Morphological Phenotypes, Cell Division, and Gene Expression of Escherichia coli under High Concentration of Sodium Sulfate
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture and Media
2.2. Experimental Setup to Measure the Growth Curve of Bacteria
2.3. Imaging and the Image Analysis
2.4. Cell Death Assay
2.5. Primers and RT-qPCR
3. Results
3.1. Cell Growth and Cell Death at Different Na2SO4 Concentration
3.2. Cell Division, Cell Length, and Morphological Heterogeneity
3.3. Reversibility of Cell Morphology upon Removal of the Salt Stress
3.4. Expression of Gene Involved in the Transport of Water, Sodium, Uptake and Metabolism of Sulfate, and Fatty Acid Production
3.5. Osmotic Pressure as the Limiting Factor for the Growth Inhibition
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yayanos, A.A.; Dietz, A.S.; Van Boxtel, R. Dependence of reproduction rate on pressure as a hallmark of deep-sea bacteria. Appl. Environ. Microbiol. 1982, 44, 1356–1361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kato, C.; Sato, T.; Horikoshi, K. Isolation and properties of barophilic and barotolerant bacteria from deep-sea mud samples. Biodivers. Conserv. 1995, 4, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Brock, T.D.; Freeze, H. Thermus aquaticus gen. n. and sp. n., a nonsporulating extreme thermophile. J. Bacteriol. 1969, 98, 289–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huston, A.L.; Krieger-Brockett, B.B.; Deming, J.W. Remarkably low temperature optima for extracellular enzyme activity from Arctic bacteria and sea ice. Environ. Microbiol. 2000, 2, 383–388. [Google Scholar] [CrossRef] [Scilit]
- Antón, J.; Oren, A.; Benlloch, S.; Rodríguez-Valera, F.; Amann, R.; Rosselló-Mora, R. Salinibacter ruber gen. nov., sp. nov., a novel, extremely halophilic member of the Bacteria from saltern crystallizer ponds. Int. J. Syst. Evol. Microbiol. 2002, 52, 485–491. [Google Scholar] [CrossRef] [Scilit]
- Horikoshi, K.; Antranikian, G.; Bull, A.T.; Robb, F.T.; Stetter, K.O. Extremophiles Handbook; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2010. [Google Scholar]
- Horikoshi, K.; Akiba, T. Alkalophilic Microorganisms: A New Microbial World; Springer: Berlin/Heidelberg, Germany, 1982. [Google Scholar]
- Schleper, C.; Pühler, G.; Kühlmorgen, B.; Zillig, W. Life at extremely low pH. Nature 1995, 375, 741–742. [Google Scholar] [CrossRef] [Scilit]
- Cassen, P.; Reynolds, R.T.; Peale, S. Is there liquid water on Europa? Geophys. Res. Lett. 1979, 6, 731–734. [Google Scholar] [CrossRef] [Scilit]
- Squyres, S.W.; Reynolds, R.T.; Cassen, P.M.; Peale, S.J. Liquid water and active resurfacing on Europa. Nature 1983, 301, 225–226. [Google Scholar] [CrossRef] [Scilit]
- Pappalardo, R.T.; Belton, M.J.; Breneman, H.; Carr, M.; Chapman, C.R.; Collins, G.; Denk, T.; Fagents, S.; Geissler, P.E.; Giese, B.; et al. Does Europa have a subsurface ocean? Evaluation of the geological evidence. J. Geophys. Res. Planets 1999, 104, 24015–24055. [Google Scholar]
- Schmidt, B.; Blankenship, D.D.; Patterson, G.; Schenk, P. Active formation of ‘chaos terrain’ over shallow subsurface water on Europa. Nature 2011, 479, 502–505. [Google Scholar] [CrossRef] [Scilit]
- Gaidos, E.J.; Nimmo, F. Planetary science: Tectonics and water on Europa. Nature 2000, 405, 637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Manga, M.; Wang, C.Y. Pressurized oceans and the eruption of liquid water on Europa and Enceladus. Geophys. Res. Lett. 2007, 34, L07202. [Google Scholar] [CrossRef] [Scilit]
