Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Parasite Maintenance, Excystation, and Purification of Sporozoites
2.2. Cell Culture
2.3. In Vitro Infection Assay
2.4. Quantification of E. acervulina and C. parvum by Real-Time Quantitative PCR (qPCR)
2.5. Reverse-Transcriptase and Cytokine mRNA Quantification Using Real-Time PCR
2.6. Statistical Analysis
3. Results
3.1. Quantification of E. acervulina and C. parvum
3.2. Cytokine Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- López-Osorio, S.; Chaparro-Gutiérrez, J.J.; Gómez-Osorio, L.M. Overview of Poultry Eimeria Life Cycle and Host-Parasite Interactions. Front. Vet. Sci. 2020, 7, 384. [Google Scholar] [CrossRef]
- Blake, D.P.; Knox, J.; Dehaeck, B.; Huntington, B.; Rathinam, T.; Ravipati, V.; Ayoade, S.; Gilbert, W.; Adebambo, A.O.; Jatau, I.D.; et al. Re-Calculating the Cost of Coccidiosis in Chickens. Vet. Res. 2020, 51, 115. [Google Scholar] [CrossRef] [PubMed]
- Collier, C.T.; Hofacre, C.L.; Payne, A.M.; Anderson, D.B.; Kaiser, P.; Mackie, R.I.; Gaskins, H.R. Coccidia-Induced Mucogenesis Promotes the Onset of Necrotic Enteritis by Supporting Clostridium Perfringens Growth. Vet. Immunol. Immunopathol. 2008, 122, 104–115. [Google Scholar] [CrossRef]
- Macdonald, S.E.; van Diemen, P.M.; Martineau, H.; Stevens, M.P.; Tomley, F.M.; Stabler, R.A.; Blake, D.P. Impact of Eimeria tenella Coinfection on Campylobacter jejuni Colonization of the Chicken. Infect. Immun. 2019, 87, e00772-18. [Google Scholar] [CrossRef] [PubMed]
- Baba, E.; Furata, T.; Arakawa, A. Establishment and Persistence of Salmonella Typhimurium Infection Stimulated by Eimeria tenella in Chickens. Res. Vet. Sci. 1982, 33, 95–98. [Google Scholar] [CrossRef] [PubMed]
- Hauck, R. Interactions between Parasites and the Bacterial Microbiota of Chickens. Avian Dis. 2017, 61, 428–436. [Google Scholar] [CrossRef]
- Andreopoulou, M.; Chaligiannis, I.; Sotiraki, S.; Daugschies, A.; Bangoura, B. Prevalence and Molecular Detection of Eimeria Species in Different Types of Poultry in Greece and Associated Risk Factors. Parasitol. Res. 2022, 121, 2051–2063. [Google Scholar] [CrossRef]
- Delling, C.; Daugschies, A. Literature Review: Coinfection in Young Ruminant Livestock—Cryptosporidium spp. and Its Companions. Pathogens 2022, 11, 103. [Google Scholar] [CrossRef] [PubMed]
- Ryan, U.; Fayer, R.; Xiao, L. Cryptosporidium Species in Humans and Animals: Current Understanding and Research Needs. Parasitology 2014, 141, 1667–1685. [Google Scholar] [CrossRef]
- Zaheer, T.; Imran, M.; Abbas, R.Z.; Zaheer, I.; Malik, M.A. Avian Cryptosporidiosis and Its Zoonotic Significance in Asia. World’s Poult. Sci. J. 2021, 77, 55–70. [Google Scholar] [CrossRef]
- Zhao, W.; Zhou, H.; Ma, T.; Cao, J.; Lu, G.; Shen, Y. PCR-Based Detection of Cryptosporidium spp. and Enterocytozoon bieneusi in Farm-Raised and Free-Ranging Geese (Anser anser f. domestica) From Hainan Province of China: Natural Infection Rate and the Species or Genotype Distribution. Front. Cell. Infect. Microbiol. 2019, 9, 416. [Google Scholar] [CrossRef]
- Kabir, M.H.B.; Han, Y.; Lee, S.-H.; Nugraha, A.B.; Recuenco, F.; Murakoshi, F.; Xuan, X.; Kato, K. Prevalence and Molecular Characterization of Cryptosporidium Species in Poultry in Bangladesh. One Health 2020, 9, 100122. [Google Scholar] [CrossRef]
