Next Article in Journal
Depression, Stress and Anxiety among Women and Men Affected by Recurrent Pregnancy Loss (RPL): A Systematic Review and Meta-Analysis
Next Article in Special Issue
What Do We Know about Surface Proteins of Chicken Parasites Eimeria?
Previous Article in Journal
Efficacy of Convalescent Plasma to Treat Long-Standing COVID-19 in Patients with B-Cell Depletion
Previous Article in Special Issue
Molecular Investigation of Eimeria Species in Broiler Farms in the Province of Vojvodina, Serbia
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11)

by
Shahinaz Taha
1,2,*,
Tran Nguyen-Ho-Bao
1,3,
Lisa Maxi Berberich
1,
Sandra Gawlowska
1,
Arwid Daugschies
1,4 and
Zaida Rentería-Solís
1,4,*
1
Institute of Parasitology, Centre for Infection Medicine, Faculty of Veterinary Medicine, Leipzig University, An den Tierkliniken 35, 04103 Leipzig, Germany
2
Deparment of Preventive Medicine and Veterinary Public Health, Faculty of Veterinary Medicine, University of Khartoum, P.O. Box 32, Shambat 13314, Khartoum North, Sudan
3
Faculty of Veterinary Medicine, College of Agriculture, Can Tho University, Can Tho 900000, Vietnam
4
Albrecht-Daniel-Thaer Institute, Rudolf-Breitscheid-Str. 38, 04463 Größpösna, Germany
*
Authors to whom correspondence should be addressed.
Life 2023, 13(6), 1267; https://doi.org/10.3390/life13061267
Submission received: 24 February 2023 / Revised: 15 May 2023 / Accepted: 27 May 2023 / Published: 27 May 2023
(This article belongs to the Special Issue Eimeria and the Future of Coccidiosis Control)

Abstract

Background: Eimeria acervulina is a frequent intestinal pathogen of chickens, causing economic impact on the poultry industry. Cryptosporidium parvum is a neglected parasite in chickens. However, because of its zoonotic potential, poultry cryptosporidiosis may pose a risk to public health. Little is known about the parasite–host interactions during coinfection with both parasites. In this study, we investigated the possible interactions during in vitro coinfection of E. acervulina and C. parvum in a chicken macrophage cell line (HD11). Methods: HD11 cells were inoculated with E. acervulina and C. parvum sporozoites and incubated 2, 6, 12, 24, and 48 h post infection (hpi). Mono-infections for each parasite were also investigated. Real-time PCR was used to quantify parasite replication. Additionally, macrophage mRNA expression levels of IFN-γ, TNF-α, iNOS, and IL-10 were measured. Results: For both parasites, multiplication was, in most groups, lower in the coinfection group (COIG) compared with mono-infections. However, at 6 hpi, the number of C. parvum copies was higher in co-infections. Intracellular replication started to decrease from 12 hpi onward, and it was almost undetectable by 48 hpi in all groups. Infections resulted in low expression of all cytokines, except at 48 hpi. Conclusions: Infection of avian macrophages with both E. acervulina and C. parvum seemed to hinder intracellular replication for both parasites in comparison to mono-infection. A clear reduction in intracellular parasites from 12 hpi onward details the important role potentially played by macrophages in host control of these parasites.

1. Introduction

Chicken coccidiosis is an intestinal disease caused by the ubiquitous Eimeria genus [1] with significant economic importance for the poultry industry [2]. The disease can range from mild infection to acute enteritis with high mortality. Eimeria sp. infection can predispose to infection by other opportunistic pathogens, such as Clostridium spp., Campylobacter spp., or Salmonella spp. which can exacerbate the clinical condition of the host [3,4,5,6]. Seven Eimeria species are usually associated with chicken coccidiosis [1,7], among which Eimeria (E.) acervulina is one of the most common [7]. E. acervulina infects the upper part of the small intestine (duodenum), and the disease is mostly moderated. However, single E. acervulina infections are not the norm [6,7] and mixed infections with other Eimeria species or bacteria can be fatal [6].
Cryptosporidium (C.) parvum is a zoonotic apicomplexan parasite and a major cause of mild to severe gastrointestinal disease in humans and domestic animals [8,9,10]. It can infect the small intestine of a broad range of species [10,11,12,13], including birds. C. parvum infection in domestic fowl is not very common and occurs mostly as a subclinical condition [12,13,14]. In chicken, Cryptosporidium species predominantly invade the airways (respiratory cryptosporidiosis) and the bursa of Fabricius or cecum (intestinal cryptosporidiosis) [15,16,17]. Although seldom reported, classical small-intestine infections related to C. parvum as seen in mammals can occur in chickens [17,18], and infected birds can shed oocysts in the feces, which could pose a risk for human infection [12,13,19].
One of the first lines of defense against invading pathogens is the innate immune system. Along with heterophils and dendritic cells, macrophages play an imperative role in the inactivation and elimination of avian pathogens [20,21,22]. They achieve this through chemotaxis and phagocytosis, amongst other functions [22]. Additionally, they are uniquely situated at the interface between the innate and adaptative immune responses [22]. The latter is due in part to their antigen-presenting abilities [22]. During eimeriosis, the macrophages not only actively inactivate and destroy Eimeria spp. but also serve to transport sporozoites to the main regions of infection [23,24,25]. C. parvum utilizes mammal macrophages in a similar fashion [26]. Yet, the role of the avian macrophage has not been thoroughly explored in Cryptosporidium spp. infections in birds [27].
C. parvum and E. acervulina are both intracellular parasites that can infect the same site of the small intestine. Moreover, possible coinfections may impact not only parasite invasion and replication, but also, more importantly, the host immune response. The objective of this study was to evaluate possible interplay between both parasites in terms of intracellular replication and immune response activation during coinfection of E. acervulina and C. parvum.

