Bovine Piroplasma Populations in the Philippines Characterized Using Targeted Amplicon Deep Sequencing
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Statements
2.2. Blood Sample Collection and DNA Extraction
2.3. PCR Assays for Screening and Amplicon Tagging and Multiplexing
2.4. Library Preparation and Amplicon Sequencing
2.5. Bioinformatics and Phylogenetic Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Eybpoosh, S.; Haghdoost, A.A.; Mostafavi, E.; Bahrampour, A.; Azadmanesh, K.; Zolala, F. Molecular epidemiology of infectious diseases. Electron. Physician 2017, 9, 5149–5158. [Google Scholar] [CrossRef] [PubMed]
- De León, G.P.-P.; Nadler, S.A. What we don’t recognize can hurt us: A plea for awareness about cryptic species. J. Parasitol. 2010, 96, 453–464. [Google Scholar] [CrossRef] [PubMed]
- Mans, B.J. The basis of molecular diagnostics for piroplasmids: Do the sequences lie? Ticks Tick-Borne Dis. 2022, 13, 101907. [Google Scholar] [CrossRef] [PubMed]
- Mans, B.J.; Pienaar, R.; Latif, A.A. A review of Theileria diagnostics and epidemiology. Int. J. Parasitol. Parasites Wildl. 2015, 4, 104–118. [Google Scholar] [CrossRef] [PubMed]
- Mosqueda, J.; Olvera-Ramirez, A.; Aguilar-Tipacamu, G.; Canto, G.J. Current advances in detection and treatment of babesiosis. Curr. Med. Chem. 2012, 19, 1504–1518. [Google Scholar] [CrossRef] [PubMed]
- Criado-Fornelio, A. A review of nucleic-acid-based diagnostic tests for Babesia and Theileria, with emphasis on bovine piroplasms. Parassitologia 2007, 49, 39–44. [Google Scholar]
- Alvarez, J.A.; Rojas, C.; Figueroa, J.V. Diagnostic tools for the identification of Babesia sp. in persistently infected cattle. Pathogens 2019, 8, E143. [Google Scholar] [CrossRef]
- Schmitz, J.E.; Stratton, C.W.; Persing, D.H.; Tang, Y.-W. Forty years of molecular diagnostics for infectious diseases. J. Clin. Microbiol. 2022, 60, e02446-21. [Google Scholar] [CrossRef]
- Valentini, A.; Pompanon, F.; Taberlet, P. DNA barcoding for ecologists. Trends Ecol. Evol. 2009, 24, 110–117. [Google Scholar] [CrossRef]
- Wooley, J.C.; Godzik, A.; Friedberg, I. A primer on metagenomics. PLoS Comput. Biol. 2010, 6, e1000667. [Google Scholar] [CrossRef]
- Pérez-Cobas, A.E.; Gomez-Valero, L.; Buchrieser, C. Metagenomic approaches in microbial ecology: An update on whole-genome and marker gene sequencing analyses. Microb. Genom. 2020, 6, e000409. [Google Scholar] [CrossRef] [PubMed]
- Knight, R.; Vrbanac, A.; Taylor, B.C.; Aksenov, A.; Callewaert, C.; Debelius, J.; Gonzalez, A.; Kosciolek, T.; McCall, L.-I.; McDonald, D.; et al. Best practices for analysing microbiomes. Nat. Rev. Microbiol. 2018, 16, 410–422. [Google Scholar] [CrossRef] [PubMed]
- Huggins, L.G.; Colella, V.; Koehler, A.V.; Schunack, B.; Traub, R.J. A multipronged next-generation sequencing metabarcoding approach unearths hyperdiverse and abundant dog pathogen communities in Cambodia. Transbound. Emerg. Dis. 2022, 69, 1933–1950. [Google Scholar] [CrossRef] [PubMed]