- Helmy, Y.A.; Krücken, J.; Abdelwhab, E.-S.M.; von Samson-Himmelstjerna, G.; Hafez, H.M. Molecular Diagnosis and Characterization of Cryptosporidium spp. in Turkeys and Chickens in Germany Reveals Evidence for Previously Undetected Parasite Species. PLoS ONE 2017, 12, e0177150. [Google Scholar] [CrossRef]
- McEvoy, J.M.; Giddings, C.W. Cryptosporidium in Commercially Produced Turkeys on-Farm and Postslaughter. Lett. Appl. Microbiol. 2009, 48, 302–306. [Google Scholar] [CrossRef] [PubMed]
- Lindsay, D.S.; Blagburn, B.L.; Ernest, J.A. Experimental Cryptosporidium parvum Infections in Chickens. J. Parasitol. 1987, 73, 242. [Google Scholar] [CrossRef]
- Goodwin, M.A.; Brown, J.; Fletcher, O.J. The Relationship of Cryptosporidium sp. Infection of the Bursa of Fabricius, Intestinal Tract, and Respiratory System of Chickens in Georgia, 1974-1988. Avian Dis. 1990, 34, 701. [Google Scholar] [CrossRef] [PubMed]
- Goodwin, M.A.; Brown, J. Intestinal Cryptosporidiosis in Chickens. Avian Dis. 1989, 33, 770. [Google Scholar] [CrossRef] [PubMed]
- Goodwin, M.A. Small-Intestinal Cryptosporidiosis in a Chicken. Avian Dis. 1988, 32, 844. [Google Scholar] [CrossRef] [PubMed]
- Bomfim, T.C.B. The Importance of Poultry in Environmental Dissemination of Cryptosporidium spp. Open Vet. Sci. J. 2013, 7, 12–17. [Google Scholar] [CrossRef]
- Laurent, F.; Lacroix-Lamandé, S. Innate Immune Responses Play a Key Role in Controlling Infection of the Intestinal Epithelium by Cryptosporidium. Int. J. Parasitol. 2017, 47, 711–721. [Google Scholar] [CrossRef]
- Cornelissen, J.B.W.J.; Swinkels, W.J.C.; Boersma, W.A.; Rebel, J.M.J. Host Response to Simultaneous Infections with Eimeria acervulina, maxima and tenella: A Cumulation of Single Responses. Vet. Parasitol. 2009, 162, 58–66. [Google Scholar] [CrossRef]
- Qureshi, M. Avian Macrophage and Immune Response: An Overview. Poult. Sci. 2003, 82, 691–698. [Google Scholar] [CrossRef] [PubMed]
- Van Doorninck, W.M.; Becker, E.R. Transport of Sporozoites of Eimeria necatrix in Macrophages. J. Parasitol. 1957, 43, 40–44. [Google Scholar] [CrossRef] [PubMed]
- Trout, J.M.; Lillehoi, H.S. Evidence of a Role for Intestinal CD8+ Lymphocytes and Macrophages in Transport of Eimeria acervulina Sporozoites. J. Parasitol. 1993, 79, 790–792. [Google Scholar] [CrossRef] [PubMed]
- Long, P.L.; Rose, M.E. Growth of Eimeria tenella in Vitro in Macrophages from Chicken Peritoneal Exudates. Z. Parasitenk. 1976, 48, 291–294. [Google Scholar] [CrossRef]
- Martinez, F.; Mascaro, C.; Rosales, M.J.; Diaz, J.; Cifuentes, J.; Osuna, A. In Vitro Multiplication of Cryptosporidium parvum in Mouse Peritoneal Macrophages. Vet. Parasitol. 1992, 42, 27–31. [Google Scholar] [CrossRef]
- McDonald, V.; Korbel, D.S.; Barakat, F.M.; Choudhry, N.; Petry, F. Innate Immune Responses against Cryptosporidium parvum Infection. Parasite Immunol. 2013, 35, 55–64. [Google Scholar] [CrossRef]
- Eckert, J. (Ed.) Guidelines on Techniques in Coccidiosis Research: COST 89/820-Biotechnology; EUR; Office for Official Publications of the European Communities: Luxembourg, 1995; ISBN 978-92-827-4970-8. [Google Scholar]
- Rentería-Solís, Z.; Zhang, R.; Taha, S.; Daugschies, A. A Modified Method for Purification of Eimeria tenella Sporozoites. Parasitol. Res. 2020, 119, 1429–1432. [Google Scholar] [CrossRef]
- Najdrowski, M.; Joachim, A.; Daugschies, A. An Improved in Vitro Infection Model for Viability Testing of Cryptosporidium parvum Oocysts. Vet. Parasitol. 2007, 150, 150–154. [Google Scholar] [CrossRef]
