Dietary Black Soldier Fly (Hermetia illucens)—Dipterose-BSF—Enhanced Zebrafish Innate Immunity Gene Expression and Resistance to Edwardsiella tarda Infection
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. BSF Larvae Extraction
2.2. Dipterose-BSF Isolation and Purification
2.3. RAW264.7 Cell Culture
2.4. NO and Sugar Evaluation
2.5. Experimental Fish
2.6. Preparation of Dipterose-BSF Diet
2.7. Zebrafish mRNA Sequencing and Validation Using qRT-PCR
2.8. Challenge Test
2.9. Statistical Analysis
3. Results
3.1. Transcriptome Analysis Using RNA-Seq after Fish Had Received Dietary Dipterose-BSF
3.2. Differentially Expressed Genes Induced by Dietary Dipterose-BSF
3.3. Gene Ontology Enrichment Analysis of DEGs
3.4. DEG Signaling Pathway Analysis Using KEGG Pathway Analysis
3.5. Immune- and Stress-Related DEG Determination
3.6. RNA-Seq Validation Using qRT-PCR
3.7. qRT-PCR Analysis of Immune- and Stress-Related Genes
3.8. Challenge Test Using E. tarda
4. Discussion
4.1. Immune- and Stress-Related Genes with Their Respective Receptor Alterations Following Dietary Dipterose-BSF Treatment
4.2. Selected Immune- and Stress-Related Gene Alterations Following Dietary Dipterose-BSF Treatment Using qRT-PCR
4.3. Challenge Test
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Choi, W.H.; Yun, J.H.; Chu, J.P.; Chu, K.B. Antibacterial effect of extracts of Hermetia illucens (Diptera: Stratiomyidae) larvae against Gram-negative bacteria. J. Entomol. Res. 2012, 42, 219–226. [Google Scholar] [CrossRef]
- Kim, W.; Bae, S.; Park, K.; Lee, S.; Choi, Y.; Han, S.; Koh, Y. Biochemical characterization of digestive enzymes in the black soldier fly, Hermetia illucens (Diptera: Stratiomyidae). J. Asia Pac. Entomol. 2011, 14, 11–14. [Google Scholar] [CrossRef]
- Diener, S.; Solano, N.M.S.; Gutierrez, F.R.; Zurbrugg, C.; Tockner, K. Biological Treatment of Municipal Organic Waste using Black Soldier Fly Larvae. Waste Biomass Valori. 2011, 2, 357–363. [Google Scholar] [CrossRef]
- Mousavi, S.; Zahedinezhad, S.; Loh, J.Y. A review on insect meals in aquaculture: The immunomodulatory and physiological effects. Int. Aquat. Res. 2020, 12, 100–115. [Google Scholar] [CrossRef]
- Brown, S.E.; Howard, A.; Kasprzak, A.B.; Gordon, K.H.; East, P.D. The discovery and analysis of a diverged family of novel antifungal moricin-like peptides in the wax moth Galler mellonella. Insect Biochem. Mol. Biol. 2008, 38, 201–212. [Google Scholar] [CrossRef]
- Yang, W.; Cheng, T.; Ye, M.; Deng, X.; Yi, H.; Huang, Y.; Tan, X.; Han, D.; Wang, B.; Xiang, Z.; et al. Functional divergence among silkworm antimicrobial peptide paralogs by the activities of recombinant proteins and the induced expression profiles. PLoS ONE 2011, 6, e18109. [Google Scholar] [CrossRef]
- Gasco, L.; Józefiak, A.; Henry, M. Beyond the protein concept: Health aspects of using edible insects on animals. J. Insects Food Feed 2020, 7, 715–741. [Google Scholar] [CrossRef]
- Katayama, N.; Ishikawa, Y.; Takaoki, M.; Yamashita, M.; Nakayama, S.; Kiguchi, K.; Kok, R.; Wada, H.; Mitsuhashi, J.; Space Agriculture Task Force. Entomophagy: A key to space agriculture. ASR 2008, 41, 701–705. [Google Scholar] [CrossRef]
- Sun, Y.; Chang, A.K.; Wen, Z.; Li, Y.; Du, X.; Li, S. Effect of replacing dietary fish meal with silkworm (Bombyx mori L) caterpillar meal on growth and non-specific immunity of sea cucumber Apostichopus japonicus (Selenka). Aquac. Res. 2014, 45, 1246–1252. [Google Scholar] [CrossRef]
- Boonyakida, J.; Nakanishi, T.; Satoh, J.; Shimahara, Y.; Mekata, T.; Park, E.Y. Immunostimulation of shrimp through oral administration of silkworm pupae expressing VP15 against WSSV. Fish Shellfish Immunol. 2022, 128, 157–167. [Google Scholar] [CrossRef]
- Miura, T.; Nishikawa, M.; Otsu, Y.; Ali, M.F.Z.; Hashizume, A.; Miura, C. The effects of silkworm-derived polysaccharide (silkrose) on ectoparasitic infestations in yellowtail (Seriola quinqueradiata) and White Trevally (Pseudocaranx dentex). Fishes 2022, 7, 14. [Google Scholar] [CrossRef]
- Ido, A.; Iwai, T.; Ito, K.; Ohta, T.; Mizushige, T.; Kishida, T.; Miura, C.; Miura, T. Dietary effects of housefly (Musca domestica) (Diptera: Muscidae) pupae on the growth performance and the resistance against bacterial pathogen in red sea bream (Pagrus major) (Perciformes: Sparidae). Appl. Entomol. Zool. 2015, 50, 213–221. [Google Scholar] [CrossRef]
