Allelic Variation and Selection in Effector Genes of Phytophthora infestans (Mont.) de Bary
Abstract
1. Introduction
2. Results
2.1. Phytophthora Infestans Isolates
2.2. Mating Type
2.3. Sequence Analysis of Effector Genes
3. Discussion
4. Materials and Methods
4.1. Isolates
4.2. DNA Purification
4.3. Mating Type
4.4. Effector Genes
4.5. PCR Amplification and Sequence of Effector Genes
4.6. Sequence Analyses
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- De Wit, P.; Testa, A.; Oliver, R. Fungal Plant Pathogenesis Mediated by Effectors. Microbiol. Spectr. 2016, 4. [Google Scholar] [CrossRef]
- Bhadauria, V.; Vijayan, P.; Wei, Y.; Banniza, S. Transcriptome analysis reveals a complex interplay between resistance and effector genes during the compatible lentil-Colletotrichum lentis interaction. Sci. Rep. 2017, 7, 42338. [Google Scholar] [CrossRef] [PubMed]
- Boevnik, P.; McLellan, H.; Gilroy, E.; Naqvi, S.; He, Q.; Yang, L.; Wang, X.; Turnbull, D.; Armstrong, M.; Tian, Z.; et al. Oomycetes Seek Help from the Plant: Phytophthora infestans Effectors Target Host Susceptibility Factors. Mol. Plant. 2016, 9, 636–638. [Google Scholar] [CrossRef]
- Van Weymers, P.; Baker, K.; Chen, X.; Harrower, B.; Cooke, D.; Gilroy, E.; Birch, P.; Thilliez, G.; Lees, A.; Lynott, J.; et al. Utilizing “Omic” Technologies to Identify and Prioritize Novel Sources of Resistance to the Oomycete Pathogen Phytophthora infestans in Potato Germplasm Collections. Front. Plant Sci. 2016, 7, 672. [Google Scholar] [CrossRef] [PubMed]
- Van Schie, C.; Takken, F. Susceptibility genes 101: How to be a good host. Annu. Rev. Phytopathol. 2014, 52, 551–581. [Google Scholar] [CrossRef] [PubMed]
- Birch, P.; Boevink, P.; Gilroy, E.; Hein, I.; Pritchard, L.; Whisson, S. Oomycete RXLR effectors: Delivery, functional redundancy and durable disease resistance. Curr. Opin. Plant Biol. 2008, 11, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Ravensdale, M.; Nemri, A.; Thrall, P.; Ellis, J.; Dodds, P. Co-evolutionary interactions between host resistance and pathogen effector genes in flax rust disease. Mol. Plant Pathol. 2011, 12, 93–102. [Google Scholar] [CrossRef]
- Kamoun, S. 2004 Foreword. In Fungal Disease Resistance in Plants: Biochemistry, Molecular Biology, and Genetic Engineering; Punja, Z., Ed.; CRC Press: New York, NY, USA, 2004; pp. xvii–xviii. [Google Scholar]
- Stahl, E.; Bishop, J. Plant-pathogen arms races at the molecular level. Curr. Opin. Plant Biol. 2000, 3, 299–304. [Google Scholar] [CrossRef]
- Liu, Z.; Bos, J.; Armstrong, M.; Whisson, S.; da Cunha, L.; Torto-Alalibo, T.; Win, J.; Avrova, A.; Wright, F.; Birch, P.; et al. Patterns of diversifying selection in the phytotoxin-like scr74 gene family of Phytophthora infestans. Mol. Biol. Evol. 2005, 22, 659–672. [Google Scholar] [CrossRef]
- Allen, R.; Bittner-Eddy, P.; Grenville-Briggs, L.; Meitz, J.; Rehmany, A.; Rose, L.; Beynon, J. Host-parasite coevolutionary conflict between Arabidopsis and downy mildew. Science 2004, 306, 1957–1960. [Google Scholar] [CrossRef]
- Rehmany, A.; Gordon, A.; Rose, L.; Allen, R.; Armstrong, M.; Whisson, S.; Kamoun, S.; Tyler, B.; Birch, P.; Beynon, J. Differential recognition of highly divergent downy mildew avirulence gene alleles by RPP1 resistance genes from two Arabidopsis lines. Plant Cell 2005, 17, 1839–1850. [Google Scholar] [CrossRef] [PubMed]