- Chaudhry, U.; Ali, Q.; Rashid, I.; Shabbir, M.Z.; Ijaz, M.; Abbas, M.; Evans, M.; Ashraf, K.; Morrison, I.; Morrison, L.; et al. Development of a deep amplicon sequencing method to determine the species composition of piroplasm haemoprotozoa. Ticks Tick-Borne Dis. 2019, 10, 101276. [Google Scholar] [CrossRef]
- Ghafar, A.; Koehler, A.V.; Hall, R.S.; Gauci, C.G.; Gasser, R.B.; Jabbar, A. Targeted next-generation sequencing and informatics as an effective tool to establish the composition of bovine piroplasm populations in endemic regions. Microorganisms 2020, 9, 21. [Google Scholar] [CrossRef]
- Huggins, L.G.; Koehler, A.V.; Ng-Nguyen, D.; Wilcox, S.; Schunack, B.; Inpankaew, T.; Traub, R.J. A novel metabarcoding diagnostic tool to explore protozoan haemoparasite diversity in mammals: A proof-of-concept study using canines from the tropics. Sci. Rep. 2019, 9, 12644. [Google Scholar] [CrossRef]
- Squarre, D.; Nakamura, Y.; Hayashida, K.; Kawai, N.; Chambaro, H.; Namangala, B.; Sugimoto, C.; Yamagishi, J. Investigation of the piroplasm diversity circulating in wildlife and cattle of the Greater Kafue Ecosystem, Zambia. Parasites Vectors 2020, 13, 599. [Google Scholar] [CrossRef]
- Ybañez, A.P.; Sivakumar, T.; Ybañez, R.H.D.; Vincoy, M.R.B.; Tingson, J.A.; Perez, Z.O.; Gabotero, S.R.; Buchorno, L.P.; Inoue, N.; Matsumoto, K.; et al. Molecular survey of bovine vector-borne pathogens in Cebu, Philippines. Vet. Parasitol. 2013, 196, 13–20. [Google Scholar] [CrossRef]
- Yu, L.; Terkawi, M.A.; Cruz-Flores, M.J.; Claveria, F.G.; Aboge, G.O.; Yamagishi, J.; Goo, Y.-K.; Cao, S.; Masatani, T.; Nishikawa, Y.; et al. Epidemiological survey of Babesia bovis and Babesia bigemina infections of cattle in Philippines. J. Vet. Med. Sci. 2013, 75, 995–998. [Google Scholar] [CrossRef]
- Belotindos, L.; Lazaro, J.; Villanueva, M.; Mingala, C. Molecular detection and characterization of Theileria species in the Philippines. Acta Parasitol. 2014, 59, 448–453. [Google Scholar] [CrossRef]
- Ochirkhuu, N.; Konnai, S.; Mingala, C.N.; Okagawa, T.; Villanueva, M.; Pilapil, F.M.I.R.; Murata, S.; Ohashi, K. Molecular epidemiological survey and genetic analysis of vector-borne infections of cattle in Luzon Island, the Philippines. Vet. Parasitol. 2015, 212, 161–167. [Google Scholar] [CrossRef] [PubMed]
- Herrera, P.C.; Viloria, V.; Balbin, M.; Mingala, C. Prevalence of babesiosis (Babesia bovis and Babesia bigemina) in cattle and water buffalo in Nueva Ecija, Philippines using nested polymerase chain reaction. Ann. Parasitol. 2017, 63, 309–316. [Google Scholar]
- Sivakumar, T.; Tuvshintulga, B.; Kothalawala, H.; Silva, S.S.P.; Lan, D.T.B.; Long, P.T.; Ybañez, A.P.; Ybañez, R.H.D.; Francisco Benitez, D.; Tayebwa, D.S.; et al. Host range and geographical distribution of Babesia sp. Mymensingh. Transbound. Emerg. Dis. 2020, 67, 2233–2239. [Google Scholar] [CrossRef] [PubMed]