- Roth, L.; Saur, J.; Retherford, K.D.; Strobel, D.F.; Feldman, P.D.; McGrath, M.A.; Nimmo, F. Transient water vapor at Europa’s south pole. Science 2014, 343, 171–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sparks, W.B.; Hand, K.; McGrath, M.; Bergeron, E.; Cracraft, M.; Deustua, S. Probing for evidence of plumes on Europa with HST/STIS. Astrophys. J. 2016, 829, 121. [Google Scholar] [CrossRef] [Scilit]
- Chyba, C.F. Energy for microbial life on Europa. Nature 2000, 403, 381–382. [Google Scholar] [CrossRef] [Scilit]
- Chyba, C.F.; Hand, K.P. Life without photosynthesis. Science 2001, 292, 2026–2027. [Google Scholar] [CrossRef] [Scilit]
- McCord, T.; Hansen, G.; Fanale, F.; Carlson, R.; Matson, D.; Johnson, T.; Smythe, W.; Crowley, J.; Martin, P.; Ocampo, A.; et al. Salts on Europa’s surface detected by Galileo’s near infrared mapping spectrometer. Science 1998, 280, 1242–1245. [Google Scholar] [CrossRef] [Scilit]
- Dalton, J.B., III. Linear mixture modeling of Europa’s non-ice material based on cryogenic laboratory spectroscopy. Geophys. Res. Lett. 2007, 34, L21205. [Google Scholar] [CrossRef] [Scilit]
- Dalton, J., III; Pitman, K. Low temperature optical constants of some hydrated sulfates relevant to planetary surfaces. J. Geophys. Res. Planets 2012, 117, E0900. [Google Scholar] [CrossRef] [Scilit]
- Zolotov, M.Y.; Shock, E.L. Composition and stability of salts on the surface of Europa and their oceanic origin. J. Geophys. Res. Planets 2001, 106, 32815–32827. [Google Scholar] [CrossRef] [Scilit]
- Kargel, J.S.; Kaye, J.Z.; Head III, J.W.; Marion, G.M.; Sassen, R.; Crowley, J.K.; Ballesteros, O.P.; Grant, S.A.; Hogenboom, D.L. Europa’s crust and ocean: Origin, composition, and the prospects for life. Icarus 2000, 148, 226–265. [Google Scholar] [CrossRef] [Scilit]
- Zolotov, M.Y. Aqueous fluid composition in CI chondritic materials: Chemical equilibrium assessments in closed systems. Icarus 2012, 220, 713–729. [Google Scholar] [CrossRef] [Scilit]
- Marion, G.M. A molal-based model for strong acid chemistry at low temperatures (<200 to 298 K). Geochim. Cosmochim. Acta 2002, 66, 2499–2516. [Google Scholar]
- Marion, G.M.; Kargel, J.S.; Catling, D.C.; Jakubowski, S.D. Effects of pressure on aqueous chemical equilibria at subzero temperatures with applications to Europa. Geochim. Cosmochim. Acta 2005, 69, 259–274. [Google Scholar] [CrossRef] [Scilit]
- Hedlund, B.P.; Dodsworth, J.A.; Murugapiran, S.K.; Rinke, C.; Woyke, T. Impact of single-cell genomics and metagenomics on the emerging view of extremophile “microbial dark matter”. Extremophiles 2014, 18, 865–875. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sawle, L.; Ghosh, K. How do thermophilic proteins and proteomes withstand high temperature? Biophys. J. 2011, 101, 217–227. [Google Scholar] [CrossRef] [Scilit]
- Greenbaum, B.D.; Kumar, P.; Libchaber, A. Using First Passage Statistics to Extract Environmentally Dependent Amino Acid Correlations. PLoS ONE 2014, 9, e101665. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Omelchenko, M.V.; Wolf, Y.I.; Gaidamakova, E.K.; Matrosova, V.Y.; Vasilenko, A.; Zhai, M.; Daly, M.J.; Koonin, E.V.; Makarova, K.S. Comparative genomics of Thermus thermophilus and Deinococcus radiodurans: Divergent routes of adaptation to thermophily and radiation resistance. BMC Evol. Biol. 2005, 5, 57. [Google Scholar] [CrossRef] [Scilit]