- Win, J.; Morgan, W.; Bos, J.; Krasileva, K.; Cano, L.; Chaparro-García, A.; Ammar, R.; Staskawicz, B.; Kamoun, S. Adaptive evolution has targeted the C-terminal domain of the RXLR effectors of plant pathogenic oomycetes. Plant Cell 2007, 19, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Anderson, R.; Deb, D.; Fedkenheuer, K.; McDowell, J. Recent progress in RxLR effector research. Mol. Plant-Microbe Interact. 2015, 28, 1063–1072. [Google Scholar] [CrossRef]
- Zheng, X.; McLellan, H.; Fraiture, M.; Liu, X.; Boevink, P.; Gilroy, E.; Chen, Y.; Kandel, K.; Sessa, G.; Birch, P.; et al. Functionally Redundant RXLR Effectors from Phytophthora infestans Act at Different Steps to Suppress Early flg22-Triggered Immunity. PLoS Pathog. 2014, 10, e1004057. [Google Scholar] [CrossRef] [PubMed]
- Armstrong, M.; Whisson, S.; Pritchard, L.; Bos, J.; Venter, E.; Avrova, A.; Rehmany, A.; Böhme, U.; Brooks, K.; Cherevach, I.; et al. An ancestral oomycete locus contains late blight avirulence gene Avr3a, encoding a protein that is recognized in the host cytoplasm. Proc. Natl. Acad. Sci. USA 2005, 102, 7766–7771. [Google Scholar] [CrossRef] [PubMed]
- Whisson, S.; Boevink, P.; Wang, S.; Birch, P. The cell biology of late blight disease. Curr. Opin. Microbiol. 2016, 34, 127–135. [Google Scholar] [CrossRef] [PubMed]
- Cooke, D.; Cano, L.; Raffaele, S.; Bain, R.; Cooke, L.; Etherington, G.; Deahl, K.; Farrer, R.; Gilroy, E.; Goss, E.; et al. Genome Analyses of an Aggressive and Invasive Lineage of the Irish Potato Famine Pathogen. PLoS Pathog. 2012, 8, e1002940. [Google Scholar] [CrossRef]
- Yang, L.; Ouyang, H.; Fang, Z.; Zhu, W.; Wu, E.; Luo, G.; Shang, L.; Zhan, J. Evidence for intragenic recombination and selective sweep in an effector gene of Phytophthora infestans. Evol. Appl. 2018, 11, 1342–1353. [Google Scholar] [CrossRef]
- Lokossou, A.; Park, T.-H.; van Arkel, G.; Arens, M.; Ruyter-Spira, C.; Morales, J.; Whisson, S.; Birch, P.; Visser, R.; Jacobsen, E.; et al. Exploiting Knowledge of R/Avr Genes to Rapidly Clone a New Leucine Zipper-NBS-LRR Family of Late Blight Resistance Genes from Potato Linkage Group IV--A. Mol. Plant-Microbe Interact. 2009, 22, 630–641. [Google Scholar] [CrossRef]
- Vleeshouwers, V.; Rietman, H.; Krenek, P.; Champouret, N.; Young, C.; Oh, S.; Wang, M.; Bouwmeester, K.; Vosman, B.; Visser, R.; et al. Effector genomics accelerates discovery and functional profiling of potato disease resistance and Phytophthora infestans avirulence genes. PLoS ONE 2008, 3, e2875. [Google Scholar] [CrossRef]
- Forbes, G.; Morales, J.; Restrepo, S.; Pérez, W.; Gamboa, S.; Ruiz, R.; Cedeño, L.; Fermin, G.; Andreu, A.; Acuña, I.; et al. Phytophthora infestans and Phytophthora andina on Solanaceous Hosts in South America. In Phytophthora A Global Perspective; Lamour, K., Ed.; CABI: Oxfordshire, UK, 2013; pp. 48–58. [Google Scholar]
- Zapata, J.; Bernal, J. Caracterización de razas fisiológicas de Phytophthora infestans (Mont.) de Bary en lulo (Solanum quitoense Lam.). Corpoica Cienc Tecnol. Agropecu. 2012, 13, 13–20. [Google Scholar] [CrossRef]
- Bos, J.; Armstrong, M.; Gilroy, E.; Boevink, P.; Hein, I.; Taylor, R.; Zhendong, T.; Engelhardt, S.; Vetukuri, R.; Harrower, B.; et al. Phytophthora infestans effector AVR3a is essential for virulence and manipulates plant immunity by stabilizing host E3 ligase CMPG1. Proc. Natl. Acad. Sci. USA 2010, 107, 9909–9914. [Google Scholar] [CrossRef] [PubMed]
