Development of a Real-Time Recombinase-Aided Amplification Method to Rapidly Detect Methicillin-Resistant Staphylococcus aureus
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and DNA Extraction
2.2. Plasmid
2.3. RAA Primer and Exo Probe
2.4. Real-Time RAA Assay
2.5. qPCR Assay
2.6. Analytical Specificity
2.7. Analytical Sensitivity
2.8. Sample Detection
3. Results
3.1. Design of the mecA Real-Time RAA Primers and Probe
3.2. Reaction Optimization for Real-Time RAA Assays
3.3. Analytical Sensitivity of the Real-Time RAA Assays
3.4. Analytical Specificity of the Real-Time RAA Assays
3.5. Diagnostic Performance of Real-Time RAA Assays Evaluated with Clinical S. aureus Clinical Isolates
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ondusko, D.S.; Nolt, D. Staphylococcus aureus. Pediatr. Rev. 2018, 39, 287–298. [Google Scholar] [CrossRef] [PubMed]
- Lowy, F.D. Staphylococcus aureus Infections. N. Engl. J. Med. 1998, 339, 520–532. [Google Scholar] [CrossRef] [PubMed]
- Eriksen, K.R. “Celbenin”-Resistant Staphylococci. Ugeskr Laeger. 1961, 123, 384–386. [Google Scholar] [PubMed]
- Hartman, B.J.; Tomasz, A. Low-Affinity Penicillin-Binding Protein Associated with Beta-Lactam Resistance in Staphylococcus aureus. J. Bacteriol. 1984, 158, 513–516. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, P.E.; Brown, D.F. Penicillin-Binding Proteins of Beta-Lactam-Resistant Strains of Staphylococcus aureus: Effect of Growth Conditions. FEBS Lett. 1985, 192, 28–32. [Google Scholar] [CrossRef] [PubMed]
- Matsuhashi, M.; Song, M.D.; Ishino, F.; Wachi, M.; Doi, M.; Inoue, M.; Ubukata, K.; Yamashita, N.; Konno, M. Molecular Cloning of the Gene of a Penicillin-Binding Protein Supposed to Cause High Resistance to Beta-Lactam Antibiotics in Staphylococcus aureus. J. Bacteriol. 1986, 167, 975–980. [Google Scholar] [CrossRef] [PubMed]
- Hiramatsu, K.; Asada, K.; Suzuki, E.; Okonogi, K.; Yokota, T. Molecular Cloning and Nucleotide Sequence Determination of the Regulator Region of Meca Gene in Methicillin-Resistant Staphylococcus aureus (Mrsa). FEBS Lett. 1992, 298, 133–136. [Google Scholar] [CrossRef] [PubMed]
- Katayama, Y.; Ito, T.; Hiramatsu, K. A New Class of Genetic Element, Staphylococcus Cassette Chromosome Mec, Encodes Methicillin Resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 2000, 44, 1549–1555. [Google Scholar] [CrossRef] [PubMed]
- Blanco, N.; O’Hara, L.M.; Harris, A.D. Transmission Pathways of Multidrug-Resistant Organisms in the Hospital Setting: A Scoping Review. Infect. Control Hosp. Epidemiol. 2019, 40, 447–456. [Google Scholar] [CrossRef] [PubMed]
- Otto, M. Community-Associated Mrsa: What Makes Them Special? Int. J. Med. Microbiol. 2013, 303, 324–330. [Google Scholar] [CrossRef] [PubMed]
- Mediavilla, J.R.; Chen, L.; Mathema, B.; Kreiswirth, B.N. Global Epidemiology of Community-Associated Methicillin Resistant Staphylococcus aureus (Ca-Mrsa). Curr. Opin. Microbiol. 2012, 15, 588–595. [Google Scholar] [CrossRef]