- Sælensminde, G.; Halskau, Ø.; Helland, R.; Willassen, N.P.; Jonassen, I. Structure-dependent relationships between growth temperature of prokaryotes and the amino acid frequency in their proteins. Extremophiles 2007, 11, 585–596. [Google Scholar] [CrossRef] [Scilit]
- Sinha, N.; Smith-Gill, S.J. Electrostatics in protein binding and function. Curr. Protein Pept. Sci. 2002, 3, 601–614. [Google Scholar] [CrossRef] [Scilit]
- Draper, D.E. A guide to ions and RNA structure. RNA 2004, 10, 335–343. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, Z.J.; Chen, S.J. Salt contribution to RNA tertiary structure folding stability. Biophys. J. 2011, 101, 176–187. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, Z.J.; Chen, S.J. Nucleic acid helix stability: Effects of salt concentration, cation valence and size, and chain length. Biophys. J. 2006, 90, 1175–1190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maity, A.; Singh, A.; Singh, N. Differential stability of DNA based on salt concentration. Eur. Biophys. J. 2017, 46, 33–40. [Google Scholar] [CrossRef] [Scilit]
- Tadeo, X.; López-Méndez, B.; Castaño, D.; Trigueros, T.; Millet, O. Protein stabilization and the Hofmeister effect: The role of hydrophobic solvation. Biophys. J. 2009, 97, 2595–2603. [Google Scholar] [CrossRef] [Scilit]
- Cray, J.A.; Russell, J.T.; Timson, D.J.; Singhal, R.S.; Hallsworth, J.E. A universal measure of chaotropicity and kosmotropicity. Environ. Microbiol. 2013, 15, 287–296. [Google Scholar] [CrossRef] [Scilit]
- Koch, A.L. Shrinkage of growing Escherichia coli cells by osmotic challenge. J. Bacteriol. 1984, 159, 919–924. [Google Scholar] [CrossRef] [Scilit]
- Rojas, E.; Theriot, J.A.; Huang, K.C. Response of Escherichia coli growth rate to osmotic shock. Proc. Natl. Acad. Sci. USA 2014, 111, 7807–7812. [Google Scholar] [CrossRef] [Scilit]
- Cota-Robles, E.H. Electron microscopy of plasmolysis in Escherichia coli. J. Bacteriol. 1963, 85, 499–503. [Google Scholar] [CrossRef] [Scilit]
- Csonka, L.N. Physiological and genetic responses of bacteria to osmotic stress. Microbiol. Mol. Biol. Rev. 1989, 53, 121–147. [Google Scholar] [CrossRef]
- Romantsov, T.; Guan, Z.; Wood, J.M. Cardiolipin and the osmotic stress responses of bacteria. Biochim. Biophys. Acta (BBA) Biomembr. 2009, 1788, 2092–2100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sleator, R.D.; Hill, C. Bacterial osmoadaptation: The role of osmolytes in bacterial stress and virulence. FEMS Microbiol. Rev. 2002, 26, 49–71. [Google Scholar] [CrossRef] [Scilit]
- Nossal, N.G.; Heppel, L.A. The release of enzymes by osmotic shock from Escherichia coli in exponential phase. J. Biol. Chem. 1966, 241, 3055–3062. [Google Scholar] [CrossRef] [Scilit]
- Sledjeski, D.D.; Gottesman, S. Osmotic shock induction of capsule synthesis in Escherichia coli K-12. J. Bacteriol. 1996, 178, 1204–1206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anraku, Y. The reduction and restoration of galactose transport in osmotically shocked cells of Escherichia coli. J. Biol. Chem. 1967, 242, 793–800. [Google Scholar] [CrossRef] [Scilit]
- Nepal, S.; Kumar, P. Growth, Cell Division, and Gene Expression of Escherichia coli at Elevated Concentrations of Magnesium Sulfate: Implications for Habitability of Europa and Mars. Microorganisms 2020, 8, 637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hulst, H.C.; van de Hulst, H.C. Light Scattering by Small Particles; Dover Publications, Inc.: Mineola, NY, USA, 1981. [Google Scholar]