- Whisson, S.; Boevink, P.; Moleleki, L.; Avrova, A.; Morales, J.; Gilroy, E.; Armstrong, M.; Grouffaud, S.; van West, P.; Chapman, S.; et al. A translocation signal for delivery of oomycete effector proteins into host plant cells. Nature 2007, 450, 115–118. [Google Scholar] [CrossRef] [PubMed]
- Shen, B.; Bai, J.; Vihinen, M. Physicochemical feature-based classification of amino acid mutations. Prot. Eng. Des. Select. 2008, 21, 37–44. [Google Scholar] [CrossRef] [PubMed]
- Stergiopoulos, I.; De Kock, M.; Lindhout, P.; De Wit, P. Allelic variation in the effector genes of the tomato pathogen Cladosporium fulvum reveals different modes of adaptive evolution. Mol. Plant-Microbe Interact. 2007, 20, 1271–1283. [Google Scholar] [CrossRef]
- Gómez, S. Interacciones del Agente Causal de la Gota Phytophthora spp. Con Hospedantes Solanaceos Andinos. Ph.D. Thesis, Doctorado en Ciencias Agrarias, Facultad Ciencias Agrarias, Universidad Nacional de Colombia Sede Medellín, Medellín, Colombia, 2017. [Google Scholar]
- Vargas, A.; Ocampo, L.; Cespedes, M.; Carreno, N.; Gonzalez, A.; Rojas, A.; Zuluaga, A.; Myers, K.; Fry, W.; Jimenez, P.; et al. Characterization of Phytophthora infestans Populations in Colombia: First Report of the A2 Mating Type. Phytopathology 2009, 99, 82–88. [Google Scholar] [CrossRef]
- Danies, G.; Antolínez, C.; Cantillo, J.; Peña, G.; Vargas, A.; Cárdenas, M.; Bernal, A.; Fry, W.; Restrepo, S. Physalis peruviana responses to Phytophthora infestans are typical of an incompatible interaction. Can. J. Plant Path. 2015, 37, 106–117. [Google Scholar] [CrossRef]
- Haverkort, A.; Boonekamp, P.; Hutten, R.; Jacobsen, E.; Lotz, L.; Kessel, G.; Vossen, J.; Visser, R. Durable Late Blight Resistance in Potato Through Dynamic Varieties Obtained by Cisgenesis: Scientific and Societal Advances in the DuRPh Project. Pot. Res. 2016, 59, 35–66. [Google Scholar] [CrossRef]
- Vleeshouwers, V.; Raffaele, S.; Vossen, J.; Champouret, N.; Oliva, R.; Segretin, M.; Rietman, H.; Cano, L.; Lokossou, A.; Kessel, G.; et al. Understanding and exploiting late blight resistance in the age of effectors. Annu. Rev. Phytopathol. 2011, 49, 507–531. [Google Scholar] [CrossRef]
- Bhattacharjee, S.; Hiller, N.L.; Liolios, K.; Win, J.; Kanneganti, T.D.; Young, C.; Kamoun, S.; Haldar, K. The malarial host-targeting signal is conserved in the Irish potato famine pathogen. PLoS Pathog. 2006, 2, e50. [Google Scholar] [CrossRef]
- Gilroy, E.; Breen, S.; Whisson, S.; Squires, J.; Hein, I.; Kaczmarek, M.; Turnbull, D.; Boevink, P.; Lokossou, A.; Cano, L.; et al. Presence/absence, differential expression and sequence polymorphisms between PiAVR2 and PiAVR2-like in Phytophthora infestans determine virulence on R2 plants. New Phytol. 2011, 191, 763–776. [Google Scholar] [CrossRef] [PubMed]
- Du, Y.; Weide, R.; Zhao, Z.; Msimuko, P.; Govers, F.; Bouwmeester, K. RXLR effector diversity in Phytophthora infestans isolates determines recognition by potato resistance proteins; the case study AVR1 and R1. Stud. Mycol. 2018, 89, 85–93. [Google Scholar] [CrossRef]
- Wang, S.; Welsh, L.; Thorpe, P.; Whisson, S.C.; Boevink, P.C.; Birch, P.R.J. The Phytophthora infestans haustorium is a site for secretion of diverse classes of infection-associated proteins. mBio 2018, 9, e01216-18. [Google Scholar] [CrossRef]
- Aguilera-Galvez, C.; Champouret, N.; Rietman, H.; Lin, X.; Wouters, D.; Chu, Z.; Jones, J.; Vossen, J.; Visser, R.; Wolters, P.; et al. Two different R gene loci co-evolved with Avr2 of Phytophthora infestans and confer distinct resistance specificities in potato. Stud. Mycol. 2018, 89, 105–115. [Google Scholar] [CrossRef] [PubMed]