- Dettwiler, I.; Troell, K.; Robinson, G.; Chalmers, R.M.; Basso, W.; Rentería-Solís, Z.M.; Daugschies, A.; Mühlethaler, K.; Dale, M.I.; Basapathi Raghavendra, J.; et al. TIDE Analysis of Cryptosporidium Infections by Gp60 Typing Reveals Obscured Mixed Infections. J. Infect. Dis. 2022, 225, 686–695. [Google Scholar] [CrossRef]
- Berberich, L.M. Studies to Improve in Vitro Transfection and Infection Methods of Cryptosporidium parvum and Biological Characterization of the Putative Virulence Factor Thrombospondin-Related Adhesive Protein (Trap-C1); Universität Leipzig: Leipzig, Germany, 2021. [Google Scholar]
- Beug, H.; von Kirchbach, A.; Döderlein, G.; Conscience, J.-F.; Graf, T. Chicken Hematopoietic Cells Transformed by Seven Strains of Defective Avian Leukemia Viruses Display Three Distinct Phenotypes of Differentiation. Cell 1979, 18, 375–390. [Google Scholar] [CrossRef]
- Taha, S.; Nguyen-Ho-Bao, T.; Daugschies, A.; Rentería-Solís, Z. In Vitro Infection of Madin-Darby Bovine Kidney (MDBK) Cells with Eimeria acervulina Sporozoites: Quantitative Analysis of Parasite Cellular Invasion and Replication Using Real-Time Polymerase Chain Reaction (PCR). Parasitol. Res. 2021, 120, 2689–2693. [Google Scholar] [CrossRef]
- Blake, D.P.; Qin, Z.; Cai, J.; Smith, A.L. Development and Validation of Real-Time Polymerase Chain Reaction Assays Specific to Four Species of Eimeria. Avian Pathol. 2008, 37, 89–94. [Google Scholar] [CrossRef] [PubMed]
- Shahiduzzaman, M.; Dyachenko, V.; Obwaller, A.; Unglaube, S.; Daugschies, A. Combination of Cell Culture and Quantitative PCR for Screening of Drugs against Cryptosporidium parvum. Vet. Parasitol. 2009, 162, 271–277. [Google Scholar] [CrossRef]
- Thabet, A.; Alnassan, A.A.; Daugschies, A.; Bangoura, B. Combination of Cell Culture and QPCR to Assess the Efficacy of Different Anticoccidials on Eimeria tenella Sporozoites. Parasitol. Res. 2015, 114, 2155–2163. [Google Scholar] [CrossRef]
- Park, S.S.; Lillehoj, H.S.; Allen, P.C.; Park, D.W.; FitzCoy, S.; Bautista, D.A.; Lillehoj, E.P. Immunopathology and Cytokine Responses in Broiler Chickens Coinfected with Eimeria maxima and Clostridium perfringens with the Use of an Animal Model of Necrotic Enteritis. Avian Dis. 2008, 52, 14–22. [Google Scholar] [CrossRef] [PubMed]
- Nang, N.T.; Lee, J.S.; Song, B.M.; Kang, Y.M.; Kim, H.S.; Seo, S.H. Induction of Inflammatory Cytokines and Toll-like Receptors in Chickens Infected with Avian H9N2 Influenza Virus. Vet. Res. 2011, 42, 64. [Google Scholar] [CrossRef]
- Zhang, R.; Thabet, A.; Hiob, L.; Zheng, W.; Daugschies, A.; Bangoura, B. Mutual Interactions of the Apicomplexan Parasites Toxoplasma Gondii and Eimeria tenella with Cultured Poultry Macrophages. Parasites Vectors 2018, 11, 453. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Zheng, W.; Daugschies, A.; Bangoura, B. Apicomplexan Co-Infections Impair with Phagocytic Activity in Avian Macrophages. Parasitol. Res. 2020, 119, 4159–4168. [Google Scholar] [CrossRef] [PubMed]
- Michael, E. Sporozoites of Eimeria acervulina within Intestinal Macrophages in Normal Experimental Infections: An Ultrastructural Study. Z. F. Parasitenkd. 1976, 49, 33–40. [Google Scholar] [CrossRef]
- Dalloul, R.A.; Bliss, T.W.; Hong, Y.-H.; Ben-Chouikha, I.; Park, D.W.; Keeler, C.L.; Lillehoj, H.S. Unique Responses of the Avian Macrophage to Different Species of Eimeria. Mol. Immunol. 2007, 44, 558–566. [Google Scholar] [CrossRef]