- Kumar, P.; Libchaber, A. Pressure and temperature dependence of growth and morphology of Escherichia coli: Experiments and stochastic model. Biophys. J. 2013, 105, 783–793. [Google Scholar] [CrossRef] [Scilit]
- Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 Years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [Scilit]
- Bikandi, J.; Millán, R.S.; Rementeria, A.; Garaizar, J. In silico analysis of complete bacterial genomes: PCR, AFLP–PCR and endonuclease restriction. Bioinformatics 2004, 20, 798–799. [Google Scholar] [CrossRef] [Scilit]
- Cockell, C.S.; McLean, C.M.; Perera, L.; Aka, S.; Stevens, A.; Dickinson, A.W. Growth of Non-Halophilic Bacteria in the Sodium–Magnesium–Sulfate–Chloride Ion System: Unravelling the Complexities of Ion Interactions in Terrestrial and Extraterrestrial Aqueous Environments. Astrobiology 2020, 20, 944–955. [Google Scholar] [CrossRef] [Scilit]
- Stevens, A.H.; Cockell, C.S. A Systematic Study of the Limits of Life in Mixed Ion Solutions: Physicochemical Parameters Do Not Predict Habitability. Front. Microbiol. 2020, 11, 1478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calamita, G.; Kempf, B.; Bonhivers, M.; Bishai, W.R.; Bremer, E.; Agre, P. Regulation of the Escherichia coli water channel gene aqpZ. Proc. Natl. Acad. Sci. USA 1998, 95, 3627–3631. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soupene, E.; King, N.; Lee, H.; Kustu, S. Aquaporin Z of Escherichia coli: Reassessment of its regulation and physiological role. J. Bacteriol. 2002, 184, 4304–4307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dover, N.; Higgins, C.; Carmel, O.; Rimon, A.; Pinner, E.; Padan, E. Na+-induced transcription of nhaA, which encodes an Na+/H+ antiporter in Escherichia coli, is positively regulated by nhaR and affected by hns. J. Bacteriol. 1996, 178, 6508–6517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stevenson, A.; Cray, J.A.; Williams, J.P.; Santos, R.; Sahay, R.; Neuenkirchen, N.; McClure, C.D.; Grant, I.R.; Houghton, J.D.; Quinn, J.P.; et al. Is there a common water-activity limit for the three domains of life? ISME J. 2015, 9, 1333–1351. [Google Scholar] [CrossRef] [Scilit]
- De Lima Alves, F.; Stevenson, A.; Baxter, E.; Gillion, J.L.; Hejazi, F.; Hayes, S.; Morrison, I.E.; Prior, B.A.; McGenity, T.J.; Rangel, D.E.; et al. Concomitant osmotic and chaotropicity-induced stresses in Aspergillus wentii: Compatible solutes determine the biotic window. Curr. Genet. 2015, 61, 457–477. [Google Scholar] [CrossRef] [Scilit]
- Zajc, J.; Džeroski, S.; Kocev, D.; Oren, A.; Sonjak, S.; Tkavc, R.; Gunde-Cimerman, N. Chaophilic or chaotolerant fungi: A new category of extremophiles? Front. Microbiol. 2014, 5, 708. [Google Scholar] [CrossRef] [Scilit]
- Heinz, J.; Rambags, V.; Schulze-Makuch, D. Physicochemical Parameters Limiting Growth of Debaryomyces hansenii in Solutions of Hygroscopic Compounds and Their Effects on the Habitability of Martian Brines. Life 2021, 11, 1194. [Google Scholar] [CrossRef] [Scilit]
- Rard, J.A.; Miller, D.G. Isopiestic determination of the Osmotic coefficients of aqueous sodium sulfate, magnesium sulfate, and sodium sulfate-magnesium sulfate at 25. degree. C. J. Chem. Eng. Data 1981, 26, 33–38. [Google Scholar] [CrossRef] [Scilit]
- Pitzer, K.S. Activity Coefficients in Electrolyte Solutions; CRC Press: Boca Raton, FL, USA, 2018. [Google Scholar]
- Marion, G.M.; Grant, S.A. FREZCHEM: A Chemical-Thermodynamic Model for Aqueous Solutions at Subzero Temperatures; Technical Report; Cold Regions Research and Engineering Lab Hanover NH: Hanover, NH, USA, 1994. [Google Scholar]