- Hughes, A.; Friedman, R. Codon-based tests of positive selection, branch lengths, and the evolution of mammalian immune system genes. Immunogenetics 2008, 60, 495–506. [Google Scholar] [CrossRef]
- Yang, Z.; Nielsen, R. Estimating Synonymous and Nonsynonymous Substitution Rates Under Realistic Evolutionary Models. Mol. Biol. Evol. 2000, 17, 32–43. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Li, W. Statistical Tests of Neutrality of Mutations. Genetics 1993, 133, 693–709. [Google Scholar] [PubMed]
- Nei, M.; Gojobori, T. Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 1986, 3, 418–426. [Google Scholar]
- Rohmer, L.; Guttman, D.; Dangl, J. Diverse Evolutionary Mechanisms Shape the Type III Effector Virulence Factor Repertoire in the Plant Pathogen Pseudomonas syringae. Genetics 2004, 167, 1341–1360. [Google Scholar] [CrossRef][Green Version]
- Gladieux, P.; Devier, B.; Aguileta, G.; Cruaud, C.; Giraud, T. Purifying selection after episodes of recurrent adaptive diversification in fungal pathogens. Infect. Genet. Evol. 2013, 17, 123–131. [Google Scholar] [CrossRef]
- Weber, E.; Koebnik, R. Positive Selection of the Hrp Pilin HrpE of the Plant Pathogen Xanthomonas. J. Bacteriol. 2006, 188, 1405–1410. [Google Scholar] [CrossRef] [PubMed]
- Upson, J.L.; Zess, E.K.; Białas, A.; Wu, C.H.; Kamoun, S. The coming of age of EvoMPMI: Evolutionary molecular plant-microbe interactions across multiple timescales. Curr. Opin. Plant Biol. 2018, 44, 108–116. [Google Scholar] [CrossRef]
- Gevers, D.; Vandepoele, K.; Simillion, C.; Van de Peer, Y. Gene duplication and biased functional retention of paralogs in bacterial genomes. Tren. Microb. 2004, 12, 148–154. [Google Scholar] [CrossRef]
- Yan, S.; Liu, H.; Mohr, T.; Jenrette, J.; Chiodini, R.; Zaccardelli, M.; Setubal, J.; Vinatzer, B. Role of recombination in the evolution of the model plant pathogen Pseudomonas syringae pv. tomato DC3000, a very atypical tomato strain. Appl. Environ. Microb. 2008, 74, 3171–3181. [Google Scholar] [CrossRef] [PubMed]
- CIP. Laboratory Manual for P. Infestans Work at CIP-Quito; Centro Internacional de la papa: Quito, Ecuador, 1997; 36p. [Google Scholar]
- Revelo, E.; Dorado, G.; Lagos, L.; Burbano-Figueroa, O. Foliar Virulence of Isolates of Phytophthora Infestans Sensu Lato on Detached Leaves of Two Solanum Betaceum Cultivars. Trop. Plant Pathol. 2011, 36, 367–373. [Google Scholar] [CrossRef]
- Pérez, W.; Gamboa, J.; Falcon, Y.; Coca, M.; Raymundo, R.; Nelson, R. Genetic Structure of Peruvian Populations of Phytophthora infestans. Phytopathology 2001, 91, 956–965. [Google Scholar] [CrossRef] [PubMed]
- Judelson, H. Genetic and Physical Variability at the Mating Type Locus of the Oomycete, P. infestans. Genetics 1996, 144, 1005–1013. [Google Scholar]
- Haas, J.; Kamoun, S.; Zody, M.; Jiang, R.; Handsaker, R.; Cano, L.; Grabherr, M.; Kodira, C.; Raffaele, S.; Torto-Alalibo, T.; et al. Genome sequence and analysis of the Irish potato famine pathogen Phytophthora infestans. Nature 2009, 461, 393–398. [Google Scholar] [CrossRef]
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.; Remm, M.; Rozen, S. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef]
- Hall, T. Bioedit©, Biological Sequence Alignment Editor, versión 7.2.6.1. 2017. Available online: http://www.mbio.ncsu.edu/BioEdit/bioedit.html (accessed on 18 July 2017).