- Prado, I.C.B.; Capuno, L.X.B.; Collera, P.D.; Cabralda, A.P.D.; De Ramos, K.A.S.; Bernardo, J.M.G.; Divina, B.P.; Masatani, T.; Tanaka, T.; Galay, R.L. Molecular detection and characterization of Babesia and Theileria in cattle and water buffaloes from Southern Luzon, Philippines. Microorganisms 2022, 10, 678. [Google Scholar] [CrossRef] [PubMed]
- Gubbels, J.M.; de Vos, A.P.; van der Weide, M.; Viseras, J.; Schouls, L.M.; de Vries, E.; Jongejan, F. Simultaneous detection of bovine Theileria and Babesia species by reverse line blot hybridization. J. Clin. Microbiol. 1999, 37, 1782–1789. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef]
- Palmer, J.M.; Jusino, M.A.; Banik, M.T.; Lindner, D.L. Non-biological synthetic spike-in controls and the AMPtk software pipeline improve mycobiome data. PeerJ 2018, 6, e4925. [Google Scholar] [CrossRef]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef]
- Frøslev, T.G.; Kjøller, R.; Bruun, H.H.; Ejrnæs, R.; Brunbjerg, A.K.; Pietroni, C.; Hansen, A.J. Algorithm for post-clustering curation of DNA amplicon data yields reliable biodiversity estimates. Nat. Commun. 2017, 8, 1188. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Rognes, T.; Flouri, T.; Nichols, B.; Quince, C.; Mahé, F. VSEARCH: A versatile open source tool for metagenomics. PeerJ 2016, 4, e2584. [Google Scholar] [CrossRef] [PubMed]
- Gaithuma, A.K.; Yamagishi, J.; Martinelli, A.; Hayashida, K.; Kawai, N.; Marsela, M.; Sugimoto, C. A single test approach for accurate and sensitive detection and taxonomic characterization of trypanosomes by comprehensive analysis of internal transcribed spacer 1 amplicons. PLoS Negl. Trop. Dis. 2019, 13, e0006842. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Galon, E.M.; Zafar, I.; Ji, S.; Li, H.; Ma, Z.; Xuan, X. Molecular reports of ruminant Babesia in Southeast Asia. Pathogens 2022, 11, 915. [Google Scholar] [CrossRef]
- Foronda, J.; Baticados, W.; Baticados, A. Molecular evidence of Babesia spp. in cattle in the Philippines. Online J. Vet. Res. 2010, 14, 188–193. [Google Scholar]
- Gebrekidan, H.; Perera, P.K.; Ghafar, A.; Abbas, T.; Gasser, R.B.; Jabbar, A. An appraisal of oriental theileriosis and the Theileria orientalis complex, with an emphasis on diagnosis and genetic characterisation. Parasitol. Res. 2020, 119, 11–22. [Google Scholar] [CrossRef]
- Watts, J.; Playford, M.; Hickey, K. Theileria orientalis: A review. N. Z. Vet. J. 2016, 64, 3–9. [Google Scholar] [CrossRef]
- Bishop, R.; Musoke, A.; Morzaria, S.; Gardner, M.; Nene, V. Theileria: Intracellular protozoan parasites of wild and domestic ruminants transmitted by ixodid ticks. Parasitology 2004, 129, S271–S283. [Google Scholar] [CrossRef]
- Galon, E.M.; Ybañez, R.H.; Macalanda, A.M.; Estabillo, G.R.; Montano, M.T.R.; Veedor, M.D.; Garvida, A.; Fabon, R.J.; Callanta, M.R.; Labutong, K.J.; et al. First molecular identification of Babesia, Theileria, and Anaplasma in goats from the Philippines. Pathogens 2022, 11, 1109. [Google Scholar] [CrossRef]
