.; Liu, L.; Marasa, B.S.; Xiao, L.; Zeng, X.; Turner, D.J.; Wang, J.Y. Polyamines are required for expression of Toll-like receptor 2 modulating intestinal epithelial barrier integrity. Am. J. Physiol. Gastrointest. Liver Physiol. 2007, 293, G568–G576. [Google Scholar] [CrossRef] [Scilit]
- Al-Sadi, R.; Guo, S.; Dokladny, K.; Smith, M.A.; Ye, D.; Kaza, A.; Watterson, D.M.; Ma, T.Y. Mechanism of interleukin-1beta induced-increase in mouse intestinal permeability in vivo. J. Interferon Cytokine Res. 2012, 32, 474–484. [Google Scholar] [CrossRef] [Scilit]
- Sun, Z.; Li, H.; Li, Y.; Qiao, J. Lactobacillus salivarius, a Potential Probiotic to Improve the Health of LPS-Challenged Piglet Intestine by Alleviating Inflammation as Well as Oxidative Stress in a Dose-Dependent Manner during Weaning Transition. Front. Vet. Sci. 2020, 7, 547425. [Google Scholar] [CrossRef] [Scilit]
- Sydora, B.C.; Tavernini, M.M.; Doyle, J.S.G.; Fedorak, R.N. Association with selected bacteria does not cause enterocolitis in IL-10 gene-deficient mice despite a systemic immune response. Dig. Dis. Sci. 2005, 50, 905–913. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poritz, L.S.; Garver, K.I.; Green, C.; Fitzpatrick, L.; Ruggiero, F.; Koltun, W.A. Loss of the tight junction protein ZO-1 in dextran sulfate sodium induced colitis. J. Surg. Res. 2007, 140, 12–19. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zakostelska, Z.; Kverka, M.; Klimesova, K.; Rossmann, P.; Mrazekm, J.; Kopecny, J.; Hornova, M.; Srutkova, D.; Hudcovic, T.; Ridl, J.; et al. Lysate of probiotic Lactobacillus casei DN-114 001 ameliorates colitis by strengthening the gut barrier function and changing the gut microenvironment. PLoS ONE 2011, 6, e27961. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chichlowski, M.; Westwood, G.S.; Abraham, S.N.; Hale, L.P. Role of mast cells in inflammatory bowel disease and inflammation-associated colorectal neoplasia in IL-10-deficient mice. PLoS ONE 2010, 5, e12220. [Google Scholar] [CrossRef] [Scilit]
- Al-Sadi, R.; Ye, D.; Dokladny, K.; Ma, T.Y. Mechanism of IL-1beta-induced increase in intestinal epithelial tight junction permeability. J. Immunol. 2008, 180, 5653–5661. [Google Scholar] [CrossRef] [Scilit]
- Al-Sadi, R.; Ye, D.; Said, H.M.; Ma, T.Y. Cellular and molecular mechanism of interleukin-1beta modulation of Caco-2 intestinal epithelial tight junction barrier. J. Cell Mol. Med. 2011, 15, 970–982. [Google Scholar] [CrossRef] [Scilit]
- Al-Sadi, R.; Guo, S.; Ye, D.; Dokladny, K.; Alhmoud, T.; Ereifej, L.; Said, H.M.; Ma, T.Y. Mechanism of IL-1beta modulation of intestinal epithelial barrier involves p38 kinase and activating transcription factor-2 activation. J. Immunol. 2013, 190, 6596–6606. [Google Scholar] [CrossRef] [Scilit]
- Al-Sadi, R.M.; Ma, T.Y. IL-1beta causes an increase in intestinal epithelial tight junction permeability. J. Immunol. 2007, 178, 4641–4649. [Google Scholar] [CrossRef] [Scilit]
- Hold, G.L.; Smith, M.; Grange, C.; Watt, E.R.; El-Omar, E.M.; Mukhopadhya, I. Role of the gut microbiota in inflammatory bowel disease pathogenesis: What have we learnt in the past 10 years? World J. Gastroenterol. 2014, 20, 1192–1210. [Google Scholar] [CrossRef] [Scilit]