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl. Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Thompson, J.; Higgins, D.; Gibson, T. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Librado, P.; Rozas, J. DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics 2009, 25, 1451–1452. [Google Scholar] [CrossRef] [PubMed]
- Nei, M.; Kumar, S. Molecular Evolution and Phylogenetics; Oxford University Press: Oxford, UK, 2000. [Google Scholar]
- Efron, B.; Halloran, E.; Holmes, S. Bootstrap confidence levels for phylogenetic trees. Proc. Natl. Acad. Sci. USA 1996, 93, 13429–13434. [Google Scholar] [CrossRef]
- Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef]
| Isolate Code/Number | Municipality/Department | Host | Meters Above the Sea Level (masl) | Geographic Coordinates | Physiological Race | Virulence Factors | Reference |
|---|---|---|---|---|---|---|---|
| M1 | La Ceja/Antioquia | Solanum quitoense cv. Castilla | 2152 | NA | NA | NA | Collected in the present work |
| M-1 | La Ceja/Antioquia | Solanum betaceum cv. Común | 2152 | LT 5.940655, LG 75.427367 | NA | NA | Collected in the present work |
| M-2 | La Ceja/Antioquia | Solanum sp. | 2176 | LT 5.946915, LG 75.422601 | NA | NA | Collected in the present work |
| M-3 | La Ceja/Antioquia | Solanum sp. | 2184 | LT. 5.969591, LG. 75.492130 | NA | NA | Collected in the present work |
| M-7 | La Ceja/Antioquia | Solanum quitoense cv. Castilla | 2473 | LT. 5.962374, LG. 75.453905 | NA | NA | Collected in the present work |
| M-8 | La Ceja/Antioquia | Solanum sp | 2390 | NA | NA | NA | Collected in the present work |
| M-9 | La Ceja/Antioquia | Solanum betaceum cv. Común | 2410 | LT. 5.982741, LG. 75444036 | NA | NA | Collected in the present work |
| M-3 | El Peñol/Antioquia | Solanum lycopersicum cv. Chonto | 1976 | NA | NA | NA | Collected in the present work |
| M-10 | Entrerríos/Antioquia | Solanum sp. | 2575 | NA | NA | NA | Collected in the present work |
| OP-1 | Oporapa/Huila | Solanum quitoense cv. Castilla | NA | NA | 4.11 | 2 | [23] |
| OP-2 | Oporapa/Huila | Solanum quitoense cv. Castilla | NA | NA | 1.4.8.11 | 2 | [23] |
| OP-3 | Oporapa/Huila | Solanum quitoense cv. Castilla | NA | NA | 4.8 | 2 | [23] |
| OP-5 | Oporapa/Huila | Solanum quitoense cv. Castilla | NA | NA | 4.8 | 2 | [23] |
| UR-1 | Urrao/Antioquia | Solanum quitoense cv. Sin espinas | NA | NA | 8 | 1 | [23] |
| UR-5 | Urrao/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 0.4.8.11 | 4 | [23] |
| UR-9 | Urrao/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 0.4.8.11 | 4 | [23] |
| UR-18 | Urrao/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 0.4.8 | 3 | [23] |
| UR-24 | Urrao/Antioquia | Solanum quitoense cv. Sin espinas | NA | NA | 0.4.8.11 | 4 | [23] |
| JA-4 | Jardín/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 4.8.11 | 3 | [23] |
| JA-5 | Jardín/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 4.8.10.11 | 4 | [23] |
| JA-6 | Jardín/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 4.8 | 2 | [23] |
| GP-3 | Guatapé/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 4.8 | 2 | [23] |