2. Materials and Methods

2.1. Parasite Maintenance, Excystation, and Purification of Sporozoites

E. acervulina oocysts were kindly provided by MSD Animal Health Innovation GmbH (Schwabeheim, Germany). The oocysts were maintained through biannual passages in healthy 11 day old chicks, and sporulated oocysts were purified according to Eckert et al. [28] Purity of the isolate was assessed before and after each passage by multiple PCR assays for seven Eimeria spp. According to Andreopoulou et al. [7]. Finally, sporozoite excystation and purification were carried out following Rentería-Solís et al.’s [29] methodology.
C. parvum oocysts were routinely passaged in neonatal calves; oocyst purification was conducted according to Najdrowski et al. [30]. The C. parvum oocysts were from an in-house isolate belonging to the sub-genotypes IIaA14G1R1 and IIaA15G2R1 [31]. C. parvum sporozoite excystation was performed following the protocol of Berberich [32]. Briefly, C. parvum oocysts were pelleted at 10,000 rpm (9500× g) for 4 min at room temperature (RT) and then placed on ice. They were subsequently pretreated with 1 mL of 5.25% sodium hypochlorite (NaOCl) in cold PBS (1×) and incubated for 5 min on ice. The oocysts were then centrifuged at 10,000 rpm for 4 min at RT. After centrifugation, the supernatant was discarded, and the pellet was washed with PBS (1×) 2–3 times. Afterwards, the oocysts were resuspended in excystation medium consisting of 0.8% sodium taurocholate (Sigma, Steinheim, Germany) dissolved in RPMI 1640 culture medium. Oocysts were then pre-incubated at 15 °C for 1 h, and thereafter incubated at 37 °C with 5% CO2 for 1:30 h. The excystation rate and sporozoite counts were determined using a Neubauer counting chamber (Mediparts, Oberhausen, Germany) for both E. tenella and C. parvum.

2.2. Cell Culture

The chicken macrophage cell line HD11 is an immortalized line originated from chicken bone marrow [33]; the HD11 cells used in this study were kindly provided by the Bio Bank of the German Federal Research Institute for Animal Health, Insel Riems, Germany (Friedrich Löffler Institute, FLI). HD-11 cells were seeded in 24-well plates (5 × 104 cells/well), cultured in RPMI-1640 medium, and supplemented with 8% fetal bovine serum (FBS), 2% chicken serum (CS), 100 IU penicillin, 100 µg/mL streptomycin (ThermoFisher Scientific, Dreieich, Germany), and 2.5 µg/mL amphotericin (Biochrom, Berlin, Germany). Cultures were maintained at 37 °C in 5% CO2 until confluent.

2.3. In Vitro Infection Assay

Confluent HD-11 monolayers (80% to 90% confluency) were infected with C. parvum (2 ×105 sporozoites/well, MOI = 1) and E. acervulina (2 × 105 sporozoites/well, MOI = 1), and then incubated at 41 °C in 5% CO2 for 2, 6, 12, 24, and 48 h. Infections were visualized under a phase-contrast microscope after each timepoint and every 24 h thereafter. Three groups of infection were set for each timepoint: single infection of C. parvum (CPIG), single infection of E. acervulina (EAIG), and coinfection with both C. parvum and E. acervulina (COIG). Additionally, every timepoint included a negative control group consisting of uninfected HD-11 monolayers. All reactions were performed in triplicate. For the 48 h groups, monolayers were washed once with sterile PBS, and fresh medium was added to the wells 24 h post infection (hpi). After each incubation period, cells were trypsinized and centrifuged, and the pellet was used for DNA or RNA purification.

2.4. Quantification of E. acervulina and C. parvum by Real-Time Quantitative PCR (qPCR)

DNA was purified from the pelleted cells using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol. For quantification of E. acervulina, amplification of the SCAR marker gene was conducted as described by Taha et al. [34] using the primers published by Blake et al. [35] (Table 1). Furthermore, replication of C. parvum was estimated using a qPCR assay targeting the HSP70 gene [36]. All reactions were performed on a Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad, Feldkirchen, Germany). Standard curves were generated by serial dilutions of plasmid DNA as previously published [36,37].