- Marion, G.M.; Kargel, J.S. Cold Aqueous Planetary Geochemistry with FREZCHEM: From Modeling to the Search for Life at the Limits; Springer Science & Business Media: Berlin/Heidelberg, Germany, 2007. [Google Scholar]
- Marion, G.M.; Mironenko, M.V.; Roberts, M.W. FREZCHEM: A geochemical model for cold aqueous solutions. Comput. Geosci. 2010, 36, 10–15. [Google Scholar] [CrossRef] [Scilit]
- Møller, N. The prediction of mineral solubilities in natural waters: A chemical equilibrium model for the Na-Ca-Cl-SO4-H2O system, to high temperature and concentration. Geochim. Cosmochim. Acta 1988, 52, 821–837. [Google Scholar] [CrossRef] [Scilit]
- Scott, W. Water relations of food spoilage microorganisms. In Advances in Food Research; Elsevier: Amsterdam, The Netherlands, 1957; Volume 7, pp. 83–127. [Google Scholar]
- Fontana, A. Minimum water activity limits for growth of microorganisms. Water Act. Foods Fundam. Appl. 2007, 405, 405. [Google Scholar]
- Cayley, S.; Lewis, B.A.; Guttman, H.J.; Record, M.T., Jr. Characterization of the cytoplasm of Escherichia coli K-12 as a function of external osmolarity: Implications for protein-DNA interactions in vivo. J. Mol. Biol. 1991, 222, 281–300. [Google Scholar] [CrossRef] [Scilit]
- Svensson, I.; Wehtje, E.; Adlercreutz, P.; Mattiasson, B. Effects of water activity on reaction rates and equilibrium positions in enzymatic esterifications. Biotechnol. Bioeng. 1994, 44, 549–556. [Google Scholar] [CrossRef] [Scilit]
- Franks, F. Water activity: A credible measure of food safety and quality? Trends Food Sci. Technol. 1991, 2, 68–72. [Google Scholar] [CrossRef] [Scilit]
- ZoBell, C.E.; Johnson, F.H. The influence of hydrostatic pressure on the growth and viability of terrestrial and marine bacteria. J. Bacteriol. 1949, 57, 179–189. [Google Scholar] [CrossRef] [Scilit]
- Jones, T.; Gill, C.; McMullen, L. The behaviour of log phase Escherichia coli at temperatures that fluctuate about the minimum for growth. Lett. Appl. Microbiol. 2004, 39, 296–300. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, H.; Pangborn, J.; Kilgore, W.W. Filamentous cells of Escherichia coli formed in the presence of mitomycin. J. Bacteriol. 1967, 93, 683–688. [Google Scholar] [CrossRef] [Scilit]
- Adler, H.I.; Hardigree, A.A. Growth and division of filamentous forms of Escherichia coli. J. Bacteriol. 1965, 90, 223–226. [Google Scholar] [CrossRef] [Scilit]
- Margolin, W. Themes and variations in prokaryotic cell division. FEMS Microbiol. Rev. 2000, 24, 531–548. [Google Scholar] [CrossRef]
- Hale, C.A.; De Boer, P.A. ZipA is required for recruitment of FtsK, FtsQ, FtsL, and FtsN to the septal ring in Escherichia coli. J. Bacteriol. 2002, 184, 2552–2556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bisson-Filho, A.W.; Hsu, Y.P.; Squyres, G.R.; Kuru, E.; Wu, F.; Jukes, C.; Sun, Y.; Dekker, C.; Holden, S.; VanNieuwenhze, M.S.; et al. Treadmilling by FtsZ filaments drives peptidoglycan synthesis and bacterial cell division. Science 2017, 355, 739–743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Lyu, Z.; Miguel, A.; McQuillen, R.; Huang, K.C.; Xiao, J. GTPase activity–Coupled treadmilling of the bacterial tubulin FtsZ organizes septal cell wall synthesis. Science 2017, 355, 744–747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, K.; Lutkenhaus, J. ftsZ is an essential cell division gene in Escherichia coli. J. Bacteriol. 1991, 173, 3500–3506. [Google Scholar] [CrossRef] [Scilit]