| ST-1 | Santuario/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 4.8 | 2 | [23] |
| ST-4 | Santuario/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 3.4.8 | 3 | [23] |
| GA-1 | Garzón/Huila | Solanum quitoense cv. Castilla | NA | NA | 4.8 | 2 | [23] |
| MB-1 | Montebello/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 4.8.11 | 3 | [23] |
| VE-1 | Versalles/Valle | Solanum quitoense cv. Castilla | NA | NA | NA | NA | [23] |
| SELVA-2 | Rionegro/Antioquia | Solanum quitoense cv. Castilla | NA | NA | 0.4 | 2 | [23] |
| SR-2 | Santa Rosa/Risaralda | Solanum quitoense cv. Castilla | NA | NA | 4.7.8.11 | 4 | [23] |
| Gene Number | Codon Number | Number of Variable Segregating Sites (Polymorphic) (S) | Total Number of Mutations (Eta) | Number of Haplotypes (h) | Haplotype Diversity (gene) (Hd) | Variance of Haplotype Diversity | Standard Deviation of Haplotype Diversity |
|---|---|---|---|---|---|---|---|
| 08944 | 240 | 52 | 53 | 5 | 0.253 | 0.01076 | 0.104 |
| 12737 | 168 | 16 | 16 | 5 | 0.270 | 0.01188 | 0.109 |
| 17063 | 160 | 6 | 7 | 4 | 0.315 | 0.01165 | 0.108 |
| 06099 | 143 | 6 | 7 | 8 | 0.692 | 0.00557 | 0.075 |
| 15980 | 443 | 3 | 3 | 3 | 0.641 | 0.00936 | 0.097 |
| 23123 * | - | - | - | - | - | - | - |
| GENE | Nucleotide Diversity (Per Site) (Pi) | Sampling Variance of Pi | Standard Deviation of Pi | Average Number of Nucleotide Differences (k) | Theta Per Sequence | Theta Per Site | Number of Non-Synonymous Substitutions |
|---|---|---|---|---|---|---|---|
| 08944 | 0.00488 | 0.0000123 | 0.00351 | 3.53103 | 13.37825 from Eta | 0.01850 from Eta | 21 |
| 12737 | 0.00363 | 0.0000033 | 0.00182 | 1.83862 | 4.11157 from S, Theta-W | 0.00811 from S, Theta-W | 10 |
| 17063 | 0.00188 | 0.0000005 | 0.00071 | 0.90640 | 1.78245 from Eta | 0.00370 from Eta | 2 |
| 06099 | 0.00294 | 0.0000003 | 0.00055 | 1.26882 | 1.75220 from Eta | 0.00406 from Eta | 7 |
| 15980 | 0.00116 | 0.0000000 | 0.00015 | 1.53846 | 0.96674 from S, Theta-W | 0.00073 from S, Theta-W | 2 |
| 23123 * | - | - | - | - | - | - | - |
| Gene | Polymorphic Site (aa) | Amino Acid in Genome Sequence T30-4 * | Substitutions |
|---|---|---|---|
| 06099 | 39 | Q | P |
| 63 | S | RR | |
| 80 | E | Q, K | |
| 153 | K | R | |
| 08944 | 11 | L | S |
| 160 | G | C | |
| 173 | V | X | |
| 182 | X | C | |
| 185 | E | Q | |
| 190 | V | I | |
| 192 | G | D | |
| 202 | P | S | |
| 203 | gap | E | |
| 206 | H | Y | |
| 207 | V | D | |
| 208 | A | V | |
| 209 | P | S | |
| 210 | D | Y | |
| 212 | I | P | |
| 217 | G | T | |
| 219 | R | W | |
| 220 | H | S | |
| 221 | G | P | |
| 222 | A | T | |
| 223 | F | I | |
| 224 | P | L | |
| 228 | W | R | |
| 229 | gap | R | |
| 230 | D | H | |
| 231 | D | K | |
| 232 | C | F | |
| 12737 | 57 | R | E |
| 77 | R | I | |
| 80 | V | L | |
| 94 | V | G | |
| 95 | G | C, V | |
| 99 | M | L | |
| 121 | Y | F | |
| 127 | E | Q | |
| 147 | G | V | |
| 150 | D | N | |
| 15980 | 303 | F | Y |
| 309 | G | R | |
| 17063 | 9 | I | P, S |
| 10 | S | P | |
| 99 | Q | L |
| GENE | Tajima’s D | Fu and Li’s D | Fu and Li’s F | Fu’s Fs | Strobeck’s S |
|---|---|---|---|---|---|