2.5. Reverse-Transcriptase and Cytokine mRNA Quantification Using Real-Time PCR

Purification of RNA was performed using the RNeasy kit (Qiagen, Hilden, Germany) following the kit’s instructions. Purified total RNA was DNase-treated (DNase I, RNase-free, Thermo Scientific, Dreieich, Germany), and complementary DNA (cDNA) was synthesized using a RevertAid first-strand cDNA synthesis kit (Thermo Scientific, Dreieich, Germany) as described by the manufacturer. Relative quantification of the following chicken cytokines was performed using SYBR green-based real-time PCR assays as previously published [38,39]: interferon gamma (IFN-γ), inducible nitric oxide synthase (iNOS), interleukin 10 (IL-10), and tumor necrosis factor alpha (TNF-α) (see Table 1). Relative quantification of mRNA was performed using the 2−ΔΔCt method and expressed as n-fold differences. Normalization of Ct values was conducted with primers for the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH).

2.6. Statistical Analysis

Kolmogorov–Smirnov and Shapiro–Wilk normality tests were used to determine the normal distribution of data. A two-way ANOVA test was used for comparison between different timepoints and groups of infection. Differences were considered significant when the p-value was ≤0.05. All statistical analyses were performed using the GraphPad Prism 9.2 software (GraphPad, San Diego, CA, USA).

3. Results

3.1. Quantification of E. acervulina and C. parvum

Monolayer integrity was visually assessed by microscopy at all timepoints. Overall, E. acervulina intracellular multiplication in the single groups (EAIG) was significantly higher (p < 0.0001) than in the coinfection groups (COIG) at all times (Figure 1a). Across the timepoints, E. acervulina copies in EAIG started notably higher than the COIG during the first 2 and 6 hpi. However, they significantly reduced their numbers from 12 hpi onward (24 and 48 hpi).
C. parvum multiplication between single and coinfection groups (CPIG and COIG, respectively) was not significant (p = 0.02381). Nevertheless, multiplication rates were higher in the CPIG than the COIG at all points except at 6 hpi (Figure 1b). Differences between time points, however, were significant for all groups (p < 0.0001) (Figure 1b). Parasite copies gradually decreased with time in the CPIG groups. In the COIG groups, however, the number of C. parvum copies notably increased at 6 hpi. Furthermore, from 12 hpi onward, C. parvum numbers in COIG were significantly reduced in comparison with CPIG (p-value < 0.0001).

3.2. Cytokine Analysis

The mRNA expression levels of four cytokines (Table 1) were measured in both single (EAIG and CPIG) and coinfection groups (COIG) at 2, 6, 12, 24, and 48 hpi by RT-qPCR (Figure 2). No statistically significant differences were found between single infection groups and coinfection groups for all cytokines (p > 0.05). However, there was a significant change across timepoints in the cases of TNF-α and IL-10 (p = 0.0334 and 0.0247, respectively).
TNF-α expression only increased at 48 hpi. The mRNA expression levels in EAIG were lowest at 6 hpi for IFN-γ, TNF-α, and IL-10. Downregulation was solely detected for IFN-γ at 12 hpi and only in EAIG. Likewise, IFN-γ was downregulated in EAIG, as well as in COIG, after 24 hpi. At 48 hpi, all cytokine mRNA levels peaked in almost all infection groups, with the exception of iNOS in the EAIG group (Figure 3).