- Martinez, F.; Rosales, M.J.; Diaz, J.; Mascaro, C. The Effects of IFN-γ Activated Mouse Peritoneal and Alveolar Macrophages on Cryptosporidium parvum Development. Vet. Parasitol. 1997, 68, 305–308. [Google Scholar] [CrossRef]
- Hong, Y.H.; Lillehoj, H.S.; Lee, S.H.; Dalloul, R.A.; Lillehoj, E.P. Analysis of Chicken Cytokine and Chemokine Gene Expression Following Eimeria acervulina and Eimeria tenella Infections. Vet. Immunol. Immunopathol. 2006, 114, 209–223. [Google Scholar] [CrossRef] [PubMed]
- Lillehoj, H.S.; Li, G. Nitric Oxide Production by Macrophages Stimulated with Coccidia Sporozoites, Lipopolysaccharide, or Interferon-γ, and Its Dynamic Changes in SC and TK Strains of Chickens Infected with Eimeria tenella. Avian Dis. 2004, 48, 244–253. [Google Scholar] [CrossRef] [PubMed]
- Hiob, L.; Koethe, M.; Schares, G.; Goroll, T.; Daugschies, A.; Bangoura, B. Experimental Toxoplasma Gondii and Eimeria tenella Co-Infection in Chickens. Parasitol. Res. 2017, 116, 3189–3203. [Google Scholar] [CrossRef] [PubMed]
Oligonucleotide Identity | Primer Name, Primer Sequence (5′ to 3′) | Product Size (bp) | References |
---|---|---|---|
E. acervulina SCAR marker forward | Eac_qPCRf, CTC GCG TGT CAG CAC TAC AT | 124 | [35] |
E. acervulina SCAR marker reverse | Eac_qPCRr, GAT AGC GTG CTT TGC CTT TC | [35] | |
C. parvum HSP70 forward | Cp_HSP70_f, AACTTTAGCTCCAGTTGAGAAAGTACTC | 143 | [36] |
C. parvum HSP70 reverse | Cp_HSP70_r, CATGGCTCTTTACCGTTAAAGAATTCC | [36] | |
C. parvum HSP70 Taqman probe | HSP_70_SNA, AATACGTGTAGAACCACCAACCAATACAACATC | [36] | |
Gallus domesticus GAPDH forward | chicken_DAPDH_f, GGTGGTGCTAAGCGTGTTAT | 264 | [38] |
Gallus domesticus GAPDH reverse | chicken_DAPDH_r, ACCTCTGTCATCTCTCCACA | [38] | |
Gallus domesticus IFN-γ forward | chicken_INF-γ_f, AGCTGACGGTGGACCTATTATT | 259 | [38] |
Gallus domesticus IFN-γ reverse | chicken_INF-γ_r, GGCTTTGCGCTGGATTC | [38] | |
Gallus domesticus iNOS forward | chicken_iNOS_f, TGGGTGGAAGCCGAAATA | 241 | [38] |
Gallus domesticus iNOS reverse | chicken_iNOS_r, GTACCAGCCGTTGAAAGGAC | [38] | |
Gallus domesticus IL-10 forward | chicken_IL-10_f, CGGGAGCTGAGGGTGAA | 272 | [38] |
Gallus domesticus IL-10 reverse | chicken_IL-10_r, GTGAAGAAGCGGTGACAGC | [38] | |
Gallus domesticus TNF-α forward | chicken_TNF- α_f, CTTCTGAGGCATTTGGAAGC | 380 | [39] |
Gallus domesticus TNF-α reverse | chicken_TNF- α_r, ACTGGGCGGTCATAGAACAG | [39] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Taha, S.; Nguyen-Ho-Bao, T.; Berberich, L.M.; Gawlowska, S.; Daugschies, A.; Rentería-Solís, Z. Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11). Life 2023, 13, 1267. https://doi.org/10.3390/life13061267
Taha S, Nguyen-Ho-Bao T, Berberich LM, Gawlowska S, Daugschies A, Rentería-Solís Z. Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11). Life. 2023; 13(6):1267. https://doi.org/10.3390/life13061267
Chicago/Turabian StyleTaha, Shahinaz, Tran Nguyen-Ho-Bao, Lisa Maxi Berberich, Sandra Gawlowska, Arwid Daugschies, and Zaida Rentería-Solís. 2023. "Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11)" Life 13, no. 6: 1267. https://doi.org/10.3390/life13061267
APA StyleTaha, S., Nguyen-Ho-Bao, T., Berberich, L. M., Gawlowska, S., Daugschies, A., & Rentería-Solís, Z. (2023). Interplay between Eimeria acervulina and Cryptosporidium parvum during In Vitro Infection of a Chicken Macrophage Cell Line (HD11). Life, 13(6), 1267. https://doi.org/10.3390/life13061267