| 08944 | −2.75121. Statistical significance: ***,p< 0.001 | −5.19552. Statistical significance: **,p< 0.02 | −5.18444. Statistical significance: **,p< 0.02 | 3.551 | 0.083. (Probability that NHap <= 5). Probability that [NHap = 5]: 0.056 |
| 12737 | −1.90412. Statistical significance: *, p < 0.05 | −2.09581. Statistical significance: Not significant, 0.10 > p > 0.05 | −2.38643. Statistical significance: Not significant, 0.10 > p > 0.05 | 0.962 | 0.490. (Probability that NHap <= 5). Probability that [NHap = 5]: 0.214 |
| 17063 | −1.46408 Statistical significance: Not significant, p > 0.10 | −0.10632 Statistical significance: Not significant, p > 0.10 | −0.59832 Statistical significance: Not significant, p > 0.10 | 0.133 | 0.716. (Probability that NHap <= 4). Probability that [NHap = 4]: 0.249 |
| 06099 | −0.80876. Statistical significance: Not significant, p > 0.10 | −0.83518. Statistical significance: Not significant, p > 0.10 | −0.96515. Statistical significance: Not significant, p > 0.10 | −2.900 | 0.983. (Probability that NHap <= 8). Probability that [NHap = 8]: 0.035 |
| 15980 | 1.86987. Statistical significance: Not significant, 0.10 > p > 0.05 | 1.08633. Statistical significance: Not significant, p > 0.10 | 1.45939. Statistical significance: Not significant, 0.10 > p > 0.05 | 1.752 | 0.392. (Probability that NHap <= 3). Probability that [NHap = 3]: 0.244 |
| 23123 * | - | - | - | - | - |
| GENE (PITG/Genbank Code Number) | GENE SIZE (bp) | PRIMER SEQUENCE | |
|---|---|---|---|
| 06099, gi|301113030, XM_002998240.1_T30-4_(PITG_06099) | 689 | FW* RV** | ATCTGGCCAGCCATTTGGAA GAACGCAAATGCTAATGACATGGA |
| 08944, gi|301107979, XM_002902941.1_T30-4_(PITG_08944) | 683 | FW RV | TCGGCAATCTGCTTCAAGACAC TTGGCGGACTCTTGCATGTC |
| 12737, gi|301102350, XM_002900083.1 T30-4 (PITG_12737) | 707 | FW RV | TTTTCTCGTCCAACGCCACA TCGACATCGCCCACAATTTC |
| 15980, gi|301097656, XM_002897722.1 T30-4 (PITG_15980) | 1532 | FW RV | GCCACCCAGTAGATTCGCTCA CGCAAGCACGTCCAGCTCTA |
| 17063, XM_002897216.1 T30-4 (PITG_17063) | 683 | FW RV | CGCGCATCAGAAGGTGTTTG CACCGCCCGAAGCAAATTTAT |
| 23123, gi|301093980, XM_002997715.1 T30-4 SCR50 (PITG_23123) | 353 | FW RV | CACCGCAACAACCGAGTCAC AGGACGGATGTGGGGAATCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morales, J.G.; Gaviria, A.E.; Gilchrist, E. Allelic Variation and Selection in Effector Genes of Phytophthora infestans (Mont.) de Bary. Pathogens 2020, 9, 551. https://doi.org/10.3390/pathogens9070551
Morales JG, Gaviria AE, Gilchrist E. Allelic Variation and Selection in Effector Genes of Phytophthora infestans (Mont.) de Bary. Pathogens. 2020; 9(7):551. https://doi.org/10.3390/pathogens9070551
Chicago/Turabian StyleMorales, Juan G., Astrid E. Gaviria, and Elizabeth Gilchrist. 2020. "Allelic Variation and Selection in Effector Genes of Phytophthora infestans (Mont.) de Bary" Pathogens 9, no. 7: 551. https://doi.org/10.3390/pathogens9070551
APA StyleMorales, J. G., Gaviria, A. E., & Gilchrist, E. (2020). Allelic Variation and Selection in Effector Genes of Phytophthora infestans (Mont.) de Bary. Pathogens, 9(7), 551. https://doi.org/10.3390/pathogens9070551