- Weese, J.S. Methicillin-Resistant Staphylococcus aureus in Animals. ILAR J. 2010, 51, 233–244. [Google Scholar] [CrossRef]
- Cuny, C.; Friedrich, A.; Kozytska, S.; Layer, F.; Nubel, U.; Ohlsen, K.; Strommenger, B.; Walther, B.; Wieler, L.; Witte, W. Emergence of Methicillin-Resistant Staphylococcus aureus (Mrsa) in Different Animal Species. Int. J. Med. Microbiol. 2010, 300, 109–117. [Google Scholar] [CrossRef]
- Zou, G.; Matuszewska, M.; Jia, M.; Zhou, J.; Ba, X.; Duan, J.; Zhang, C.; Zhao, J.; Tao, M.; Fan, J.; et al. A Survey of Chinese Pig Farms and Human Healthcare Isolates Reveals Separate Human and Animal Methicillin-Resistant Staphylococcus aureus Populations. Adv. Sci. 2022, 9, e2103388. [Google Scholar] [CrossRef]
- Devriese, L.A.; van Damme, L.R.; Fameree, L. Methicillin (Cloxacillin)-Resistant Staphylococcus aureus Strains Isolated from Bovine Mastitis Cases. Zentralbl. Veterinarmed. B 1972, 19, 598–605. [Google Scholar] [CrossRef]
- Chen, C.; Wu, F. Livestock-Associated Methicillin-Resistant Staphylococcus aureus (La-Mrsa) Colonisation and Infection among Livestock Workers and Veterinarians: A Systematic Review and Meta-Analysis. Occup. Environ. Med. 2020, 78, 530–540. [Google Scholar] [CrossRef]
- Lee, A.S.; de Lencastre, H.; Garau, J.; Kluytmans, J.; Malhotra-Kumar, S.; Peschel, A.; Harbarth, S. Methicillin-Resistant Staphylococcus aureus. Nat. Rev. Dis. Primers 2018, 4, 18033. [Google Scholar] [CrossRef]
- Palavecino, E.L. Rapid Methods for Detection of Mrsa in Clinical Specimens. Methods Mol. Biol. 2020, 2069, 29–45. [Google Scholar]
- Merlino, J.; Leroi, M.; Bradbury, R.; Veal, D.; Harbour, C. New Chromogenic Identification and Detection of Staphylococcus aureus and Methicillin-Resistant S. Aureus. J. Clin. Microbiol. 2000, 38, 2378–2380. [Google Scholar] [CrossRef]
- Perry, J.D. A Decade of Development of Chromogenic Culture Media for Clinical Microbiology in an Era of Molecular Diagnostics. Clin. Microbiol. Rev. 2017, 30, 449–479. [Google Scholar] [CrossRef]
- Paule, S.M.; Mehta, M.; Hacek, D.M.; Gonzalzles, T.M.; Robicsek, A.; Peterson, L.R. Chromogenic Media vs. Real-Time Pcr for Nasal Surveillance of Methicillin-Resistant Staphylococcus aureus: Impact on Detection of Mrsa-Positive Persons. Am. J. Clin. Pathol. 2009, 131, 532–539. [Google Scholar] [CrossRef] [PubMed]
- Sanchini, A. Recent Developments in Phenotypic and Molecular Diagnostic Methods for Antimicrobial Resistance Detection in Staphylococcus aureus: A Narrative Review. Diagnostics 2022, 12, 208. [Google Scholar] [CrossRef] [PubMed]
- Winstanley, T.; Courvalin, P. Expert Systems in Clinical Microbiology. Clin. Microbiol. Rev. 2011, 24, 515–556. [Google Scholar] [CrossRef] [PubMed]
- Harbarth, S.; Hawkey, P.M.; Tenover, F.; Stefani, S.; Pantosti, A.; Struelens, M.J. Update on Screening and Clinical Diagnosis of Meticillin-Resistant Staphylococcus aureus (Mrsa). Int. J. Antimicrob. Agents 2011, 37, 110–117. [Google Scholar] [CrossRef] [PubMed]