- Ma, X.; Ehrhardt, D.W.; Margolin, W. Colocalization of cell division proteins FtsZ and FtsA to cytoskeletal structures in living Escherichia coli cells by using green fluorescent protein. Proc. Natl. Acad. Sci. USA 1996, 93, 12998–13003. [Google Scholar] [CrossRef] [Scilit]
- Bi, E.; Lutkenhaus, J. FtsZ ring structure associated with division in Escherichia coli. Nature 1991, 354, 161–164. [Google Scholar] [CrossRef] [Scilit]
- Addinall, S.G.; Lutkenhaus, J. FtsZ-spirals and-arcs determine the shape of the invaginating septa in some mutants of Escherichia coli. Mol. Microbiol. 1996, 22, 231–237. [Google Scholar] [CrossRef] [Scilit]
- Ishii, A.; Sato, T.; Wachi, M.; Nagai, K.; Kato, C. Effects of high hydrostatic pressure on bacterial cytoskeleton FtsZ polymers in vivo and in vitro. Microbiology 2004, 150, 1965–1972. [Google Scholar] [CrossRef] [Scilit]
- Szwedziak, P.; Löwe, J. Do the divisome and elongasome share a common evolutionary past? Curr. Opin. Microbiol. 2013, 16, 745–751. [Google Scholar] [CrossRef] [Scilit]
- Garner, E.C.; Bernard, R.; Wang, W.; Zhuang, X.; Rudner, D.Z.; Mitchison, T. Coupled, circumferential motions of the cell wall synthesis machinery and MreB filaments in B. subtilis. Science 2011, 333, 222–225. [Google Scholar] [CrossRef] [Scilit]
- Ursell, T.S.; Nguyen, J.; Monds, R.D.; Colavin, A.; Billings, G.; Ouzounov, N.; Gitai, Z.; Shaevitz, J.W.; Huang, K.C. Rod-like bacterial shape is maintained by feedback between cell curvature and cytoskeletal localization. Proc. Natl. Acad. Sci. USA 2014, 111, E1025–E1034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elowitz, M.B.; Levine, A.J.; Siggia, E.D.; Swain, P.S. Stochastic gene expression in a single cell. Science 2002, 297, 1183–1186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kerr, R.A.; Levine, H.; Sejnowski, T.J.; Rappel, W.J. Division accuracy in a stochastic model of Min oscillations in Escherichia coli. Proc. Natl. Acad. Sci. USA 2006, 103, 347–352. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calamita, G. The Escherichia coli aquaporin-Z water channel: MicroReview. Mol. Microbiol. 2000, 37, 254–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Jiang, W.; Nan, J.; Almqvist, J.; Huang, Y. The Escherichia coli CysZ is a pH dependent sulfate transporter that can be inhibited by sulfite. Biochim. Biophys. Acta (BBA) Biomembr. 2014, 1838, 1809–1816. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kertesz, M.A.; Leisinger, T.; Cook, A.M. Proteins induced by sulfate limitation in Escherichia coli, Pseudomonas putida, or Staphylococcus aureus. J. Bacteriol. 1993, 175, 1187–1190. [Google Scholar] [CrossRef] [Scilit]
- Leyh, T.; Taylor, J.; Markham, G. The sulfate activation locus of Escherichia coli K12: Cloning, genetic, and enzymatic characterization. J. Biol. Chem. 1988, 263, 2409–2416. [Google Scholar] [CrossRef] [Scilit]
- Karpel, R.; Alon, T.; Glaser, G.; Schuldiner, S.; Padan, E. Expression of a sodium proton antiporter (NhaA) in Escherichia coli is induced by Na+ and Li+ ions. J. Biol. Chem. 1991, 266, 21753–21759. [Google Scholar] [CrossRef] [Scilit]
- Padan, E.; Tzubery, T.; Herz, K.; Kozachkov, L.; Rimon, A.; Galili, L. NhaA of Escherichia coli, as a model of a pH-regulated Na+/H+ antiporter. Biochim. Biophys. Acta (BBA) Bioenerg. 2004, 1658, 2–13. [Google Scholar] [CrossRef] [Scilit]
- Yamazaki, M.; Ohnishi, S.; Ito, T. Osmoelastic coupling in biological structures: Decrease in membrane fluidity and osmophobic association of phospholipid vesicles in response to osmotic stress. Biochemistry 1989, 28, 3710–3715. [Google Scholar] [CrossRef] [Scilit]
- Laroche, C.; Beney, L.; Marechal, P.; Gervais, P. The effect of osmotic pressure on the membrane fluidity of Saccharomyces cerevisiae at different physiological temperatures. Appl. Microbiol. Biotechnol. 2001, 56, 249–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clark, D.P.; DeMendoza, D.; Polacco, M.L.; Cronan, J.E., Jr. beta.-Hydroxydecanoyl thioester dehydrase does not catalyze a rate-limiting step in Escherichia coli unsaturated fatty acid synthesis. Biochemistry 1983, 22, 5897–5902. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Metris, A.; George, S.; Mulholland, F.; Carter, A.; Baranyi, J. Metabolic shift of Escherichia coli under salt stress in the presence of glycine betaine. Appl. Environ. Microbiol. 2014, 80, 4745–4756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zolotov, M.Y. Aqueous origins of bright salt deposits on Ceres. Icarus 2017, 296, 289–304. [Google Scholar] [CrossRef] [Scilit]
- De Sanctis, M.; Ammannito, E.; Raponi, A.; Frigeri, A.; Ferrari, M.; Carrozzo, F.; Ciarniello, M.; Formisano, M.; Rousseau, B.; Tosi, F.; et al. Fresh emplacement of hydrated sodium chloride on Ceres from ascending salty fluids. Nat. Astron. 2020, 4, 786–793. [Google Scholar] [CrossRef] [Scilit]










| Na2SO4 (m) | pH () |
|---|---|
| 0.0 | 7.00 |
| 0.2 | 6.82 |
| 0.4 | 6.77 |
| 0.6 | 6.62 |
| 0.8 | 6.55 |
| 1.0 | 6.45 |
| Gene | Primer | Sequence (5-3) |
|---|---|---|
| 16s rRNA | Forward Reverse | TCGTCAGCTCGTGTTGTGAA AGGGCCATGATGACTTGACG |
| aqpZ | Forward Reverse | AGCATTCACCAGGCGGTTAT TCAGGGTTAAGGCCAGACCA |
| cysN | Forward Reverse | ATCGCCACGACCAGATGTTT CGAGCAGTACACCCGCAATA |
| cysZ | Forward Reverse | CGTTCCGGACTGGCTACAAT CGTGCTTCCAGTTGTTCAGC |
| fabA | Forward Reverse | AATTTCACTTCGCCAACGCC TCTGTGGTTCTTCGGATGCC |
| nhaA | Forward Reverse | TGAAAGAGAAGCATGGGCGT GCAGAATGGAGGTCAAGCCA |
| nhaB | Forward Reverse | TCTTGCAGGTCGGTGTCTTC GTCGCTCTCTTTTTGCGTGG |
| osmZ | Forward Reverse | TTCGTTCGGGTCAATACCGT ACGCTGGAAGAAATGCTGGA |
| sbp | Forward Reverse | CACGCCGAGTGAGTCTATCC CGGTAGTAGTTTTTCGCGGC |
| Na2SO4 (m) | (m) | (m) | CV (%) |
|---|---|---|---|
| 0 | 2.04 | 0.22 | 22.77 |
| 0.2 | 1.64 | 0.26 | 31.34 |
| 0.4 | 1.93 | 0.41 | 31.81 |
| 0.6 | 2.69 | 2.54 | 59.29 |
| 0.8 | 3.78 | 4.74 | 57.57 |
| 1.0 | 1.66 | 0.28 | 32.02 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nguyen, K.; Kumar, P. Morphological Phenotypes, Cell Division, and Gene Expression of Escherichia coli under High Concentration of Sodium Sulfate. Microorganisms 2022, 10, 274. https://doi.org/10.3390/microorganisms10020274
Nguyen K, Kumar P. Morphological Phenotypes, Cell Division, and Gene Expression of Escherichia coli under High Concentration of Sodium Sulfate. Microorganisms. 2022; 10(2):274. https://doi.org/10.3390/microorganisms10020274
Chicago/Turabian StyleNguyen, Khanh, and Pradeep Kumar. 2022. "Morphological Phenotypes, Cell Division, and Gene Expression of Escherichia coli under High Concentration of Sodium Sulfate" Microorganisms 10, no. 2: 274. https://doi.org/10.3390/microorganisms10020274
APA StyleNguyen, K., & Kumar, P. (2022). Morphological Phenotypes, Cell Division, and Gene Expression of Escherichia coli under High Concentration of Sodium Sulfate. Microorganisms, 10(2), 274. https://doi.org/10.3390/microorganisms10020274