4. Discussion

We investigated the differences in parasite intracellular multiplication and host-cell cytokine expression between single and coinfections of E. acervulina and C. parvum. Dual infections of Eimeria spp. and Cryptosporidium spp. have been previously reported [18]; however, this is, to our knowledge, the first in vitro coinfection study in avian macrophages.
Zhang et al. [40,41] provided quantitative data during single and coinfection of E. tenella and Toxoplasma gondii in peripheral blood macrophages. E. tenella numbers were constantly reduced at all timepoints examined (2, 6, 12, and 24 hpi) in coinfected cultures [41]. Interestingly, the same authors measured the replication of E. tenella in poultry macrophages at 24, 48, and 72 hpi. In that study, E. tenella levels increased across timepoints, and detection of intracellular meronts was possible [40]. In our study, we did not investigate timepoints beyond 48 hpi. However, the number of parasites in our experiments was significantly reduced from 12 hpi onward. Michael [42] described the structural morphology of chicken macrophages 6 days after infection with E. acervulina. The author only found sporozoites within the macrophages [42]. It appears that E. acervulina simply fails to further develop into merozoites within macrophages, unlike E. tenella.
We detected a decrease in parasite DNA at 12 hpi. This could have been due to phagocytosis or removal of extracellular parasites after cell rupture during washing steps. During visual examination of monolayer integrity, we did not find noticeable damage to the cell structure. Other possible explanations for this discrepancy could be the different immunogenic potentials across Eimeria species [43], or the difference in MOI between studies. We used a lower MOI than Zhang et al., which may have impacted the macrophage response [40,41].
Zhang et al. [41] discovered that the phagocytic activity of the infected macrophages was hindered at 6 hpi for E. tenella infection but not for T. gondii. This could explain the peak in parasite replication we observed at 6 hpi in almost all cohorts of our study; the increment in intracellular E. acervulina at 6 hpi could have been the product of active cell invasion instead of phagocytosis. Moreover, the rapid decrease in parasite numbers after 6 hpi could indicate initiation of effective phagocytosis. However, macrophage phagocytosis was not investigated in our study.
C. parvum has the capacity to proliferate in mammal macrophages during in vitro infections [26,44]. Martinez et al. [26] were able to observe intracellular type I and II meronts of C. parvum in mouse macrophages at 24, 48, and 72 hpi. To the best of our current knowledge, no studies have previously been published that focused on intracellular mono- or coinfection dynamics of Cryptosporidium spp. in avian macrophages. In our study, coinfection with C. parvum and E. acervulina seemed to reduce the number of intracellular parasites for both species, except for C. parvum at 6 hpi in which coinfection showed a larger number of parasites than in the mono-infection. This was not the case for previous reports using E. tenella as a model, in which E. tenella showed a numeric advantage during coinfections of macrophages with T. gondii in comparison with single infections [40,41].
In addition to phagocytosis or their role as vehicles to infection sites [24,25,26,41], macrophages are also expert triggers of immune response, thanks in part to their ability to express cytokines [22]. For this study, we measured the expression levels of a cytokine involved in the inhibition of parasite replication in both E. acervulina and C. parvum: IFN-γ [42,43,44]. In our study, IFN-γ was only expressed at 48 hpi with very mild expression in the E. acervulina single infection, whereas the highest values were recorded in the coinfection and the C. parvum mono-infection. According to Dallout et al. [43], IFN-γ was not expressed in E. acervulina-infected macrophages during the first 48 hpi. In the present study, 48 hpi was also the timepoint with the lowest parasite replication, which could be explained by the possible role of IFN-γ in hindering E. acervulina and C. parvum intracellular multiplication. Additionally, IL-10 expression levels peaked at 48 hpi in all groups and were their lowest at 2 and 6 hpi. Given the regulatory activity of IL-10 against IFN-γ and previous data from E. acervulina in vivo infections [45], the low levels of IFN-γ mRNA in most groups could be explained by the continuous expression of IL-10 across infections and timepoints. iNOS was continuously expressed across all infection settings and timepoints. Interestingly, iNOS was continuously expressed with fold change values >1.5 for all groups and timepoints. Similar results were obtained in most groups for TNF-α, a known promoter of iNOS [46], which could explain the continuous presence of the latter, except at 2 hpi, when TNF-α expression was downregulated. These discrepancies could be further elucidated using proteomic methods. Furthermore, macrophage in vitro replication ability or cell viability during infection were not studied in this project but could be of importance for future investigations. This could help to elucidate possible hampering of macrophage function. Lastly, while in vitro models are an important tool for infection research, replication of our results in an in vivo model can be of significance, as applied in previous examples with other coinfections such as Toxoplasma gondii and Eimeria tenella [47].

5. Conclusions

Both E. acervulina and C. parvum gradually reduced their intracellular presence under the conditions of this study, which suggests an active role of macrophages in parasite control. Coinfection with both parasites seemed to affect their multiplication. We also replicated a previously reported inhibition in phagocytosis at 6 hpi for other apicomplexan parasites. Competition of different parasites for intracellular resources might play a role in parasite replication and should be further studied. Since coinfection with various species of the genus Eimeria and with other avian Cryptosporidium spp. may occur under natural conditions, coinfection studies deserve more attention.

Author Contributions

S.T., conceptualization, formal analysis, investigation, methodology, data curation, validation, visualization, writing—original draft, and writing—review & editing; T.N.-H.-B., formal analysis, investigation, methodology, and data curation; L.M.B., methodology and investigation; S.G., methodology and investigation; A.D., supervision, resources, funding acquisition, and writing—review & editing; Z.R.-S., conceptualization, project administration, methodology, resources, supervision, funding acquisition, writing—original draft, and writing—review & editing. All authors have read and agreed to the published version of the manuscript.

Funding

This work was partially funded by the University of Leipzig, Flexible Funds Program for Junior Researchers (Project no. 43700897, grant for Z. Rentería-Solís). The Sudanese Ministry of Higher Education and Scientific Research provided financial aid to S. Taha, and T. Nguyen-Ho-Bao was supported by the Vietnamese Government Scholarship. Article processing charges were covered thanks to the support of the Open-Access Publishing Fund Program from Leipzig University. The funding institutions had no role in this study.