- Paule, S.M.; Pasquariello, A.C.; Thomson, R.B., Jr.; Kaul, K.L.; Peterson, L.R. Real-Time Pcr Can Rapidly Detect Methicillin-Susceptible and Methicillin-Resistant Staphylococcus aureus Directly from Positive Blood Culture Bottles. Am. J. Clin. Pathol. 2005, 124, 404–407. [Google Scholar] [CrossRef]
- Nijhuis, R.H.; van Maarseveen, N.M.; van Hannen, E.J.; van Zwet, A.A.; Mascini, E.M. A Rapid and High-Throughput Screening Approach for Methicillin-Resistant Staphylococcus Aureus Based on the Combination of Two Different Real-Time Pcr Assays. J. Clin. Microbiol. 2014, 52, 2861–2867. [Google Scholar] [CrossRef][Green Version]
- Warren, D.K.; Liao, R.S.; Merz, L.R.; Eveland, M.; Dunne, W.M., Jr. Detection of Methicillin-Resistant Staphylococcus Aureus Directly from Nasal Swab Specimens by a Real-Time Pcr Assay. J. Clin. Microbiol. 2004, 42, 5578–5581. [Google Scholar] [CrossRef]
- Huletsky, A.; Giroux, R.; Rossbach, V.; Gagnon, M.; Vaillancourt, M.; Bernier, M.; Gagnon, F.; Truchon, K.; Bastien, M.; Picard, F.J.; et al. New Real-Time Pcr Assay for Rapid Detection of Methicillin-Resistant Staphylococcus aureus Directly from Specimens Containing a Mixture of Staphylococci. J. Clin. Microbiol. 2004, 42, 1875–1884. [Google Scholar] [CrossRef]
- Polisena, J.; Chen, S.; Cimon, K.; McGill, S.; Forward, K.; Gardam, M. Clinical Effectiveness of Rapid Tests for Methicillin Resistant Staphylococcus aureus (Mrsa) in Hospitalized Patients: A Systematic Review. BMC Infect. Dis. 2011, 11, 336. [Google Scholar] [CrossRef]
- Anjum, M.F.; Zankari, E.; Hasman, H. Molecular Methods for Detection of Antimicrobial Resistance. Microbiol. Spectr. 2017, 5, ARBA-0011-2017. [Google Scholar] [CrossRef]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-Mediated Isothermal Amplification (Lamp): A Versatile Technique for Detection of Micro-Organisms. J. Appl. Microbiol. 2018, 124, 626–643. [Google Scholar] [CrossRef]
- Anjum, M.F.; Lemma, F.; Cork, D.J.; Meunier, D.; Murphy, N.; North, S.E.; Woodford, N.; Haines, J.; Randall, L.P. Isolation and Detection of Extended Spectrum Beta-Lactamase (Esbl)-Producing Enterobacteriaceae from Meat Using Chromogenic Agars and Isothermal Loop-Mediated Amplification (Lamp) Assays. J. Food. Sci. 2013, 78, M1892–M1898. [Google Scholar] [CrossRef]
- Solanki, R.; Vanjari, L.; Ede, N.; Gungi, A.; Soory, A.; Vemu, L. Evaluation of Lamp Assay Using Phenotypic Tests and Conventional Pcr for Detection of Blandm-1 and Blakpc Genes among Carbapenem-Resistant Clinical Gram-Negative Isolates. J. Med. Microbiol. 2013, 62 Pt 10, 1540–1544. [Google Scholar] [CrossRef]
- Yamamoto, N.; Hamaguchi, S.; Akeda, Y.; Santanirand, P.; Kerdsin, A.; Seki, M.; Ishii, Y.; Paveenkittiporn, W.; Bonomo, R.A.; Oishi, K.; et al. Clinical Specimen-Direct Lamp: A Useful Tool for the Surveillance of Blaoxa-23-Positive Carbapenem-Resistant Acinetobacter Baumannii. PLoS ONE 2015, 10, e0133204. [Google Scholar] [CrossRef]