- Li, X.; Rahimnejad, S.; Wang, L.; Lu, K.; Song, K.; Zhang, C. Substituting fish meal with housefly (Musca domestica) maggot meal in diets for bullfrog Rana (Lithobates) catesbeiana: Effects on growth, digestive enzymes activity, antioxidant capacity and gut health. Aquaculture 2019, 499, 295–305. [Google Scholar] [CrossRef]
- Fan, T.; Xiang, J.; Qin, L.; Li, W.; Li, M.; Zou, H.; Song, K.; Wu, S.; Wang, G. Effects of dietary housefly larvae (Musca domestica) on the growth performance, immunity and intestinal microbiota of Chinese soft-shelled turtle (Pelodiscus sinensis). Aquac. Res. 2022, 53, 1862–1872. [Google Scholar] [CrossRef]
- Jeong, S.M.; Khosravi, S.; Mauliasari, I.R.; Lee, B.J.; You, S.G.; Lee, S.M. Nutritional evaluation of cricket, Gryllus bimaculatus, meal as fish meal substitute for oliveflounder, Paralichthys olivaceus, juveniles. J. World Aquac. Soc. 2021, 52, 859–880. [Google Scholar] [CrossRef]
- Fan, K.; Liu, H.; Pei, Z.; Brown, P.B.; Huang, Y. A study of the potential effect of dietary fishmeal replacement with cricket meal (Gryllus bimaculatus) on growth performance, blood health, liver antioxidant activities, intestinal microbiota and immune-related gene expression of juvenile channel catfish. AFST 2023, 295, 115542. [Google Scholar] [CrossRef]
- Henry, M.; Gasco, L.; Piccolo, G.; Fountoulaki, E. Review on the use of insects in the diet of farmed fish: Past and future. AFST 2018, 203, 1–22. [Google Scholar] [CrossRef]
- Ido, A.; Hashizume, A.; Ohta, T.; Takahashi, T.; Miura, C.; Miura, T. Replacement of fish meal by defatted yellow mealworm (Tenebrio molitor) larvae in diet improves growth performance and disease resistance in red seabream (Pargus major). Animals 2019, 9, 100. [Google Scholar] [CrossRef]
- Motte, C.; Rios, A.; Lefebvre, T.; Do, H.; Henry, M.; Jintasataporn, O. Replacing fish meal with defatted insect meal (yellow mealworm Tenebrio molitor) improves the growth and immunity of pacific white shrimp (Litopenaeus vannamei). Animals 2019, 9, 258. [Google Scholar] [CrossRef]
- Shafique, L.; Abdel-Latif, H.M.R.; Hassan, F.-U.; Alagawany, M.; Naiel, M.A.E.; Dawood, M.A.O.; Yilmaz, S.; Liu, Q. The feasibility of using yellow mealworms (Tenebrio molitor): Towards a sustainable aquafeed industry. Animals 2021, 11, 811. [Google Scholar] [CrossRef]
- Xiao, X.; Jin, P.; Zheng, L.; Cai, M.; Yu, Z.; Yu, J.; Zhang, J. Effects of black soldier fly (Hermetia illucens) larvae meal protein as a fishmeal replacement on the growth and immune index of yellow catfish (Pelteobagrus fulvidraco). Aquac. Res. 2018, 49, 1569–1577. [Google Scholar] [CrossRef]
- Chaklader, M.R.; Siddik, M.A.B.; Fotedar, R.; Howieson, J. Insect larvae, Hermetia illucens in poultry by-product meal for barramundi, Lates calcarifer modulates histomorphology, immunity and resistance to Vibrio harveyi. Sci. Rep. 2019, 9, 16703. [Google Scholar] [CrossRef]
- Abdel-Latif, H.M.; Abdel-Tawwab, M.; Khalil, R.H.; Metwally, A.A.; Shakweer, M.S.; Ghetas, H.A.; Khallaf, M.A. Black soldier fly (Hermetia illucens) larvae meal in diets of European seabass: Effects on antioxidative capacity, non-specific immunity, transcriptomic responses, and resistance to the challenge with Vibrio Alginolyticus. Fish Shellfish Immunol. 2021, 114, 207–217. [Google Scholar] [CrossRef]
- Harlystiarini, H.; Mutia, R.; Wibawan, I.W.T.; Astuti, D.A. In vitro antibacterial activity of black soldier fly (Hermetia Illucens) larva extracts against gram-negative bacteria. Bul. Peternak. 2019, 43, 125–129. [Google Scholar] [CrossRef]
- Ali, M.F.Z.; Ohta, T.; Ido, A.; Miura, C.; Miura, T. The dipterose of black soldier fly (Hermetia illucens) induces innate immune response through toll-like receptor pathway in mouse macrophage RAW264.7 cells. Biomolecules 2019, 9, 677. [Google Scholar] [CrossRef]
- Li, P.; Wang, F. Polysaccharides: Candidates of promising vaccine adjuvants. Drug Discov. Ther. 2015, 9, 88–93. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.F.Z.; Kameda, K.; Kondo, F.; Iwai, T.; Kurniawan, R.A.; Ohta, T.; Ido, A.; Takahashi, T.; Miura, C.; Miura, T. Effects of dietary silkrose of Antheraea yamamai on gene expression profiling and disease resistance to Edwardsiella tarda in Japanese medaka (Oryzias latipes). Fish Shellfish Immunol. 2021, 114, 207–217. [Google Scholar] [CrossRef]