Institutional Review Board Statement

All animal study protocols were approved by the local authorities (Landesdirektion Leipzig): animal permit number A04/19, date of approval 23 January 2019; permit number A06/19, date of approval 10 April 2019.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors are grateful to Mathias Lenk and the Bio Bank of the German Federal Research Institute for Animal Health for providing cell lines. The authors are also thankful to Ronald Schmäschke (Institute of Parasitology, Leipzig University) for his valuable help with the preparation of animal permits. The authors also thank Britta Beck and Thomas Grochow (Institute of Parasitology and Institute of Veterinary Anatomy, Leipzig University), as well as Manuela Kirchner, Lea Murnik, and Nadine Roßner (Institute of Parasitology, Leipzig University), for their valuable assistance during E. acervulina and C. parvum in vivo passage. The authors are also grateful to Marion Fritsche and Beate Schneidewind (Institute of Parasitology, University of Leipzig) for their excellent work as animal keepers.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. López-Osorio, S.; Chaparro-Gutiérrez, J.J.; Gómez-Osorio, L.M. Overview of Poultry Eimeria Life Cycle and Host-Parasite Interactions. Front. Vet. Sci. 2020, 7, 384. [Google Scholar] [CrossRef] [Scilit]
  2. Blake, D.P.; Knox, J.; Dehaeck, B.; Huntington, B.; Rathinam, T.; Ravipati, V.; Ayoade, S.; Gilbert, W.; Adebambo, A.O.; Jatau, I.D.; et al. Re-Calculating the Cost of Coccidiosis in Chickens. Vet. Res. 2020, 51, 115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Collier, C.T.; Hofacre, C.L.; Payne, A.M.; Anderson, D.B.; Kaiser, P.; Mackie, R.I.; Gaskins, H.R. Coccidia-Induced Mucogenesis Promotes the Onset of Necrotic Enteritis by Supporting Clostridium Perfringens Growth. Vet. Immunol. Immunopathol. 2008, 122, 104–115. [Google Scholar] [CrossRef] [Scilit]
  4. Macdonald, S.E.; van Diemen, P.M.; Martineau, H.; Stevens, M.P.; Tomley, F.M.; Stabler, R.A.; Blake, D.P. Impact of Eimeria tenella Coinfection on Campylobacter jejuni Colonization of the Chicken. Infect. Immun. 2019, 87, e00772-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Baba, E.; Furata, T.; Arakawa, A. Establishment and Persistence of Salmonella Typhimurium Infection Stimulated by Eimeria tenella in Chickens. Res. Vet. Sci. 1982, 33, 95–98. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Hauck, R. Interactions between Parasites and the Bacterial Microbiota of Chickens. Avian Dis. 2017, 61, 428–436. [Google Scholar] [CrossRef] [Scilit]
  7. Andreopoulou, M.; Chaligiannis, I.; Sotiraki, S.; Daugschies, A.; Bangoura, B. Prevalence and Molecular Detection of Eimeria Species in Different Types of Poultry in Greece and Associated Risk Factors. Parasitol. Res. 2022, 121, 2051–2063. [Google Scholar] [CrossRef] [Scilit]
  8. Delling, C.; Daugschies, A. Literature Review: Coinfection in Young Ruminant Livestock—Cryptosporidium spp. and Its Companions. Pathogens 2022, 11, 103. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Ryan, U.; Fayer, R.; Xiao, L. Cryptosporidium Species in Humans and Animals: Current Understanding and Research Needs. Parasitology 2014, 141, 1667–1685. [Google Scholar] [CrossRef] [Scilit]
  10. Zaheer, T.; Imran, M.; Abbas, R.Z.; Zaheer, I.; Malik, M.A. Avian Cryptosporidiosis and Its Zoonotic Significance in Asia. World’s Poult. Sci. J. 2021, 77, 55–70. [Google Scholar] [CrossRef] [Scilit]
  11. Zhao, W.; Zhou, H.; Ma, T.; Cao, J.; Lu, G.; Shen, Y. PCR-Based Detection of Cryptosporidium spp. and Enterocytozoon bieneusi in Farm-Raised and Free-Ranging Geese (Anser anser f. domestica) From Hainan Province of China: Natural Infection Rate and the Species or Genotype Distribution. Front. Cell. Infect. Microbiol. 2019, 9, 416. [Google Scholar] [CrossRef] [Scilit]
  12. Kabir, M.H.B.; Han, Y.; Lee, S.-H.; Nugraha, A.B.; Recuenco, F.; Murakoshi, F.; Xuan, X.; Kato, K. Prevalence and Molecular Characterization of Cryptosporidium Species in Poultry in Bangladesh. One Health 2020, 9, 100122. [Google Scholar] [CrossRef] [Scilit]
  13. Helmy, Y.A.; Krücken, J.; Abdelwhab, E.-S.M.; von Samson-Himmelstjerna, G.; Hafez, H.M. Molecular Diagnosis and Characterization of Cryptosporidium spp. in Turkeys and Chickens in Germany Reveals Evidence for Previously Undetected Parasite Species. PLoS ONE 2017, 12, e0177150. [Google Scholar] [CrossRef] [Scilit]