- Menghini, P.; Corridoni, D.; Butto, L.F.; Osme, A.; Shivaswamy, S.; Lam, M.; Bamias, G.; Pizarro, T.T.; Rodriguez-Palacios, A.; Dinarello, C.A.; et al. Neutralization of IL-1alpha ameliorates Crohn’s disease-like ileitis by functional alterations of the gut microbiome. Proc. Natl. Acad. Sci. USA 2019, 116, 26717–26726. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alard, J.; Peucelle, V.; Boutillier, D.; Breton, J.; Kuylle, S.; Pot, B.; Holowacz, S.; Grangette, C. New probiotic strains for inflammatory bowel disease management identified by combining in vitro and in vivo approaches. Benef. Microbes 2018, 9, 317–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zeineldin, M.; Aldridge, B.; Lowe, J. Dysbiosis of the fecal microbiota in feedlot cattle with hemorrhagic diarrhea. Microb. Pathog. 2018, 115, 123–130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Ishfaq, M.; Li, J. Lactobacillus salivarius ameliorated Mycoplasma gallisepticum-induced inflammatory injury and secondary Escherichia coli infection in chickens: Involvement of intestinal microbiota. Vet. Immunol. Immunopathol. 2021, 233, 110192. [Google Scholar] [CrossRef] [Scilit]
- Bian, X.; Wang, T.T.; Xu, M.; Evivie, S.E.; Luo, G.W.; Liang, H.Z.; Yu, S.F.; Huo, G.C. Effect of Lactobacillus Strains on Intestinal Microflora and Mucosa Immunity in Escherichia coli O157:H7-Induced Diarrhea in Mice. Curr. Microbiol. 2016, 73, 65–70. [Google Scholar] [CrossRef] [Scilit]
- Sayan, H.; Assavacheep, P.; Angkanaporn, K.; Assavacheep, A. Effect of Lactobacillus salivarius on growth performance, diarrhea incidence, fecal bacterial population and intestinal morphology of suckling pigs challenged with F4+ enterotoxigenic Escherichia coli. Asian-Australas J. Anim. Sci. 2018, 31, 1308–1314. [Google Scholar] [CrossRef] [Scilit]













| Primer | Primer Sequences |
|---|---|
| IL-1β F | 5′–TTCAGGCAGGCAGTATCACTC–3′ |
| IL-1β R | 5′–GAAGGTCCACGGGAAAGACAC–3′ |
| IL-4 F | 5′–GGTCTCAACCCCCAGCTAGT–3′ |
| IL-4 R | 5′–GCCGATGATCTCTCTCAAGTGAT–3′ |
| IL-6 F | 5′–CTGCAAGAGACTTCCATCCAG–3′ |
| IL-6 R | 5′–AGTGGTATAGACAGGTCTGTTGG–3′ |
| TNF-α F | 5′–CAGGCGGTGCCTATGTCTC–3′ |
| TNF-α R | 5′–CGATCACCCCGAAGTTCAGTAG–3′ |
| GAPDH F | 5′–GGGAAGCCCATCACCATCTT–3′ |
| GAPDH R | 5′–GCCTTCTCCATGGTGGTGAA–3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wei, Z.; He, Z.; Wang, T.; Wang, X.; Wang, T.; Long, M. Lactobacillus salivarius WZ1 Inhibits the Inflammatory Injury of Mouse Jejunum Caused by Enterotoxigenic Escherichia coli K88 by Regulating the TLR4/NF-κB/MyD88 Inflammatory Pathway and Gut Microbiota. Microorganisms 2023, 11, 657. https://doi.org/10.3390/microorganisms11030657
Wei Z, He Z, Wang T, Wang X, Wang T, Long M. Lactobacillus salivarius WZ1 Inhibits the Inflammatory Injury of Mouse Jejunum Caused by Enterotoxigenic Escherichia coli K88 by Regulating the TLR4/NF-κB/MyD88 Inflammatory Pathway and Gut Microbiota. Microorganisms. 2023; 11(3):657. https://doi.org/10.3390/microorganisms11030657
Chicago/Turabian StyleWei, Zhen, Ziqi He, Tongyao Wang, Xiaoxuan Wang, Tiancheng Wang, and Miao Long. 2023. "Lactobacillus salivarius WZ1 Inhibits the Inflammatory Injury of Mouse Jejunum Caused by Enterotoxigenic Escherichia coli K88 by Regulating the TLR4/NF-κB/MyD88 Inflammatory Pathway and Gut Microbiota" Microorganisms 11, no. 3: 657. https://doi.org/10.3390/microorganisms11030657
APA StyleWei, Z., He, Z., Wang, T., Wang, X., Wang, T., & Long, M. (2023). Lactobacillus salivarius WZ1 Inhibits the Inflammatory Injury of Mouse Jejunum Caused by Enterotoxigenic Escherichia coli K88 by Regulating the TLR4/NF-κB/MyD88 Inflammatory Pathway and Gut Microbiota. Microorganisms, 11(3), 657. https://doi.org/10.3390/microorganisms11030657