- Yan, Z.; Hansson, G.K. Innate immunity, macrophage activation, and atherosclerosis. Immunol. Rev. 2007, 219, 187–203. [Google Scholar] [CrossRef]
- Li, D.; Wu, M. Pattern recognition receptors in health and diseases. Signal Transduct. Target. Ther. 2021, 6, 291. [Google Scholar] [CrossRef]
- Morin-Crini, N.; Lichtfouse, E.; Torri, G.; Crini, G. Fundamentals and Applications of Chitosan. In Sustainable Agriculture Reviews 35; Crini, G., Lichtfouse, E., Eds.; Springer: Cham, Switzerland, 2019; Volume 35, pp. 49–123. [Google Scholar] [CrossRef]
- Marsh, M.B.; Rice, C.D. Development, characterization, and technical applications of a fish lysozyme-specific monoclonal antibody (mAb M24-2). Comp. Immunol. Microbiol. Infect. Dis. 2010, 33, e15–e23. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Luo, X.; Duan, Y.; Yang, W.; Zhang, H.; Li, C.; Zhang, J. Structural elucidation and immunostimulatory activity of polysaccharide isolated by subcritical water extraction from Cordyceps militaris. Carbohydr. Polym. 2017, 10, 794–802. [Google Scholar] [CrossRef]
- Bi, S.; Jing, Y.; Zhou, Q.; Hu, X.; Zhu, J.; Guo, Z.; Song, L.; Yu, R. Structural elucidation and immunostimulatory activity of a new polysaccharide from Cordyceps militaris. Food Funct. 2018, 9, 279–293. [Google Scholar] [CrossRef] [PubMed]
- Hwang, K.C.; Shin, H.Y.; Kim, W.J.; Seo, M.S.; Kim, H. Effects of a high-molecular-weight polysaccharides isolated from korean persimmon on the antioxidant, anti-inflammatory, and antiwrinkle activity. Molecules 2021, 26, 1600. [Google Scholar] [CrossRef]
- Rong, Y.; Yang, R.; Yang, Y.; Wen, Y.; Liu, S.; Li, C.; Hu, Z.; Cheng, X.; Li, W. Structural characterization of an active polysaccharide of longan and evaluation of immunological activity. Carbohydr. Polym. 2019, 213, 247–256. [Google Scholar] [CrossRef] [PubMed]
- Ohta, T.; Ido, A.; Kusano, K.; Miura, C.; Miura, T. A novel polysaccharide in insects activates the innate immune system in mouse macrophage RAW264 cells. PLoS ONE 2014, 9, e114823. [Google Scholar] [CrossRef]
- Ohta, T.; Kusano, K.; Ido, A.; Miura, C.; Miura, T. Silkrose: A novel acidic polysaccharide from the silkmoth that canstimulate the innate immune response. Carbohydr. Polym. 2016, 136, 995–1001. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.F.Z.; Yasin, I.A.; Ohta, T.; Hashizume, A.; Ido, A.; Takahashi, T.; Miura, C.; Miura, T. The silkrose of Bombyx mori effectively prevent vibriosis in penaeid prawns via the activation of innate immunity. Sci. Rep. 2018, 8, 8836. [Google Scholar] [CrossRef]
- Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
- Martin, M. Cutadapt removes adapter sequences from highthroughput sequencing reads. EMBnet J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R.; 1000 Genome Project Data Processing Subgroup. The sequence alignment/map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Liao, Y.; Smyth, G.K.; Shi, W. FeatureCounts: An efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 2014, 30, 923–930. [Google Scholar] [CrossRef]
- Sun, J.; Nishiyama, T.; Shimizu, K.; Kadota, K. TCC: An R package for comparing tag count data with robust normalization strategies. BMC Bioinform. 2013, 14, 219. [Google Scholar] [CrossRef] [PubMed]
- Moulos, P.; Hatzis, P. Systematic integration of RNA-Seq statistical algorithms for accurate detection of differential gene expression patterns. Nucleid Acid Res. 2015, 43, e25. [Google Scholar] [CrossRef]
- Wilkinson, L. ggplot2: Elegant graphic for data analysis by WICKHAM, H. Biometerics 2011, 67, 678–679. [Google Scholar] [CrossRef]
- Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. ClusterProfiler: An R package for comparing biological themes among gene clusters. OMICS 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCΤ method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- McCurley, A.T.; Callard, G.V. Characterization of housekeeping genes in zebrafish: Male-female differences and effects of tissue type, developmental stage and chemical treatment. BMC Mol. Biol. 2008, 9, 102. [Google Scholar] [CrossRef]