- Mu, X.Q.; Liu, B.B.; Hui, E.; Huang, W.; Yao, L.C.; Duo, L.B.; Sun, W.Y.; Li, G.Q.; Wang, F.X.; Liu, S.L. A Rapid Loop-Mediated Isothermal Amplification (Lamp) Method for Detection of the Macrolide-Streptogramin Type B Resistance Gene Msra in Staphylococcus aureus. J. Glob. Antimicrob. Resist. 2016, 7, 53–58. [Google Scholar] [CrossRef]
- Mercado, C.G.; Robles, R.G.; Ascencio, F.; Silva-Sanchez, J.; Estrada-Garcia, M.T.; Gomez-Anduro, G. Development of a Lamp Method for Detection of Carbapenem-Resistant Acinetobacter Baumannii During a Hospital Outbreak. J. Infect. Dev. Ctries. 2020, 14, 494–501. [Google Scholar] [CrossRef]
- Pu, W.; Wang, Y.; Yang, N.; Guo, G.; Li, H.; Li, Q.; Rehman, N.U.; Zheng, L.; Wang, P.; Han, S.; et al. Investigation of Streptococcus Agalactiae Using Pcsb-Based Lamp in Milk, Tilapia and Vaginal Swabs in Haikou, China. J. Appl. Microbiol. 2020, 128, 784–793. [Google Scholar] [CrossRef]
- Behrmann, O.; Hugle, M.; Eckardt, F.; Bachmann, I.; Heller, C.; Schramm, M.; Turner, C.; Hufert, F.T.; Dame, G. 3d Printed Monolithic Microreactors for Real-Time Detection of Klebsiella Pneumoniae and the Resistance Gene Blandm-1 by Recombinase Polymerase Amplification. Micromachines 2020, 11, 595. [Google Scholar] [CrossRef]
- Kanokudom, S.; Assawakongkarat, T.; Akeda, Y.; Ratthawongjirakul, P.; Chuanchuen, R.; Chaichanawongsaroj, N. Rapid Detection of Extended Spectrum Beta-Lactamase Producing Escherichia coli Isolated from Fresh Pork Meat and Pig Cecum Samples Using Multiplex Recombinase Polymerase Amplification and Lateral Flow Strip Analysis. PLoS ONE 2021, 16, e0248536. [Google Scholar] [CrossRef]
- Wang, X.; Xu, L.L.; Zuo, X.Y.; Lin, J.W.; Jin, Z.; Shen, R.; Du, D.; Tang, Y.Z. Rapid Detection of the New Delhi Metallo-Beta-Lactamase (Ndm) Gene by Recombinase Polymerase Amplification. Infect. Genet. Evol. 2021, 87, 104678. [Google Scholar] [CrossRef]
- Singpanomchai, N.; Akeda, Y.; Tomono, K.; Tamaru, A.; Santanirand, P.; Ratthawongjirakul, P. Rapid Detection of Multidrug-Resistant Tuberculosis Based on Allele-Specific Recombinase Polymerase Amplification and Colorimetric Detection. PLoS ONE 2021, 16, e0253235. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Wang, X.; Yang, L.; Kan, B.; Lu, X. Rapid Detection of Mcr-1 by Recombinase Polymerase Amplification. J. Med. Microbiol. 2018, 67, 1682–1688. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Guo, L.; Ma, R.; Cong, L.; Wu, Z.; Wei, Y.; Xue, S.; Zheng, W.; Tang, S. Rapid Detection of Salmonella with Recombinase Aided Amplification. J. Microbiol. Methods 2017, 139, 202–204. [Google Scholar] [CrossRef] [PubMed]
- Song, Z.; Ting, L.; Kun, Y.; Wei, L.; Jian-Feng, Z.; Li-Chuan, G.; Yan-Hong, L.; Yang, D.; Qing-Jie, Y.; Hai-Tao, Y. Establishment of a Recombinase-Aided Isothermal Amplification Technique to Detect Schistosoma Japonicum Specific Gene Fragments. Zhongguo Xue Xi Chong Bing Fang Zhi Za Zhi 2018, 30, 273–277. [Google Scholar] [PubMed]