  14. McEvoy, J.M.; Giddings, C.W. Cryptosporidium in Commercially Produced Turkeys on-Farm and Postslaughter. Lett. Appl. Microbiol. 2009, 48, 302–306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Lindsay, D.S.; Blagburn, B.L.; Ernest, J.A. Experimental Cryptosporidium parvum Infections in Chickens. J. Parasitol. 1987, 73, 242. [Google Scholar] [CrossRef] [Scilit]
  16. Goodwin, M.A.; Brown, J.; Fletcher, O.J. The Relationship of Cryptosporidium sp. Infection of the Bursa of Fabricius, Intestinal Tract, and Respiratory System of Chickens in Georgia, 1974-1988. Avian Dis. 1990, 34, 701. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Goodwin, M.A.; Brown, J. Intestinal Cryptosporidiosis in Chickens. Avian Dis. 1989, 33, 770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Goodwin, M.A. Small-Intestinal Cryptosporidiosis in a Chicken. Avian Dis. 1988, 32, 844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Bomfim, T.C.B. The Importance of Poultry in Environmental Dissemination of Cryptosporidium spp. Open Vet. Sci. J. 2013, 7, 12–17. [Google Scholar] [CrossRef] [Scilit]
  20. Laurent, F.; Lacroix-Lamandé, S. Innate Immune Responses Play a Key Role in Controlling Infection of the Intestinal Epithelium by Cryptosporidium. Int. J. Parasitol. 2017, 47, 711–721. [Google Scholar] [CrossRef] [Scilit]
  21. Cornelissen, J.B.W.J.; Swinkels, W.J.C.; Boersma, W.A.; Rebel, J.M.J. Host Response to Simultaneous Infections with Eimeria acervulina, maxima and tenella: A Cumulation of Single Responses. Vet. Parasitol. 2009, 162, 58–66. [Google Scholar] [CrossRef] [Scilit]
  22. Qureshi, M. Avian Macrophage and Immune Response: An Overview. Poult. Sci. 2003, 82, 691–698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Van Doorninck, W.M.; Becker, E.R. Transport of Sporozoites of Eimeria necatrix in Macrophages. J. Parasitol. 1957, 43, 40–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Trout, J.M.; Lillehoi, H.S. Evidence of a Role for Intestinal CD8+ Lymphocytes and Macrophages in Transport of Eimeria acervulina Sporozoites. J. Parasitol. 1993, 79, 790–792. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Long, P.L.; Rose, M.E. Growth of Eimeria tenella in Vitro in Macrophages from Chicken Peritoneal Exudates. Z. Parasitenk. 1976, 48, 291–294. [Google Scholar] [CrossRef] [Scilit]
  26. Martinez, F.; Mascaro, C.; Rosales, M.J.; Diaz, J.; Cifuentes, J.; Osuna, A. In Vitro Multiplication of Cryptosporidium parvum in Mouse Peritoneal Macrophages. Vet. Parasitol. 1992, 42, 27–31. [Google Scholar] [CrossRef] [Scilit]
  27. McDonald, V.; Korbel, D.S.; Barakat, F.M.; Choudhry, N.; Petry, F. Innate Immune Responses against Cryptosporidium parvum Infection. Parasite Immunol. 2013, 35, 55–64. [Google Scholar] [CrossRef] [Scilit]
  28. Eckert, J. (Ed.) Guidelines on Techniques in Coccidiosis Research: COST 89/820-Biotechnology; EUR; Office for Official Publications of the European Communities: Luxembourg, 1995; ISBN 978-92-827-4970-8. [Google Scholar]
  29. Rentería-Solís, Z.; Zhang, R.; Taha, S.; Daugschies, A. A Modified Method for Purification of Eimeria tenella Sporozoites. Parasitol. Res. 2020, 119, 1429–1432. [Google Scholar] [CrossRef] [Scilit]
  30. Najdrowski, M.; Joachim, A.; Daugschies, A. An Improved in Vitro Infection Model for Viability Testing of Cryptosporidium parvum Oocysts. Vet. Parasitol. 2007, 150, 150–154. [Google Scholar] [CrossRef] [Scilit]
  31. Dettwiler, I.; Troell, K.; Robinson, G.; Chalmers, R.M.; Basso, W.; Rentería-Solís, Z.M.; Daugschies, A.; Mühlethaler, K.; Dale, M.I.; Basapathi Raghavendra, J.; et al. TIDE Analysis of Cryptosporidium Infections by Gp60 Typing Reveals Obscured Mixed Infections. J. Infect. Dis. 2022, 225, 686–695. [Google Scholar] [CrossRef] [Scilit]
  32. Berberich, L.M. Studies to Improve in Vitro Transfection and Infection Methods of Cryptosporidium parvum and Biological Characterization of the Putative Virulence Factor Thrombospondin-Related Adhesive Protein (Trap-C1); Universität Leipzig: Leipzig, Germany, 2021. [Google Scholar]