- Johnstone, C.; Chavez-Pozo, E. Antigen Presentation and Autophagy in Teleost Adaptive Immunity. Int. J. Mol. Sci. 2022, 23, 4899. [Google Scholar] [CrossRef]
- Wang, T.; Secombes, C.J. The cytokine networks of adaptive immunity in fish. Fish Shellfish Immunol. 2013, 35, 1703–1718. [Google Scholar] [CrossRef]
- Xia, J.; Ge, C.; Yao, H. Antimicrobial peptides from black soldier fly (Hermetia illucens) as potential antimicrobial factors representing an alternative to antibiotics in livestock farming. Animals 2021, 11, 1937. [Google Scholar] [CrossRef]
- Okocha, R.C.; Olatoye, I.O.; Adedeji, O.B. Food safety impacts of antimicrobial use and their residues in aquaculture. Public Health Rev. 2018, 39, 21. [Google Scholar] [CrossRef] [PubMed]
- Čičková, H.; Newton, G.L.; Lacy, R.C.; Kozánek, M. The use of fly larvae for organic waste treatment. Waste Manag. 2015, 35, 68–80. [Google Scholar] [CrossRef]
- Meneguz, M.; Schiavone, A.; Gai, F.; Dama, A.; Lussiana, C.; Renna, M.; Gasco, L. Effect of rearing substrate on growth performance, waste reduction efficiency and chemical composition of black soldier fly (Hermetia illucens) larvae. J. Sci. Food Agric. 2018, 98, 5776–5784. [Google Scholar] [CrossRef] [PubMed]
- Dezfuli, B.S.; Lorenzoni, M.; Carosi, A.; Giari, L.; Bosi, G. Teleost innate immunity, an intricate game between immune cells and parasites of fish organs: Who wins, who loses. Front. Immunol. 2023, 14, 1250835. [Google Scholar] [CrossRef] [PubMed]
- Liao, Z.; Su, J. Progresses on three pattern recognition receptor families (TLRs, RLRs and NLRs) in teleost. Dev. Comp. Immunol. 2021, 122, 104131. [Google Scholar] [CrossRef] [PubMed]
- Aoki, T.; Hikima, J.I.; Hwang, S.D.; Jung, T.S. Innate immunity of finfish: Primordial conservation and function of viral RNA sensors in teleosts. Fish Shellfish Immunol. 2013, 35, 1689–1702. [Google Scholar] [CrossRef] [PubMed]
- Ali, M.F.Z.; Nakahara, S.; Otsu, Y.; Ido, A.; Miura, C.; Miura, T. Effects of functional polysaccharide from silkworm as an immunostimulant on transcriptional profiling and disease resistance in fish. J. Insects Food Feed 2022, 8, 1221–1233. [Google Scholar] [CrossRef]
- Zhuo, H.; Liu, J. Nuclear factor interleukin 3 (NFIL3) participates in regulation of the NF-κB-mediated inflammation and antioxidant system in Litopenaeus vannamei under ammonia-N stress. Fish Shellfish Immunol. 2022, 131, 1192–1205. [Google Scholar] [CrossRef]
- Nehyba, J.; Hrdličková, R.; Burnside, J.; Bose, H.R., Jr. A novel interferon regulatory factor (IRF), IRF-10, has a unique role in immune defense and is induced by the v-rel oncoprotein. Mol. Cell. Biol. 2022, 22, 3942–3957. [Google Scholar] [CrossRef]
- Matsuura, M. Structural modifications of bacterial lipopolysaccharide that facilitate Gram-negative bacteria evasion of host innate immunity. Front. Immunol. 2013, 4, 109. [Google Scholar] [CrossRef]
- Grosche, L.; Knippertz, I.; König, C.; Royzman, D.; Wild, A.B.; Zinser, E.; Sticht, H.; Muller, Y.A.; Steinkasserer, A.; Lechmann, M. The CD83 molecule—An important immune checkpoint. Front. Immunol. 2020, 11, 721. [Google Scholar] [CrossRef]
- Wei, X.; Li, C.; Zhang, Y.; Li, K.; Li, J.; Ai, K.; Li, K.; Zhang, J.; Yang, J. Fish NF-κB couples TCR and IL-17 signals to regulate ancestral T-cell immune response against bacterial infection. FASEB J. 2021, 35, e21457. [Google Scholar] [CrossRef]
- Yang, D.-X.; Yang, M.-J.; Yin, Y.; Kou, T.-S.; Peng, L.-T.; Chen, Z.-G.; Zheng, J.; Peng, B. Serine metabolism tunes immune responses to promote Oreochromis niloticus survival upon Edwardsiella tarda infection. mSystems 2021, 6, e00426-21. [Google Scholar] [CrossRef]
- Hallare, A.V.; Köhler, H.-R.; Triebskorn, R. Developmental toxicity and stress protein responses in zebrafish embryos after exposure to diclofenac and its solvent, DMSO. Chemosphere 2004, 56, 659–666. [Google Scholar] [CrossRef]
- Soliman, A.M.; Barreda, D.R. The acute inflammatory response of teleost fish. Dev. Comp. Immunol. 2023, 146, 104731. [Google Scholar] [CrossRef]
- Sun, C.; Wu, J.; Liu, S.; Li, H.; Zhang, S. Zebrafish CD59 has both bacterial-binding and inhibiting activities. Dev. Comp. Immunol. 2013, 41, 178–188. [Google Scholar] [CrossRef]
- Rodrigues, P.N.S.; Vázquez-Dorado, S.; Neves, J.V.; Wilson, J.M. Dual function of fish hepcidin: Response to experimental iron overload and bacterial infection in sea bass (Dicentrarchus labrax). Dev. Comp. Immunol. 2006, 30, 1156–1167. [Google Scholar] [CrossRef] [PubMed]
- Neves, J.V.; Caldas, C.; Vieira, I.; Ramos, M.F.; Rodrigues, P.N.S. Multiple hepcidins in a teleost fish, Dicentrarchus labrax: Different hepcidins for different roles. J. Immunol. 2015, 195, 2696–2709. [Google Scholar] [CrossRef] [PubMed]
- Correa, R.G.; Tergaonkar, V.; Ng, J.K.; Dubova, I.; Izpisua-Belmonte, J.C.; Verma, I.M. Characterization of NF-κΒ/IκΒ proteins in zebra fish and their involvement in notochord development. Mol. Cell. Biol. 2004, 24, 5257–5268. [Google Scholar] [CrossRef]
- Pahl, H.L. Activators and target genes of Rel/NF-κΒ transcription factors. Oncogene 1999, 18, 6853–6866. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Secombes, C.J. The Function of Fish Cytokines. Biology 2016, 5, 23. [Google Scholar] [CrossRef]
- Wattrus, S.J.; Zon, L.I. Blood in the water: Recent uses of zebrafish to study myeloid biology. Curr. Opin. Hematol. 2021, 28, 43–49. [Google Scholar] [CrossRef]
- Weaver, C.J.; Leung, Y.F.; Suter, D.M. Expression dynamics of NADPH oxidases during early zebrafish development. J. Comp. Neurol. 2016, 524, 2130–2141. [Google Scholar] [CrossRef]
- Chopra, K.; Folkmanaitė, M.; Stockdale, L.; Shathish, V.; Ishibashi, S.; Bergin, R.; Amich, J.; Amaya, E. Duox is the primary NADPH oxidase responsible for ROS production during adult caudal fin regeneration in zebrafish. iScience 2023, 26, 106147. [Google Scholar] [CrossRef]
- Li, K.; Qiu, H.; Yan, J.; Shen, X.; Wei, X.; Duan, M.; Yang, J. The involvement of TNF-α and TNF-β as proinflammatory cytokines in lymphocyte-mediated adaptive immunity of Nile tilapia by initiating apoptosis. Dev. Comp. Immunol. 2021, 115, 103884. [Google Scholar] [CrossRef]
- Machuca, C.; Martínez, Y.M.; Becerril, M.R.; Angulo, C. Yeast β-glucans as fish immunomodulators: A review. Animals 2022, 12, 2154. [Google Scholar] [CrossRef]
- Yu, W.; Yang, Y.; Zhou, Q.; Huang, X.; Huang, Z.; Li, T.; Wu, Q.; Zhou, C.; Ma, Z.; Lin, H. Effects of dietary Astragalus polysaccharides on growth, health and resistance to Vibrio harveyi of Lates calcarifer. Int. J. Biol. Macromol. 2022, 207, 850–858. [Google Scholar] [CrossRef]
- Wu, Y.; Cheng, Y.; Qian, S.; Zhang, W.; Huang, M.; Yang, S.; Fei, H. An evaluation of laminarin additive in the diets of juvenile largemouth bass (Micropterus salmoides): Growth, antioxidant capacity, immune response and intestinal microbiota. Animals 2023, 13, 459. [Google Scholar] [CrossRef]
- Qin, H.; Long, Z.; Ma, J.; Kong, L.; Lin, H.; Zhou, S.; Lin, Y.; Huang, Z.; Liu, L.; Li, Z. Growth performance, digestive capacity and intestinal health of juvenile spotted seabass (Lateolabrax maculatus) fed dietary laminarin supplement. Front. Mar. Sci. 2023, 10, 1242175. [Google Scholar] [CrossRef]







| Materials | Dry Weight (g) |
|---|---|
| Krill meal | 100 |
| Fish meal | 600 |
| Soybean meal | 50 |
| Wheat flour | 93 |
| Feed Thickeners (wheat starch) | 60 |
| Fish oil | 50 |
| Soy lecithin | 10 |
| Vitamin mixture * | 8 |
| Mineral mixture ** | 6 |
| Choline chloride | 1 |
| Sodium dihydrogen phosphate | 6 |
| Potassium dihydrogen phosphate | 6 |
| Calcium lactate | 10 |
| Total | 1000 |
| Primer Name | Primer Sequence | NCBI Accession Number | Efficiency (%) |
|---|---|---|---|
| Hepcidin Fw | TAACGTGTTTCTGGCTGCTG | NM_205583 | 110.4 |
| Hepcidin Rv | GCCTTTATTGCGACAGCATT | ||
| Heme oxygenase 1a Fw | CCACGTCAGAGCTGAAAACA | NM_001127516 | 105.2 |
| Heme oxygenase 1a Rv | CCGAAGAAGTGCTCCAAGTC | ||
| NADPH oxidase 1 Fw | TGCACATCCGCTCTGTTGGA | NM_001102387 | 104.1 |
| NADPH oxidase 1 Rv | AGGCAAATGGGGTCACTCCA | ||
| CD59 Fw | TGATGAAGGTTCTGCTGCTG | NM_001326385 | 120.6 |
| CD59 Rv | GATGCACCTTCGGAAGTAGG | ||
| NFKB2 Fw | AGGAGCCAAAGCAGAGAGGA | XM_005156814.4 | 110.3 |
| NFKB2 Rv | AACCTCCACACGAGCATTGC | ||
| Nfil 3–5 Fw | GAAAACAGGCGGTTTGTCAT | NM_001197058 | 106.2 |
| Nfil 3–5 Rv | AGAGTGCCGAGGTAGGGATT | ||
| Ifit8 Fw | AGAGCTAAAGCAGGCAGGCA | NM_001037565 | 100.2 |
| Ifit8 Rv | GGACACTCGTCCCAGCATCA |
| No. | KEGG ID | Description | p-Value | Count |
|---|---|---|---|---|
| Liver | ||||
| 1 | dre04140 | Autophagy–animal | 8.57 × 10−5 | 20 |
| 2 | dre01232 | Nucleotide metabolism | 0.000339 | 12 |
| 3 | dre03320 | PPAR signaling pathway | 0.001278 | 10 |
| 4 | dre04068 | FoxO signaling pathway | 0.001317 | 15 |
| 5 | dre04141 | Protein processing in endoplasmic reticulum | 0.001396 | 16 |
| Intestine | ||||
| 1 | dre03008 | Ribosome biogenesis in eukaryotes | 5.06 × 10−16 | 22 |
| Gene Name | Gene Symbol | Gene ID | Fold log2 Change (FDR Value) | |
|---|---|---|---|---|
| Liver | Intestine | |||
| Immune-related genes (upregulated) | ||||
| Nuclear factor, interleukin 3 regulated | NFIL3 | ENSDARG00000042977 | NE | 2.549 (0.001) |
| Nuclear factor, interleukin 3 regulated, member 5 | NFIL3-5 | ENSDARG00000094965 | 3.351 (0.009) | 2.961 (0.001) |
| Nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 | NFKB2 | ENSDARG00000038687 | 1.779 (0.003) | 1.703 (0.001) |
| Nuclear receptor subfamily 3, group C, member 1 | NR3C1 | ENSDARG00000025032 | NS | 0.925 (0.041) |
| Nuclear receptor subfamily 2, group C, member 2 | NR2C2 | ENSDARG00000042477 | 1.376 (0.018) | NS |
| TNF receptor-associated factor 4b | TRAF4 | ENSDARG00000038964 | NS | 1.840 (0.002) |
| Tumor necrosis factor, alpha-induced protein 8-like 1 | TNFAIP8L1 | ENSDARG00000086457 | NS | 0.767 (0.045) |
| Tumor protein p53 inducible protein 11a | TP53I11a | ENSDARG00000069430 | 2.972 (0.009) | NS |
| TNF superfamily member 10, like | TNFSF10L | ENSDARG00000004196 | NS | 1.380 (0.006) |
| TNF superfamily member 10 | TNFSF10 | ENSDARG00000057241 | NS | 1.760 (0.008) |
| Microtubule-associated tumor suppressor 1a | MTUS1a | ENSDARG00000071562 | NS | 1.720 (0.002) |
| Filamin A interacting protein 1 | FILIP1 | ENSDARG00000078419 | NS | 2.361 (0.003) |
| Filamin A interacting protein 1 | FILIP1 | ENSDARG00000079634 | 2.092 (0.031) | NS |
| Platelet-derived growth factor alpha polypeptide b | PDGF-b | ENSDARG00000098578 | NS | 1.367 (0.002) |
| Interferon alpha inducible protein 27.3 | IFI27.3 | ENSDARG00000074217 | NS | 1.864 (0.040) |
| BCL2 family apoptosis regulator BOK a | BOKa | ENSDARG00000052129 | NS | 0.958 (0.019) |
| Mitogen-activated protein kinase 14a | MAPK14a | ENSDARG00000000857 | NS | 0.738 (0.029) |
| Mitogen-activated protein kinase 6 | MAPK6 | ENSDARG00000032103 | NS | 0.768 (0.042) |
| Mitogen-activated protein kinase 14b | MAPK14b | ENSDARG00000028721 | 1.405 (0.016) | NS |
| Mitogen-activated protein kinase kinase kinase 5 | MAP3K5 | ENSDARG00000005416 | 1.408 (0.009) | NS |
| Chemokine (C-X-C motif) ligand 18a, duplicate 1 | CXCL18a.1 | ENSDARG00000111840 | NS | 1.397 (0.010) |
| Chemokine (C-X-C motif) receptor 3, tandem duplicate 3 | CXCR3.3 | ENSDARG00000070669 | 1.394 (0.011) | NS |
| Atypical chemokine receptor 4b | ACKR4b | ENSDARG00000040133 | 1.067 (0.037) | NS |
| Thyroid hormone responsive | THRSP | ENSDARG00000099399 | 1.670 (0.017) | 3.028 (0.012) |
| Hepcidin antimicrobial peptide | HAMP | ENSDARG00000102175 | 2.446 (0.017) | 2.835 (0.006) |
| Caspase 6b.1, apoptosis-related cysteine peptidase | CASP6b.1 | ENSDARG00000025608 | NS | 1.273 (0.017) |
| Caspase 6b.2, apoptosis-related cysteine peptidase | CASP6b.2 | ENSDARG00000070368 | NS | 1.997 (0.007) |
| Protein regulator of cytokinesis 1a | PRC1a | ENSDARG00000100918 | NS | 1.888 (0.023) |
| Immunity-related GTPase family, f1 | IRGF1 | ENSDARG00000070774 | 1.805 (0.030) | NS |
| CD83 molecule | CD83 | ENSDARG00000079553 | NS | 1.551 (0.036) |
| Bloodthirsty-related gene family, member 2 | BTR02 | ENSDARG00000052215 | NS | 0.926 (0.036) |
| Bloodthirsty-related gene family, member 25 | BTR25 | ENSDARG00000102018 | NS | 1.387 (0.038) |
| T cell immune regulator 1, ATPase H+ transporting V0 subunit a3b | TCIRG1b | ENSDARG00000105142 | 0.931 (0.037) | NS |
| T cell activation inhibitor, mitochondrial | TCIAM | ENSDARG00000079881 | 1.265 (0.032) | NS |
| Switching B cell complex subunit SWAP70b | SWAP70b | ENSDARG00000057286 | 0.908 (0.034) | NS |
| Serine active site containing 1 | SERAC1 | ENSDARG00000056121 | 1.387 (0.039) | NS |
| Serine/threonine kinase 11 interacting protein | STK11IP | ENSDARG00000070122 | 1.830 (0.004) | NS |
| Coiled-coil serine-rich protein 2 | CCSER2 | ENSDARG00000087749 | 1.609 (0.026) | NS |
| MAPK interacting serine/threonine kinase 1 | MKNK1 | ENSDARG00000018411 | 1.480 (0.035) | NS |
| Serine protease 35 | PRS35 | ENSDARG00000059081 | 4.638 (0.035) | NS |
| EI24 autophagy-associated transmembrane protein | EI24 | ENSDARG00000053840 | 1.543 (0.009) | NS |
| Autophagy related 4A, cysteine peptidase | ATG4A | ENSDARG00000014531 | 0.998 (0.042) | NS |
| NBR1 autophagy cargo receptor a | NBR1a | ENSDARG00000077297 | 1.169 (0.042) | NS |
| Shiftless antiviral inhibitor of ribosomal frameshifting | SHFL | ENSDARG00000052176 | 1.436 (0.043) | NS |
| Leucine-rich repeat containing 8 VRAC subunit A | LRRC8A | ENSDARG00000052155 | 1.443 (0.025) | NS |
| Leucine-rich repeat containing 8 VRAC subunit Db | LRRC8DB | ENSDARG00000103840 | 1.025 (0.031) | NS |
| Leucine-rich repeats and immunoglobulin-like domains 2 | LRIG2 | ENSDARG00000078561 | 1.009 (0.026) | NS |
| Cysteine/histidine-rich 1 | CYHR1 | ENSDARG00000061057 | 1.574 (0.033) | NS |
| Immune-related genes (downregulated) | ||||
| Nuclear receptor corepressor 2 | NCOR2 | ENSDARG00000000966 | NS | −0.814 (0.030) |
| Nuclear receptor subfamily 4, group A, member 2b | NR4a2b | ENSDARG00000044532 | NS | −1.628 (0.035) |
| Tumor necrosis factor receptor superfamily, member 1a | TNFRSF1a | ENSDARG00000018569 | −1.021 (0.043) | NS |
| Fibrinogen-like 2a | FGL2a | ENSDARG00000019861 | −1.070 (0.035) | −1.242 (0.025) |
| Interferon-related developmental regulator 2 | IFRD2 | ENSDARG00000036811 | NS | −1.195 (0.019) |
| Interferon regulatory factor 10 | IRF10 | ENSDARG00000027658 | NS | −0.877 (0.043) |
| Major histocompatibility complex class II DGB gene | MHC-II DGB | ENSDARG00000104635 | −7.597 (0.039) | −11.690 (0.035) |
| RNA polymerase I and III subunit C | POLR1C | ENSDARG00000039400 | NS | −2.010 (0.002) |
| 3′-phosphoadenosine 5′-phosphosulfate synthase 2a | PAPSS2a | ENSDARG00000071021 | NS | −0.778 (0.045) |
| Tetratricopeptide repeat domain 4 | TTC4 | ENSDARG00000044405 | NS | −2.028 (0.001) |
| Thyroglobulin | TG | ENSDARG00000020084 | −8.126 (0.033) | −4.222 (0.001) |
| SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 a | SMARCAD1a | ENSDARG00000014041 | −1.460 (0.038) | NS |
| DEAD (Asp-Glu-Ala-Asp) box polypeptide 4 | DDX4 | ENSDARG00000014373 | −9.133 (0.014) | NS |
| DEAD (Asp-Glu-Ala-Asp) box polypeptide 18 | DDX18 | ENSDARG00000030789 | NS | −1.204 (0.009) |
| DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 | DDX54 | ENSDARG00000105286 | NS | −1.099 (0.019) |
| DEAD-box helicase 24 | DDX 24 | ENSDARG00000104708 | NS | −1.139 (0.018) |
| DEAD-box helicase 31 | DDX31 | ENSDARG00000035507 | NS | −1.357 (0.036) |
| Caspase 22, apoptosis-related cysteine peptidase | CASP22 | ENSDARG00000091926 | NS | −1.072 (0.015) |
| Bloodthirsty-related gene family, member 12 | BTR12 | ENSDARG00000051809 | NS | −1.590 (0.023) |
| Apoptosis inhibitor 5 | API5 | ENSDARG00000033597 | −0.963 (0.034) | −0.734 (0.044) |
| Synovial apoptosis inhibitor 1, synoviolin | SYVN1 | ENSDARG00000017842 | −1.195 (0.031) | NS |
| MAPK-regulated corepressor-interacting protein 2 | MCRIP2 | ENSDARG00000061256 | −0.989 (0.048) | NS |
| Basic leucine zipper and W2 domains 1b | BZW1b | ENSDARG00000099148 | −2.285 (0.002) | −1.930 (0.001) |
| Serine palmitoyltransferase, long chain base subunit 2b | SPTLC2b | ENSDARG00000074287 | −1.777 (0.003) | −1.749 (0.006) |
| Phosphatidylserine synthase 2 | PTDSS2 | ENSDARG00000101018 | −1.154 (0.031) | NS |
| Immunoglobulin superfamily DCC subclass member 4 | IGDCC4 | ENSDARG00000076919 | −0.844 (0.037) | NS |
| Leucine-rich repeat containing 59 | LRRC59 | ENSDARG00000071426 | −2.216 (0.009) | NS |
| Homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like domain member 1 | HERPUD1 | ENSDARG00000024314 | −1.462 (0.017) | NS |
| Stress-related genes (upregulated) | ||||
| Heme oxygenase 1a | HMOX1a | ENSDARG00000027529 | 2.090 (0.046) | 2.287 (0.012) |
| Tet methylcytosine dioxygenase 2 | TET2 | ENSDARG00000076928 | NS | 0.878 (0.036) |
| Hemopexin a | HPXa | ENSDARG00000012609 | NS | 1.624 (0.044) |
| NADPH oxidase 1 | NOX1 | ENSDARG00000087574 | NS | 1.401 (0.046) |
| NADH:ubiquinone oxidoreductase core subunit S2 | NDUFS2 | ENSDARG00000007526 | NS | 0.770 (0.036) |