- Zhang, R.Q.; Li, G.X.; Li, X.N.; Shen, X.X.; Gao, Y.; Wang, L.; Fan, T.; Duan, Q.X.; Wang, Y.K.; Wang, J.; et al. A Rapid and Sensitive Recombinase Aided Amplification Assay Incorporating Competitive Internal Control to Detect Bordetella Pertussis Using the DNA Obtained by Boiling. Int. J. Infect. Dis. 2019, 86, 108–113. [Google Scholar] [CrossRef] [PubMed]
- Mu, D.; Zhou, D.; Xie, G.; Liu, J.; Xiong, Q.; Feng, X.; Xu, H. The Fluorescent Probe-Based Recombinase-Aided Amplification for Rapid Detection of Escherichia coli O157:H7. Mol. Cell. Probes 2021, 60, 101777. [Google Scholar] [CrossRef] [PubMed]
- Mu, D.; Zhou, D.; Xie, G.; Liu, J.; Wang, Z.; Xiong, Q.; Xu, H. Real-Time Recombinase-Aided Amplification with Improved Propidium Monoazide for the Rapid Detection of Viable Escherichia coli O157:H7 in Milk. J. Dairy Sci. 2022, 105, 1028–1038. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.; Ge, Y.; Zhao, K.; Zhu, X.; Chen, Y.; Wu, B.; Zhu, F.; Zhu, B.; Cui, L. A Reverse-Transcription Recombinase-Aided Amplification Assay for the Rapid Detection of N Gene of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). Virology 2020, 549, 1–4. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Yu, Z.; Jiao, S.; Liu, Y.; Ni, H.; Wang, Y. Development of a Recombinase-Aided Amplification Assay for Rapid and Sensitive Detection of Porcine Circovirus 3. J. Virol. Methods 2020, 282, 113904. [Google Scholar] [CrossRef]
- Xue, G.; Li, S.; Zhang, W.; Du, B.; Cui, J.; Yan, C.; Huang, L.; Chen, L.; Zhao, L.; Sun, Y.; et al. Reverse-Transcription Recombinase-Aided Amplification Assay for Rapid Detection of the 2019 Novel Coronavirus (SARS-CoV-2). Anal. Chem. 2020, 92, 9699–9705. [Google Scholar] [CrossRef]
- Xiong, Y.; Luo, Y.; Li, H.; Wu, W.; Ruan, X.; Mu, X. Rapid Visual Detection of Dengue Virus by Combining Reverse Transcription Recombinase-Aided Amplification with Lateral-Flow Dipstick Assay. Int. J. Infect. Dis. 2020, 95, 406–412. [Google Scholar] [CrossRef] [PubMed]
- Xue, G.; Li, S.; Zhao, H.; Yan, C.; Feng, Y.; Cui, J.; Jiang, T.; Yuan, J. Use of a Rapid Recombinase-Aided Amplification Assay for Mycoplasma Pneumoniae Detection. BMC Infect. Dis. 2020, 20, 79. [Google Scholar] [CrossRef]
- Zhang, W.; Feng, Y.; Zhao, H.; Yan, C.; Feng, J.; Gan, L.; Cui, J.; Liu, S.; Zhang, R.; Du, S.; et al. A Recombinase Aided Amplification Assay for Rapid Detection of the Klebsiella Pneumoniae Carbapenemase Gene and Its Characteristics in Klebsiella Pneumoniae. Front. Cell. Infect. Microbiol. 2021, 11, 746325. [Google Scholar] [CrossRef]
- Feng, Y.; Xue, G.; Feng, J.; Yan, C.; Cui, J.; Gan, L.; Zhang, R.; Zhao, H.; Xu, W.; Li, N.; et al. Rapid Detection of New Delhi Metallo-Beta-Lactamase Gene Using Recombinase-Aided Amplification Directly on Clinical Samples from Children. Front. Microbiol. 2021, 12, 691289. [Google Scholar] [CrossRef]
- Louie, L.; Goodfellow, J.; Mathieu, P.; Glatt, A.; Louie, M.; Simor, A.E. Rapid Detection of Methicillin-Resistant Staphylococci from Blood Culture Bottles by Using a Multiplex Pcr Assay. J. Clin. Microbiol. 2002, 40, 2786–2790. [Google Scholar] [CrossRef] [PubMed]