  33. Beug, H.; von Kirchbach, A.; Döderlein, G.; Conscience, J.-F.; Graf, T. Chicken Hematopoietic Cells Transformed by Seven Strains of Defective Avian Leukemia Viruses Display Three Distinct Phenotypes of Differentiation. Cell 1979, 18, 375–390. [Google Scholar] [CrossRef] [Scilit]
  34. Taha, S.; Nguyen-Ho-Bao, T.; Daugschies, A.; Rentería-Solís, Z. In Vitro Infection of Madin-Darby Bovine Kidney (MDBK) Cells with Eimeria acervulina Sporozoites: Quantitative Analysis of Parasite Cellular Invasion and Replication Using Real-Time Polymerase Chain Reaction (PCR). Parasitol. Res. 2021, 120, 2689–2693. [Google Scholar] [CrossRef] [Scilit]
  35. Blake, D.P.; Qin, Z.; Cai, J.; Smith, A.L. Development and Validation of Real-Time Polymerase Chain Reaction Assays Specific to Four Species of Eimeria. Avian Pathol. 2008, 37, 89–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Shahiduzzaman, M.; Dyachenko, V.; Obwaller, A.; Unglaube, S.; Daugschies, A. Combination of Cell Culture and Quantitative PCR for Screening of Drugs against Cryptosporidium parvum. Vet. Parasitol. 2009, 162, 271–277. [Google Scholar] [CrossRef] [Scilit]
  37. Thabet, A.; Alnassan, A.A.; Daugschies, A.; Bangoura, B. Combination of Cell Culture and QPCR to Assess the Efficacy of Different Anticoccidials on Eimeria tenella Sporozoites. Parasitol. Res. 2015, 114, 2155–2163. [Google Scholar] [CrossRef] [Scilit]
  38. Park, S.S.; Lillehoj, H.S.; Allen, P.C.; Park, D.W.; FitzCoy, S.; Bautista, D.A.; Lillehoj, E.P. Immunopathology and Cytokine Responses in Broiler Chickens Coinfected with Eimeria maxima and Clostridium perfringens with the Use of an Animal Model of Necrotic Enteritis. Avian Dis. 2008, 52, 14–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Nang, N.T.; Lee, J.S.; Song, B.M.; Kang, Y.M.; Kim, H.S.; Seo, S.H. Induction of Inflammatory Cytokines and Toll-like Receptors in Chickens Infected with Avian H9N2 Influenza Virus. Vet. Res. 2011, 42, 64. [Google Scholar] [CrossRef] [Scilit]
  40. Zhang, R.; Thabet, A.; Hiob, L.; Zheng, W.; Daugschies, A.; Bangoura, B. Mutual Interactions of the Apicomplexan Parasites Toxoplasma Gondii and Eimeria tenella with Cultured Poultry Macrophages. Parasites Vectors 2018, 11, 453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  41. Zhang, R.; Zheng, W.; Daugschies, A.; Bangoura, B. Apicomplexan Co-Infections Impair with Phagocytic Activity in Avian Macrophages. Parasitol. Res. 2020, 119, 4159–4168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Michael, E. Sporozoites of Eimeria acervulina within Intestinal Macrophages in Normal Experimental Infections: An Ultrastructural Study. Z. F. Parasitenkd. 1976, 49, 33–40. [Google Scholar] [CrossRef] [Scilit]
  43. Dalloul, R.A.; Bliss, T.W.; Hong, Y.-H.; Ben-Chouikha, I.; Park, D.W.; Keeler, C.L.; Lillehoj, H.S. Unique Responses of the Avian Macrophage to Different Species of Eimeria. Mol. Immunol. 2007, 44, 558–566. [Google Scholar] [CrossRef] [Scilit]
  44. Martinez, F.; Rosales, M.J.; Diaz, J.; Mascaro, C. The Effects of IFN-γ Activated Mouse Peritoneal and Alveolar Macrophages on Cryptosporidium parvum Development. Vet. Parasitol. 1997, 68, 305–308. [Google Scholar] [CrossRef] [Scilit]
  45. Hong, Y.H.; Lillehoj, H.S.; Lee, S.H.; Dalloul, R.A.; Lillehoj, E.P. Analysis of Chicken Cytokine and Chemokine Gene Expression Following Eimeria acervulina and Eimeria tenella Infections. Vet. Immunol. Immunopathol. 2006, 114, 209–223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Lillehoj, H.S.; Li, G. Nitric Oxide Production by Macrophages Stimulated with Coccidia Sporozoites, Lipopolysaccharide, or Interferon-γ, and Its Dynamic Changes in SC and TK Strains of Chickens Infected with Eimeria tenella. Avian Dis. 2004, 48, 244–253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Hiob, L.; Koethe, M.; Schares, G.; Goroll, T.; Daugschies, A.; Bangoura, B. Experimental Toxoplasma Gondii and Eimeria tenella Co-Infection in Chickens. Parasitol. Res. 2017, 116, 3189–3203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Quantification of intracellular parasites at different time points. (a) Quantification of E. acervulina DNA copies in single E. acervulina infection groups (EAIG) and coinfection (E. acervulina and C. parvum) groups (COIG). (b) Quantification of C. parvum DNA copies in single (CPIG) and coinfection (COIG) groups. Timepoints: 2, 6, 12, 24, and 48 hpi (order of the timepoint bars in the graphs, from left to right: 2 hpi, 6 hpi, 12 hpi, 24 hpi, and 48 hpi). *** p < 0.0001.