| Dehydrogenase/reductase (SDR family) member 3b | DHRS3b | ENSDARG00000044803 | NS | 0.929 (0.019) |
| Glutathione S-transferase theta 1b | GSTT1b | ENSDARG00000017388 | NS | 1.248 (0.019) |
| Glutathione S-transferase rho | GSTR | ENSDARG00000042620 | NS | 0.978 (0.035) |
| Pirin | PIR | ENSDARG00000056638 | 1.612 (0.005) | NS |
| Mannosidase, endo-alpha | MANEa | ENSDARG00000001898 | 1.014 (0.019) | 0.835 (0.023) |
| Xanthine dehydrogenase | XDH | ENSDARG00000055240 | 1.096 (0.023) | 1.365 (0.014) |
| Egl-9 family hypoxia-inducible factor 1b | EGLN1B | ENSDARG00000004632 | 1.330 (0.025) | NS |
| Stress-related genes (downregulated) | ||||
| Hypoxia upregulated 1 | HYOU1 | ENSDARG00000013670 | −1.567 (0.044) | −1.388 (0.009) |
| Heat shock protein 4a | HSPA4a | ENSDARG00000004754 | −2.506 (0.004) | −2.130 (0.001) |
| Heat shock protein 5 | HSPA5 | ENSDARG00000103846 | −3.629 (0.005) | −2.133 (0.012) |
| DnaJ heat shock protein family (Hsp40) member C21 | DNAJC21 | ENSDARG00000105195 | −1.899 (0.025) | −2.376 (0.002) |
| DnaJ heat shock protein family (Hsp40) member B1a | DNAJB1a | ENSDARG00000099383 | −2.193 (0.008) | NS |
| DnaJ heat shock protein family (Hsp40) member B1B | DNAJB1b | ENSDARG00000041394 | −2.451 (0.032) | NS |
| DnaJ heat shock protein family (Hsp40) member A1 | DNAJA1 | ENSDARG00000030972 | −2.553 (0.021) | NS |
| HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1 | HSPBP1 | ENSDARG00000102937 | −2.272 (0.003) | −2.241 (0.005) |
| Heat shock cognate 70-kd protein, tandem duplicate 3 | HSP70.3 | ENSDARG00000021924 | −3.265 (0.013) | −4.385 (0.008) |
| Heat shock transcription factor family member 5 | HSF5 | ENSDARG00000104686 | −4.947 (0.025) | NS |
| AHA1, activator of heat shock protein ATPase homolog 1b | AHSA1b | ENSDARG00000100317 | −1.528 (0.023) | −1.050 (0.013) |
| Heat shock protein 90, alpha (cytosolic), class A member 1, tandem duplicate 2 | HSP90aa1.2 | ENSDARG00000024746 | −4.796 (0.004) | −2.299 (0.016) |
| Heat shock protein 9 | HSPA9 | ENSDARG00000003035 | NS | −1.064 (0.018) |
| Nitric oxide-associated 1 | NOA1 | ENSDARG00000102934 | NS | −1.494 (0.022) |
| Butyrobetaine (gamma), 2-oxoglutarate dioxygenase | BBOX1 | ENSDARG00000036135 | NS | −1.166 (0.010) |
| Oxidative stress responsive kinase 1a | OXR1a | ENSDARG00000034189 | NS | −0.801 (0.045) |
| Glutathione S-transferase mu tandem duplicate 3 | GSTM.3 | ENSDARG00000088116 | NS | −1.741 (0.018) |
| Lactase | LCT | ENSDARG00000092404 | NS | −1.564 (0.036) |
| Phosphoenolpyruvate carboxykinase 1 | PCK1 | ENSDARG00000013522 | −3.313 (0.002) | NS |
| Oxoglutarate dehydrogenase | OGDH | ENSDARG00000103428 | −1.670 (0.003) | NS |
| L-threonine dehydrogenase | TDH | ENSDARG00000002745 | −1.328 (0.012) | NS |
| UDP-glucose 6-dehydrogenase | UGDH | ENSDARG00000019838 | −1.367 (0.016) | NS |
| Methylenetetrahydrofolate dehydrogenase | MTHFD2 | ENSDARG00000098646 | −1.600 (0.019) | NS |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nishiguchi, H.; Suryadi, I.B.B.; Ali, M.F.Z.; Miura, C.; Miura, T. Dietary Black Soldier Fly (Hermetia illucens)—Dipterose-BSF—Enhanced Zebrafish Innate Immunity Gene Expression and Resistance to Edwardsiella tarda Infection. Insects 2024, 15, 326. https://doi.org/10.3390/insects15050326
Nishiguchi H, Suryadi IBB, Ali MFZ, Miura C, Miura T. Dietary Black Soldier Fly (Hermetia illucens)—Dipterose-BSF—Enhanced Zebrafish Innate Immunity Gene Expression and Resistance to Edwardsiella tarda Infection. Insects. 2024; 15(5):326. https://doi.org/10.3390/insects15050326
Chicago/Turabian StyleNishiguchi, Haruki, Ibnu Bangkit Bioshina Suryadi, Muhammad Fariz Zahir Ali, Chiemi Miura, and Takeshi Miura. 2024. "Dietary Black Soldier Fly (Hermetia illucens)—Dipterose-BSF—Enhanced Zebrafish Innate Immunity Gene Expression and Resistance to Edwardsiella tarda Infection" Insects 15, no. 5: 326. https://doi.org/10.3390/insects15050326
APA StyleNishiguchi, H., Suryadi, I. B. B., Ali, M. F. Z., Miura, C., & Miura, T. (2024). Dietary Black Soldier Fly (Hermetia illucens)—Dipterose-BSF—Enhanced Zebrafish Innate Immunity Gene Expression and Resistance to Edwardsiella tarda Infection. Insects, 15(5), 326. https://doi.org/10.3390/insects15050326