- Mankertz, A.; Hillenbrand, B. Replication of Porcine Circovirus Type 1 Requires Two Proteins Encoded by the Viral Rep Gene. Virology 2001, 279, 429–438. [Google Scholar] [CrossRef][Green Version]
- Chen, Y.; Shi, Y.; Zhu, W.; You, J.; Yang, J.; Xie, Y.; Zhao, H.; Li, H.; Fan, S.; Li, L.; et al. Combining Crispr-Cas12a-Based Technology and Metagenomics Next Generation Sequencing: A New Paradigm for Rapid and Full-Scale Detection of Microbes in Infectious Diabetic Foot Samples. Front. Microbiol. 2021, 12, 742040. [Google Scholar] [CrossRef]
Name | Sequence (5′ 3′) | Gene | Location | Reference |
---|---|---|---|---|
mecA-F1 | TACTGCTATCCACCCTCAAACAGGTGAATTA | mecA | 1041–1071 | This study |
mecA-F2 | ATGATTATGGCTCAGGTACTGCTATCCACC | mecA | 1025–1054 | This study |
mecA-F3 | CTAAAGTTCAAAAGAGTATTTATAACAACATG | mecA | 989–1020 | This study |
mecA-R1 | TTAATTTATTATATTCTTCGTTACTCATGC | mecA | 1121–1150 | This study |
mecA-R2 | TGTAATCTGGAACTTGTTGAGCAGAGGTTC | mecA | 1165–1194 | This study |
mecA-R3 | TTGAACCTGGTGAAGTTGTAATCTGGAACT | mecA | 1181–1210 | This study |
p1073–1120 | TAGCACTTGTAAGCACACCTTCATATGACG[FAM-dT] [thf][BHQ1-dT]ATCCATTTATGTATG | mecA | 1073–1120 | This study |
mecA-F | GATTATGGCTCAGGTACTGCTATCC | mecA | 1027–1051 | [26] |
mecA-R | TTCGTTACTCATGCCATACATAAATG | mecA | 1109–1134 | [26] |
mecA-probe | VIC-CCTCAAACAGGTGAATTATTAGCACTTGTAAGCA-BHQ1 | mecA | 1053–1087 | [26] |
Method | qPCR | Kappa | p-Value | |||
---|---|---|---|---|---|---|
Positive | Negative | Total | ||||
RAA | Positive | 54 | 2 | 56 | 0.9517 | 0.0001 |
Negative | 0 | 11 | 11 | |||
Total | 54 | 13 | 67 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ding, X.; Wang, H.; Cui, M.; Cheng, M.; Zhao, Q.; Bai, Y.; Zhang, C.; Zhang, C.; Xu, S.; Li, T. Development of a Real-Time Recombinase-Aided Amplification Method to Rapidly Detect Methicillin-Resistant Staphylococcus aureus. Microorganisms 2022, 10, 2351. https://doi.org/10.3390/microorganisms10122351
Ding X, Wang H, Cui M, Cheng M, Zhao Q, Bai Y, Zhang C, Zhang C, Xu S, Li T. Development of a Real-Time Recombinase-Aided Amplification Method to Rapidly Detect Methicillin-Resistant Staphylococcus aureus. Microorganisms. 2022; 10(12):2351. https://doi.org/10.3390/microorganisms10122351
Chicago/Turabian StyleDing, Xiaoyan, Hejia Wang, Mingquan Cui, Min Cheng, Qi Zhao, Yuhui Bai, Chunping Zhang, Cunshuai Zhang, Shixin Xu, and Ting Li. 2022. "Development of a Real-Time Recombinase-Aided Amplification Method to Rapidly Detect Methicillin-Resistant Staphylococcus aureus" Microorganisms 10, no. 12: 2351. https://doi.org/10.3390/microorganisms10122351
APA StyleDing, X., Wang, H., Cui, M., Cheng, M., Zhao, Q., Bai, Y., Zhang, C., Zhang, C., Xu, S., & Li, T. (2022). Development of a Real-Time Recombinase-Aided Amplification Method to Rapidly Detect Methicillin-Resistant Staphylococcus aureus. Microorganisms, 10(12), 2351. https://doi.org/10.3390/microorganisms10122351