Figure 1. Quantification of intracellular parasites at different time points. (a) Quantification of E. acervulina DNA copies in single E. acervulina infection groups (EAIG) and coinfection (E. acervulina and C. parvum) groups (COIG). (b) Quantification of C. parvum DNA copies in single (CPIG) and coinfection (COIG) groups. Timepoints: 2, 6, 12, 24, and 48 hpi (order of the timepoint bars in the graphs, from left to right: 2 hpi, 6 hpi, 12 hpi, 24 hpi, and 48 hpi). *** p < 0.0001.
Life 13 01267 g001
Figure 2. Modulation of the expression of INF-γ and TNF-α in HD11 cells during coinfection (COIG) and single infection (EAIG and CPIG), presented as fold changes of values recorded in uninfected controls at 2, 6, 12, 24, and 48 hpi (order from left to right); * p < 0.05.
Figure 2. Modulation of the expression of INF-γ and TNF-α in HD11 cells during coinfection (COIG) and single infection (EAIG and CPIG), presented as fold changes of values recorded in uninfected controls at 2, 6, 12, 24, and 48 hpi (order from left to right); * p < 0.05.
Life 13 01267 g002
Figure 3. Modulation of the expression of INOS and IL-10 in HD11 cells during coinfection (COIG) and single infection (EAIG and CPIG), presented as fold changes of values recorded in uninfected controls at 2, 6, 12, 24, and 48 hpi (order of timepoint bars on the graphs, from left to right: 2 hpi, 6 hpi, 12 hpi, 24 hpi, and 48 hpi); * p < 0.05.
Figure 3. Modulation of the expression of INOS and IL-10 in HD11 cells during coinfection (COIG) and single infection (EAIG and CPIG), presented as fold changes of values recorded in uninfected controls at 2, 6, 12, 24, and 48 hpi (order of timepoint bars on the graphs, from left to right: 2 hpi, 6 hpi, 12 hpi, 24 hpi, and 48 hpi); * p < 0.05.
Life 13 01267 g003
Table 1. Sequences of primers used in this study.
Table 1. Sequences of primers used in this study.
Oligonucleotide IdentityPrimer Name, Primer Sequence (5′ to 3′)Product Size (bp)References
E. acervulina SCAR marker forwardEac_qPCRf, CTC GCG TGT CAG CAC TAC AT124[35]
E. acervulina SCAR marker reverseEac_qPCRr, GAT AGC GTG CTT TGC CTT TC [35]
C. parvum HSP70 forwardCp_HSP70_f, AACTTTAGCTCCAGTTGAGAAAGTACTC143[36]
C. parvum HSP70 reverseCp_HSP70_r, CATGGCTCTTTACCGTTAAAGAATTCC [36]
C. parvum HSP70 Taqman probeHSP_70_SNA, AATACGTGTAGAACCACCAACCAATACAACATC [36]
Gallus domesticus GAPDH forwardchicken_DAPDH_f, GGTGGTGCTAAGCGTGTTAT264[38]
Gallus domesticus GAPDH reversechicken_DAPDH_r, ACCTCTGTCATCTCTCCACA [38]
Gallus domesticus IFN-γ forwardchicken_INF-γ_f, AGCTGACGGTGGACCTATTATT259[38]
Gallus domesticus IFN-γ reversechicken_INF-γ_r, GGCTTTGCGCTGGATTC [38]
Gallus domesticus iNOS forwardchicken_iNOS_f, TGGGTGGAAGCCGAAATA241[38]
Gallus domesticus iNOS reversechicken_iNOS_r, GTACCAGCCGTTGAAAGGAC [38]
Gallus domesticus IL-10 forwardchicken_IL-10_f, CGGGAGCTGAGGGTGAA272[38]
Gallus domesticus IL-10 reversechicken_IL-10_r, GTGAAGAAGCGGTGACAGC [38]
Gallus domesticus TNF-α forwardchicken_TNF- α_f, CTTCTGAGGCATTTGGAAGC380[39]
Gallus domesticus TNF-α reversechicken_TNF- α_r, ACTGGGCGGTCATAGAACAG [39]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Taha, S.; Nguyen-Ho-Bao, T.; Berberich, L.M.; Gawlowska, S.; Daugschies, A.; Rentería-Solís, Z. Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11). Life 2023, 13, 1267. https://doi.org/10.3390/life13061267

AMA Style

Taha S, Nguyen-Ho-Bao T, Berberich LM, Gawlowska S, Daugschies A, Rentería-Solís Z. Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11). Life. 2023; 13(6):1267. https://doi.org/10.3390/life13061267

Chicago/Turabian Style

Taha, Shahinaz, Tran Nguyen-Ho-Bao, Lisa Maxi Berberich, Sandra Gawlowska, Arwid Daugschies, and Zaida Rentería-Solís. 2023. "Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11)" Life 13, no. 6: 1267. https://doi.org/10.3390/life13061267

APA Style

Taha, S., Nguyen-Ho-Bao, T., Berberich, L. M., Gawlowska, S., Daugschies, A., & Rentería-Solís, Z. (2023). Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11). Life, 13(6), 1267. https://doi.org/10.3390/life13061267

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop