Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strain Information and DNA Extraction
2.2. Design of Primers and Probes
2.3. Conventional PCR and MIRA-qPCR
2.4. Test for Specificity, Sensitivity and Repeatability
2.5. S. aureus and non-aureus Staphylococci Detection in Simulated Samples
3. Results
3.1. The Principle and Workflow of Duplex MIRA-qPCR Assay
3.2. Specificity Analysis of the MIRA-qPCR
3.3. Sensitivity Analysis of the MIRA-qPCR
3.4. Repeatability Analysis of the MIRA-qPCR
3.5. Evaluation of MIRA-qPCR Assay Using Simulated Samples
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Syed, M.A.; Ullah, H.; Tabassum, S.; Fatima, B.; Woodley, T.A.; Ramadan, H.; Jackson, C.R. Staphylococci in poultry intestines: A comparison between farmed and household chickens. Poult. Sci. 2020, 99, 4549–4557. [Google Scholar] [CrossRef]
- Mourenza, Á.; Gil, J.A.; Mateos, L.M.; Letek, M. Novel treatments and preventative strategies against food-poisoning caused by staphylococcal species. Pathogens 2021, 10, 91. [Google Scholar] [CrossRef] [PubMed]
- Ebani, V.V. Biology and pathogenesis of Staphylococcus infection. Microorganisms 2020, 8, 383. [Google Scholar] [CrossRef] [PubMed]
- Riegel, P.; Jesel-Morel, L.; Laventie, B.; Boisset, S.; Vandenesch, F.; Prévost, G. Coagulase-positive Staphylococcus pseudintermedius from animals causing human endocarditis. Int. J. Med. Microbiol. 2011, 301, 237–239. [Google Scholar] [CrossRef] [PubMed]
- Götz, F. Staphylococcus and biofilms. Mol. Microbiol. 2002, 43, 1367–1378. [Google Scholar] [CrossRef] [PubMed]
- Gordon, R.J.; Lowy, F.D. Pathogenesis of methicillin-resistant Staphylococcus aureus infection. Clin. Infect. Dis. 2008, 46 (Suppl. 5), S350–S359. [Google Scholar] [CrossRef]
- Penesyan, A.; Gillings, M.; Paulsen, I.T. Antibiotic discovery: Combatting bacterial resistance in cells and in biofilm communities. Molecules 2015, 20, 5286–5298. [Google Scholar] [CrossRef]
- Cheung, G.Y.C.; Bae, J.S.; Otto, M. Pathogenicity and virulence of Staphylococcus aureus. Virulence 2021, 12, 547–569. [Google Scholar] [CrossRef]
- Boucher, H.W.; Talbot, G.H.; Benjamin, D.K., Jr.; Bradley, J.; Guidos, R.J.; Jones, R.N.; Murray, B.E.; Bonomo, R.A.; Gilbert, D. 10 × ′20 Progress—Development of new drugs active against gram-negative bacilli: An update from the Infectious Diseases Society of America. Clin. Infect. Dis. 2013, 56, 1685–1694. [Google Scholar] [CrossRef]
- Khoshnood, S.; Heidary, M.; Asadi, A.; Soleimani, S.; Motahar, M.; Savari, M.; Saki, M.; Abdi, M. A review on mechanism of action, resistance, synergism, and clinical implications of mupirocin against Staphylococcus aureus. Biomed. Pharmacother. 2019, 109, 1809–1818. [Google Scholar] [CrossRef]
- França, A.; Gaio, V.; Lopes, N.; Melo, L.D.R. Virulence factors in coagulase-negative staphylococci. Pathogens 2021, 10, 170. [Google Scholar] [CrossRef] [PubMed]
- Michels, R.; Last, K.; Becker, S.L.; Papan, C. Update on coagulase-negative staphylococci—What the clinician should know. Microorganisms 2021, 9, 830. [Google Scholar] [CrossRef] [PubMed]
- Otto, M. Staphylococcus epidermidis—The ‘accidental’ pathogen. Nat. Rev. Microbiol. 2009, 7, 555–567. [Google Scholar] [CrossRef]
- Argemi, X.; Hansmann, Y.; Prola, K.; Prévost, G. Coagulase-negative staphylococci pathogenomics. Int. J. Mol. Sci. 2019, 20, 1215. [Google Scholar] [CrossRef]
- Lina, G. New insights into coagulase-negative staphylococci. Clin. Microbiol. Infect. 2019, 25, 1063. [Google Scholar] [CrossRef] [PubMed]
- Babenko, D.; Omarkulov, B.; Ilyaazizov; Sandle, T.; Moraru, D.C.; Chesca, A.E. Evaluation of sequence based typing methods (SPA and MSLT) for clonal characterization of Staphylococcus aureus. Acta Med. Mediterr. 2016, 32, 1851–1856. [Google Scholar]
- Sudhaharan, S.; Vanjari, L.; Mamidi, N.; Ede, N.; Vemu, L. Evaluation of LAMP assay using phenotypic tests and conventional PCR for detection of nuc and mecA genes among clinical isolates of Staphylococcus spp. J. Clin. Diagn. Res. 2015, 9, DC06–DC09. [Google Scholar] [CrossRef]
- Zhu, H.; Zhang, H.; Xu, Y.; Laššáková, S.; Korabečná, M.; Neužil, P. PCR past, present and future. Biotechniques 2020, 69, 317–325. [Google Scholar] [CrossRef]
- Xu, S.; Xie, X.; Shi, Y.; Chai, A.; Li, B.; Li, L. Development of a real-time quantitative PCR assay for the specific detection of Bacillus velezensis and its application in the study of colonization ability. Microorganisms 2022, 10, 1216. [Google Scholar] [CrossRef]
- Lorenz, T.C. Polymerase chain reaction: Basic protocol plus troubleshooting and optimization strategies. J. Vis. Exp. 2012, 63, e3998. [Google Scholar] [CrossRef]
- Yang, J.; Zhang, N.; Lv, J.; Zhu, P.; Pan, X.; Hu, J.; Wu, W.; Li, S.; Li, H. Comparing the performance of conventional PCR, RTQ-PCR, and droplet digital PCR assays in detection of Shigella. Mol. Cell. Probes 2020, 51, 101531. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Sun, C.; Wang, Y.; Gao, X.; You, J.; Yu, W.; Sun, N.; Yang, Y.; Li, X. Rapid detection of SARS-CoV-2 using duplex reverse transcription-multienzyme isothermal rapid amplification in a point-of-care testing. Front. Cell. Infect. Microbiol. 2021, 11, 678703. [Google Scholar] [CrossRef] [PubMed]
- Sun, M.L.; Lai, H.Y.; Chong, N.Y.; Liu, D.F.; Zhang, Z.Y.; Pang, B.; Yao, J. Simple and feasible detection of hepatitis B virus via combination of multienzyme isothermal rapid amplification and lateral flow dipstick strip. Front. Mol. Biosci. 2021, 8, 763079. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Li, M.C.; Liu, H.C.; Lin, S.Q.; Zhao, X.Q.; Liu, Z.G.; Zhao, L.L.; Wan, K.L. Detecting Mycobacterium tuberculosis complex and rifampicin resistance via a new rapid multienzyme isothermal point mutation assay. Anal. Biochem. 2021, 630, 114341. [Google Scholar] [CrossRef]
- Meier-Kolthoff, J.P.; Göker, M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat. Commun. 2019, 10, 2182. [Google Scholar] [CrossRef]
- Page, A.J.; Cummins, C.A.; Hunt, M.; Wong, V.K.; Reuter, S.; Holden, M.T.; Fookes, M.; Falush, D.; Keane, J.A.; Parkhill, J. Roary: Rapid large-scale prokaryote pan genome analysis. Bioinformatics 2015, 31, 3691–3693. [Google Scholar] [CrossRef]
- He, P.; Wang, H.; Yan, Y.; Zhu, G.; Chen, Z. Development and application of a multiplex fluorescent PCR for Shigella detection and species identification. J. Fluoresc. 2022, 32, 707–713. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, Q.; Guo, J.; Li, D.; Wang, L.; Wang, X.; Xing, G.; Deng, R.; Zhang, G. An isothermal molecular point of care testing for African swine fever virus using recombinase-aided amplification and lateral flow assay without the need to extract nucleic acids in blood. Front. Cell. Infect. Microbiol. 2021, 11, 633763. [Google Scholar] [CrossRef]
- Ren, Y.; Allenmark, F.; Müller, H.J.; Shi, Z. Variation in the "coefficient of variation": Rethinking the violation of the scalar property in time-duration judgments. Acta Psychol. 2021, 214, 103263. [Google Scholar] [CrossRef]
- Alarcón, B.; Vicedo, B.; Aznar, R. PCR-based procedures for detection and quantification of Staphylococcus aureus and their application in food. J. Appl. Microbiol. 2006, 100, 352–364. [Google Scholar] [CrossRef]
- Vichaibun, V.; Kanchanaphum, P. Quantitative LAMP and PCR detection of Salmonella in chicken samples collected from local markets around Pathum Thani province, Thailand. Int. J. Food. Sci. 2020, 2020, 8833173. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Lin, X.; Xu, X.; Wang, Z. Fabrication of gold/silver nanodimer SERS probes for the simultaneous detection of Salmonella typhimurium and Staphylococcus aureus. Mikrochim. Acta 2021, 188, 202. [Google Scholar] [CrossRef] [PubMed]
- Feng, Z.S.; Li, J.Y.; Zhang, J.Y.; Li, F.Y.; Guan, H.X.; Zhang, R.Q.; Liu, H.; Guo, Q.; Shen, X.X.; Kan, B.; et al. Development and evaluation of a sensitive recombinase aided amplification assay for rapid detection of Vibrio parahaemolyticus. J. Microbiol. Methods 2022, 193, 106404. [Google Scholar] [CrossRef]
- Wang, Y.; Li, D.; Wang, Y.; Li, K.; Ye, C. Rapid and sensitive detection of Vibrio parahaemolyticus and Vibrio vulnificus by multiple endonuclease restriction real-time loop-mediated isothermal amplification technique. Molecules 2016, 21, 111. [Google Scholar] [CrossRef] [PubMed]
- Heilmann, C.; Ziebuhr, W.; Becker, K. Are coagulase-negative staphylococci virulent? Clin. Microbiol. Infect. 2019, 25, 1071–1080. [Google Scholar] [CrossRef] [PubMed]
- Meng, X.; Zhang, G.; Sun, B.; Liu, S.; Wang, Y.; Gao, M.; Fan, Y.; Zhang, G.; Shi, G.; Kang, X. Rapid detection of mecA and femA genes by loop-mediated isothermal amplification in a microfluidic system for discrimination of different Staphylococcal species and prediction of methicillin resistance. Front. Microbiol. 2020, 11, 1487. [Google Scholar] [CrossRef]
- Zhou, J.; Yin, L.; Dong, Y.; Peng, L.; Liu, G.; Man, S.; Ma, L. CRISPR-Cas13a based bacterial detection platform: Sensing pathogen Staphylococcus aureus in food samples. Anal. Chim. Acta 2020, 1127, 225–233. [Google Scholar] [CrossRef]
- Kim, E.; Yang, S.M.; Won, J.E.; Kim, D.Y.; Kim, D.S.; Kim, H.Y. Real-time PCR method for the rapid detection and quantification of pathogenic Staphylococcus species based on novel molecular target genes. Foods 2021, 10, 2839. [Google Scholar] [CrossRef]
- Okolie, C.E.; Wooldridge, K.G.; Turner, D.P.; Cockayne, A.; James, R. Development of a new pentaplex real-time PCR assay for the identification of poly-microbial specimens containing Staphylococcus aureus and other staphylococci, with simultaneous detection of staphylococcal virulence and methicillin resistance markers. Mol. Cell. Probes 2015, 29, 144–150. [Google Scholar] [CrossRef]
- McClure, J.A.; Zaal DeLongchamp, J.; Conly, J.M.; Zhang, K. Novel multiplex PCR assay for detection of chlorhexidine-quaternary ammonium, mupirocin, and methicillin resistance genes, with simultaneous discrimination of Staphylococcus aureus from coagulase-negative staphylococci. J. Clin. Microbiol. 2017, 55, 1857–1864. [Google Scholar] [CrossRef]
- Tang, Y.W.; Kilic, A.; Yang, Q.; McAllister, S.K.; Li, H.; Miller, R.S.; McCormac, M.; Tracy, K.D.; Stratton, C.W.; Han, J.; et al. StaphPlex system for rapid and simultaneous identification of antibiotic resistance determinants and Panton-Valentine leukocidin detection of staphylococci from positive blood cultures. J. Clin. Microbiol. 2007, 45, 1867–1873. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sakai, H.; Procop, G.W.; Kobayashi, N.; Togawa, D.; Wilson, D.A.; Borden, L.; Krebs, V.; Bauer, T.W. Simultaneous detection of Staphylococcus aureus and coagulase-negative staphylococci in positive blood cultures by real-time PCR with two fluorescence resonance energy transfer probe sets. J. Clin. Microbiol. 2004, 42, 5739–5744. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Hong, J.; Lim, J.A.; Heu, S.; Roh, E. Improved multiplex PCR primers for rapid identification of coagulase-negative staphylococci. Arch. Microbiol. 2018, 200, 73–83. [Google Scholar] [CrossRef] [PubMed]