- Chansiri, K.; Kawazu, S.; Kamio, T.; Terada, Y.; Fujisaki, K.; Philippe, H.; Sarataphan, N. Molecular phylogenetic studies on Theileria parasites based on small subunit ribosomal RNA gene sequences. Vet. Parasitol. 1999, 83, 99–105. [Google Scholar] [CrossRef]
- Ramakrishnan, P.; Abas Mazni, O. Prevalence of Theileria mutans in swamp buffalo. J. Trop. Agric. Food Sci. 1993, 21, 85–88. [Google Scholar]
- Galon, E.M.; Macalanda, A.M.; Garcia, M.M.; Ibasco, C.J.; Garvida, A.; Ji, S.; Zafar, I.; Hasegawa, Y.; Liu, M.; Ybañez, R.H.; et al. Molecular identification of selected tick-borne protozoan and bacterial pathogens in thoroughbred racehorses in Cavite, Philippines. Pathogens 2021, 10, 1318. [Google Scholar] [CrossRef] [PubMed]
- Criado-Fornelio, A. The “expanding universe” of piroplasms. Vet. Parasitol. 2004, 119, 337–345. [Google Scholar] [CrossRef] [PubMed]
- Beck, R.; Vojta, L.; Mrljak, V.; Marinculić, A.; Beck, A.; Živičnjak, T.; Cacciò, S.M. Diversity of Babesia and Theileria species in symptomatic and asymptomatic dogs in Croatia. Int. J. Parasitol. 2009, 39, 843–848. [Google Scholar] [CrossRef] [PubMed]
- Fritz, D. A PCR study of piroplasms in 166 dogs and 111 horses in France (March 2006 to March 2008). Parasitol. Res. 2010, 106, 1339–1342. [Google Scholar] [CrossRef]
- Qablan, M.A.; Kubelová, M.; Široký, P.; Modrý, D.; Amr, Z.S. Stray dogs of Northern Jordan as reservoirs of ticks and tick-borne hemopathogens. Parasitol. Res. 2012, 111, 301–307. [Google Scholar] [CrossRef]
- Inácio, E.L.; Pérez-Macchi, S.; Alabi, A.; Bittencourt, P.; Müller, A. Prevalence and molecular characterization of piroplasmids in domestic dogs from Paraguay. Ticks Tick-Borne Dis. 2019, 10, 321–327. [Google Scholar] [CrossRef]
- Salim, B.; Alanazi, A.D.; Omori, R.; Alyousif, M.S.; Alanazi, I.O.; Katakura, K.; Nakao, R. Potential role of dogs as sentinels and reservoirs for piroplasms infecting equine and cattle in Riyadh City, Saudi Arabia. Acta Trop. 2019, 193, 78–83. [Google Scholar] [CrossRef]
- Qablan, M.A.; Sloboda, M.; Jirků, M.; Oborník, M.; Dwairi, S.; Amr, Z.S.; Hořín, P.; Lukeš, J.; Modrý, D. Quest for the piroplasms in camels: Identification of Theileria equi and Babesia caballi in Jordanian dromedaries by PCR. Vet. Parasitol. 2012, 186, 456–460. [Google Scholar] [CrossRef]
- de Souza Gonçalves, T.; de Nazaré Leite Barros, F.; Inoue, L.S.; de Farias, D.M.; dos Santos Lima, J.; Nobre, A.V.; Azenha Aidar, E.S.; Ferreira Diniz, R.R.; Gering, A.P.; Scofield, A. Natural Theileria equi infection in captive Tapirus terrestris (Perissodactyla: Tapiridae) in the Brazilian Amazon. Ticks Tick-Borne Dis. 2020, 11, 101452. [Google Scholar] [CrossRef]
- Sadeddine, R.; Diarra, A.Z.; Laroche, M.; Mediannikov, O.; Righi, S.; Benakhla, A.; Dahmana, H.; Raoult, D.; Parola, P. Molecular identification of protozoal and bacterial organisms in domestic animals and their infesting ticks from North-Eastern Algeria. Ticks Tick-Borne Dis. 2020, 11, 101330. [Google Scholar] [CrossRef] [PubMed]