- Shang, Y.; Ye, Q.; Cai, S.; Wu, Q.; Pang, R.; Yang, S.; Xiang, X.; Wang, C.; Zha, F.; Ding, Y.; et al. Loop-mediated isothermal amplification (LAMP) for rapid detection of Salmonella in foods based on new molecular targets. LWT 2021, 142, 110999. [Google Scholar] [CrossRef]
- Wu, C.; Zeng, Y.; He, Y. Rapid visualization and detection of Staphylococcus aureus based on loop-mediated isothermal amplification. World J. Microbiol. Biotechnol. 2021, 37, 209. [Google Scholar] [CrossRef] [PubMed]
- Hu, J.; Wang, Y.; Ding, H.; Jiang, C.; Geng, Y.; Sun, X.; Jing, J.; Gao, H.; Wang, Z.; Dong, C. Recombinase polymerase amplification with polymer flocculation sedimentation for rapid detection of Staphylococcus aureus in food samples. Int. J. Food Microbiol. 2020, 331, 108691. [Google Scholar] [CrossRef]
- Deng, H.; Gao, Z. Bioanalytical applications of isothermal nucleic acid amplification techniques. Anal. Chim. Acta 2015, 853, 30–45. [Google Scholar] [CrossRef]
- Shanmugakani, R.K.; Bonam, W.; Erickson, D.; Mehta, S. An isothermal amplification-based point-of-care diagnostic platform for the detection of Mycobacterium tuberculosis: A proof-of-concept study. Curr. Res. Biotechnol. 2021, 3, 154–159. [Google Scholar] [CrossRef]
- Pilchová, V.; Seinige, D.; Hennig-Pauka, I.; Büttner, K.; Abdulmawjood, A.; Kehrenberg, C. Development and validation of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Glaesserella (Haemophilus) parasuis. Microorganisms 2020, 9, 41. [Google Scholar] [CrossRef]
- Shahbazi, E.; Mollasalehi, H.; Minai-Tehrani, D. Development and evaluation of an improved quantitative loop-mediated isothermal amplification method for rapid detection of Morganella morganii. Talanta 2019, 191, 54–58. [Google Scholar] [CrossRef]
- Ng, B.Y.C.; Wee, E.J.H.; Woods, K.; Anderson, W.; Antaw, F.; Tsang, H.Z.H.; West, N.P.; Trau, M. Isothermal point mutation detection: Toward a first-pass screening strategy for multidrug-resistant tuberculosis. Anal. Chem. 2017, 89, 9017–9022. [Google Scholar] [CrossRef] [PubMed]
- Weng, J.; Sheng, N.; Wang, R.; Liang, S.; Wang, C.; Bai, X.; Zhou, G.; Zou, B.; Song, Q. Multiplex visualized closed-tube PCR with hamming distance 2 code for 15 HPV subtype typing. Anal. Chem. 2021, 93, 5529–5536. [Google Scholar] [CrossRef] [PubMed]
- Waters, D.L.; Shapter, F.M. The polymerase chain reaction (PCR): General methods. Methods Mol. Biol. 2014, 1099, 65–75. [Google Scholar] [CrossRef] [PubMed]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef]
- Bu, Y.; Qiao, W.; Zhai, Z.; Liu, T.; Gong, P.; Zhang, L.; Hao, Y.; Yi, H. Establishment and evaluation of a loop-mediated isothermal amplification (LAMP) assay for rapid detection of Pseudomonas fluorescens in raw milk. Front. Microbiol. 2021, 12, 810511. [Google Scholar] [CrossRef]
- Stehlíková, D.; Beran, P.; Cohen, S.P.; Čurn, V. Development of real-time and colorimetric loop mediated isothermal amplification assay for detection of Xanthomonas gardneri. Microorganisms 2020, 8, 1301. [Google Scholar] [CrossRef]
- Lakhundi, S.; Zhang, K. Methicillin-resistant Staphylococcus aureus: Molecular characterization, evolution, and epidemiology. Clin. Microbiol. Rev. 2018, 31, e00020-18. [Google Scholar] [CrossRef]
- Huang, Q.Q.; Liu, B.B.; Zhu, H.F.; Ma, J.J.; Tsoi, M.; Yao, B.Q.; Yao, L.C.; Wu, Q.; Mu, X.Q.; Liu, S.L. Rapid and sensitive detection of the vanA resistance gene from clinical Enterococcus faecium and Enterococcus faecalis isolates by loop-mediated isothermal amplification. J. Glob. Antimicrob. Resist. 2019, 16, 262–265. [Google Scholar] [CrossRef]
- Ji, Y.; Wang, P.; Xu, T.; Zhou, Y.; Chen, R.; Zhu, H.; Zhou, K. Development of a one-step multiplex PCR assay for differential detection of four species (Enterobacter cloacae, Enterobacter hormaechei, Enterobacter roggenkampii, and Enterobacter kobei) belonging to Enterobacter cloacae complex with clinical significance. Front. Cell. Infect. Microbiol. 2021, 11, 677089. [Google Scholar] [CrossRef]
- Razei, A.; Sorouri, R.; Mousavi, S.L.; Nazarian, S.; Amani, J.; Aghamollaei, H. Presenting a rapid method for detection of Bacillus cereus, Listeria monocytogenes and Campylobacter jejuni in food samples. Iran J. Basic Med. Sci. 2017, 20, 1050–1055. [Google Scholar] [CrossRef]
- Maikanov, B.; Mustafina, R.; Auteleyeva, L.; Wiśniewski, J.; Anusz, K.; Grenda, T.; Kwiatek, K.; Goldsztejn, M.; Grabczak, M. Clostridium botulinum and Clostridium perfringens occurrence in Kazakh honey samples. Toxins 2019, 11, 472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Target | Sequence (5′–3′) | Product Sizes (bp) |
---|---|---|---|
FMN-bgsfp | Staphylococcus aureus | F: ATGACCAGCTTCGGTACTACTAAAGATTATC | 285 |
R: TCCATAACTCATACCAGATTGTCCTACGATAC | |||
Probe:TCGCGAATGAGCGTTTATTTAGTCGTGAAGAATA[dT-FAM][THF]G[dT-BHQ1]GTACCGACAAAGATT[c3spacer] | |||
tuf | Staphylococcus spp. | F: CTTCCCAGGTGAYGAYGTACCTGTAATCGC | 220 |
R: ACCACGTTCAACACGGCCWGTAGCAACAGT | |||
Probe: AACCATTCATGATGCCWGTTGAGGACGTAT[FAM-dT][THF][ BHQ1-dT]CAATCACTGGTCGTG [c3spacer] |
Bacterial Concentration (CFU/mL) | ||||||
---|---|---|---|---|---|---|
N × 107 | N × 106 | N × 105 | N × 104 | N × 103 | N × 102 | |
Ct values for Replicate 1 (N = 2.64) | 3.84 | 5.62 | 7.48 | 10.24 | 13.46 | 15.86 |
Ct values for Replicate 2 (N = 3) | 3.75 | 5.68 | 7.43 | 10.17 | 13.42 | 15.82 |
Ct values for Replicate 3 (N = 5.26) | 3.91 | 5.71 | 7.51 | 10.20 | 13.48 | 15.85 |
Mean of Ct values | 3.83 | 5.67 | 7.47 | 10.20 | 13.45 | 15.84 |
SD of Ct values | 0.08 | 0.05 | 0.04 | 0.04 | 0.03 | 0.02 |
CV (%) | 2.09 | 0.88 | 0.54 | 0.39 | 0.22 | 0.13 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lai, J.; Huang, Z.; Xiao, Y.; Yu, K.; Bai, X.; Gao, H.; Dai, H.; Liu, X.; Wang, D. Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci. Microorganisms 2022, 10, 1734. https://doi.org/10.3390/microorganisms10091734
Lai J, Huang Z, Xiao Y, Yu K, Bai X, Gao H, Dai H, Liu X, Wang D. Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci. Microorganisms. 2022; 10(9):1734. https://doi.org/10.3390/microorganisms10091734
Chicago/Turabian StyleLai, Jiulian, Zhenzhou Huang, Yue Xiao, Keyi Yu, Xuemei Bai, He Gao, Hang Dai, Xiaoning Liu, and Duochun Wang. 2022. "Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci" Microorganisms 10, no. 9: 1734. https://doi.org/10.3390/microorganisms10091734
APA StyleLai, J., Huang, Z., Xiao, Y., Yu, K., Bai, X., Gao, H., Dai, H., Liu, X., & Wang, D. (2022). Development and Evaluation of Duplex MIRA-qPCR Assay for Simultaneous Detection of Staphylococcus aureus and non-aureus Staphylococci. Microorganisms, 10(9), 1734. https://doi.org/10.3390/microorganisms10091734