- Baticados, A.M.; Baticados, W.N.; Carlos, E.T.; Carlos, S.M.; Villarba, L.A.; Subiaga, S.G.; Magcalas, J.M. Parasitological detection and molecular evidence of Hepatozoon canis from canines in Manila, Philippines. Vet. Med. Res. Rep. 2011, 1, 7–10. [Google Scholar] [CrossRef]
- Adao, D.E.V.; Herrera, C.M.T.; Galarion, L.H.; Bolo, N.R.; Carlos, R.S.; Carlos, E.T.; Carlos, S.S.; Rivera, W.L. Detection and molecular characterization of Hepatozoon canis, Babesia vogeli, Ehrlichia canis, and Anaplasma platys in dogs from Metro Manila, Philippines. Korean J. Vet. Res. 2017, 57, 79–88. [Google Scholar] [CrossRef]
- Galay, R.L.; Manalo, A.A.L.; Dolores, S.L.D.; Aguilar, I.P.M.; Sandalo, K.A.C.; Cruz, K.B.; Divina, B.P.; Andoh, M.; Masatani, T.; Tanaka, T. Molecular detection of tick-borne pathogens in canine population and Rhipicephalus sanguineus (sensu lato) ticks from Southern Metro Manila and Laguna, Philippines. Parasites Vectors 2018, 11, 643. [Google Scholar] [CrossRef] [PubMed]
- Ybañez, A.; Ybañez, R.H.; Estrera, A.; Talle, M.; Liu, M.; Xuan, X. Detection of Mycoplasma and Hepatozoon spp. in Philippine dogs. J. Protozool. Res. 2019, 29, 1–7. [Google Scholar]
- Colella, V.; Nguyen, V.L.; Tan, D.Y.; Lu, N.; Fang, F.; Zhijuan, Y.; Wang, J.; Liu, X.; Chen, X.; Dong, J.; et al. Zoonotic vectorborne pathogens and ectoparasites of dogs and cats in Eastern and Southeast Asia. Emerg. Infect. Dis. 2020, 26, 1221–1233. [Google Scholar] [CrossRef]
- Nguyen, V.-L.; Colella, V.; Greco, G.; Fang, F.; Nurcahyo, W.; Hadi, U.K.; Venturina, V.; Tong, K.B.Y.; Tsai, Y.-L.; Taweethavonsawat, P.; et al. Molecular detection of pathogens in ticks and fleas collected from companion dogs and cats in East and Southeast Asia. Parasites Vectors 2020, 13, 420. [Google Scholar] [CrossRef]
- de Miranda, R.L.; de Castro, J.R.; Olegário, M.M.M.; Beletti, M.E.; Mundim, A.V.; O’Dwyer, L.H.; Eyal, O.; Talmi-Frank, D.; Cury, M.C.; Baneth, G. Oocysts of Hepatozoon canis in Rhipicephalus (Boophilus) microplus collected from a naturally infected dog. Vet. Parasitol. 2011, 177, 392–396. [Google Scholar] [CrossRef]
- Li, J.; Kelly, P.; Guo, W.; Zhang, J.; Yang, Y.; Liu, W.; Wang, C. Molecular detection of Rickettsia, Hepatozoon, Ehrlichia and SFTSV in goat ticks. Vet. Parasitol. Reg. Stud. Rep. 2020, 20, 100407. [Google Scholar] [CrossRef]
- Gjerde, B. Molecular characterisation of Sarcocystis bovifelis, Sarcocystis bovini n. sp., Sarcocystis hirsuta and Sarcocystis cruzi from cattle (Bos taurus) and Sarcocystis sinensis from water buffaloes (Bubalus bubalis). Parasitol. Res. 2016, 115, 1473–1492. [Google Scholar] [CrossRef]
- Lindsay, D.S.; Dubey, J.P. Neosporosis, toxoplasmosis, and sarcocystosis in ruminants. Vet. Clin. N. Am. Food Anim. Pract. 2020, 36, 205–222. [Google Scholar] [CrossRef] [PubMed]
- Claveria, F.G.; Farolan, R.J.; Macabagdal, M.R.; Criss, A.; Salvador, R.; San-Pedro Lim, R. Light microscopic studies of Sarcocystis spp. infection in cattle slaughtered in three different abattoirs in Metro Manila. J. Protozool. Res. 1999, 9, 26–31. [Google Scholar] [CrossRef]
- Claveria, F.G.; San-Pedro, L.R.; Cruz-Flores, M.J.; Nagasawa, H.; Suzuki, N.; De la Peña, C. Ultrastructural studies of Sarcocystis cruzi (Hasselmann,1926) Wenyon, 1926 infection in cattle (Bos taurus): Philippine cases. Parasite 2001, 8, 251–254. [Google Scholar] [CrossRef] [PubMed][Green Version]
Description | Primer Name | Primer Sequence (5′-3′) | Legend | References |
---|---|---|---|---|
V4 hypervariable region of the 18S rRNA gene of piroplasma | RLB-F | GAGGTAGTGACAAGAAATAACAATA | {RLB-F} | [25] |
RLB-R | TCTTCGATCCCCTAACTTTC | {RLB-R} | ||
RLB primers with Illumina tails | Illumina RLB-F | ACACTCTTTCCCTACACGACGCTCTTCCGATCT{RLB-F} | {IlluminaF} | [17] |
Illumina RLB-R | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT{RLB-R} | {IlluminaR} | ||
Illumina-index primers | Illumina-i5 | AATGATACGGCGACCACCGAGATCTACAC{index-i5 *}{IlluminaF} | ||
Illumina-i7 | CAAGCAGAAGACGGCATACGAGAT{index-i7 *}{IlluminaR} |
Taxonomy Hit | No. of ASVs | Total Sequence Reads |
---|---|---|
B. bovis | 37 | 259,704 |
B. bigemina | 18 | 207,232 |
Babesia sp. | 3 | 162 |
T. orientalis | 13 | 347,535 |
T. annulata | 1 | 459 |
T. equi | 1 | 715 |
T. mutans | 1 | 2188 |
Theileria sp. Thung Song | 1 | 1100 |
H. canis | 2 | 490 |
S. cruzi | 2 | 818 |
Total | 79 | 820,403 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Galon, E.M.; Macalanda, A.M.; Sugi, T.; Hayashida, K.; Kawai, N.; Kidaka, T.; Ybañez, R.H.; Adjou Moumouni, P.F.; Ringo, A.E.; Li, H.; et al. Bovine Piroplasma Populations in the Philippines Characterized Using Targeted Amplicon Deep Sequencing. Microorganisms 2023, 11, 2584. https://doi.org/10.3390/microorganisms11102584
Galon EM, Macalanda AM, Sugi T, Hayashida K, Kawai N, Kidaka T, Ybañez RH, Adjou Moumouni PF, Ringo AE, Li H, et al. Bovine Piroplasma Populations in the Philippines Characterized Using Targeted Amplicon Deep Sequencing. Microorganisms. 2023; 11(10):2584. https://doi.org/10.3390/microorganisms11102584
Chicago/Turabian StyleGalon, Eloiza May, Adrian Miki Macalanda, Tatsuki Sugi, Kyoko Hayashida, Naoko Kawai, Taishi Kidaka, Rochelle Haidee Ybañez, Paul Franck Adjou Moumouni, Aaron Edmond Ringo, Hang Li, and et al. 2023. "Bovine Piroplasma Populations in the Philippines Characterized Using Targeted Amplicon Deep Sequencing" Microorganisms 11, no. 10: 2584. https://doi.org/10.3390/microorganisms11102584
APA StyleGalon, E. M., Macalanda, A. M., Sugi, T., Hayashida, K., Kawai, N., Kidaka, T., Ybañez, R. H., Adjou Moumouni, P. F., Ringo, A. E., Li, H., Ji, S., Yamagishi, J., Ybañez, A., & Xuan, X. (2023). Bovine Piroplasma Populations in the Philippines Characterized Using Targeted Amplicon Deep Sequencing. Microorganisms, 11(10), 2584. https://doi.org/10.3390/microorganisms11102584