Algae-Bacteria Community Analysis for Drinking Water Taste and Odour Risk Management
Abstract
1. Introduction
2. Materials and Methods
2.1. Reservoir Locations and Sample Collection
2.2. Geosmin and 2-MIB Concentrations
Categorising Geosmin and 2-MIB Concentrations
2.3. Water Chemistry
2.4. eDNA Extraction and Next-Generation Sequencing (NGS)
2.4.1. Extracting eDNA from Reservoir Water
2.4.2. Next Generation Sequencing (NGS): 16S rRNA and rbcL Genes
2.4.3. Bioinformatic Analysis and Databases for Taxonomic Assignment
2.5. Statistical Analyses
2.5.1. Datasets: Proportional and Binomial Manipulation
2.5.2. Non-Metric Multidimensional Scaling of 16S rRNA and rbcL Communities
2.5.3. Random Forest (RF) Models
2.5.4. Co-Occurrence Analyses
2.6. Data Availability
3. Results
3.1. T&O Categories in NMDS Community Analysis
3.2. Indicative Taxa of T&O ‘Events’ in Reservoirs Experiencing High Geosmin and 2-MIB Concentrations
T&O Risk Categorisation of Indicative Taxa Identified by RF Analysis
3.3. Co-Occurrence of Bacterial (16S rRNA) and Algal (rbcL) Communities
3.4. T&O Risk Indicator Categories and Associated Taxa
4. Discussion
4.1. Categorisation of Indicative Taxa for T&O Risk
4.1.1. Cyanobacterial T&O Producers
4.1.2. T&O Degraders
4.1.3. Nutrient Enrichment Indicators
4.1.4. Nutrient Exchange/Recycling
4.1.5. Cyanobacterial Benefactors
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Devi, A.; Chiu, Y.T.; Hsueh, H.T.; Lin, T.F. Quantitative PCR based detection system for cyanobacterial geosmin/2-methylisoborneol (2-MIB) events in drinking water sources: Current status and challenges. Water Res. 2021, 188, 116478. [Google Scholar] [CrossRef] [PubMed]
- Pochiraju, S.; Hoppe-Jones, C.; Adams, C.; Weinrich, L. Development and optimization of analytical methods for the detection of 18 taste and odor compounds in drinking water utilities. Water Res. X 2021, 11, 100099. [Google Scholar] [CrossRef] [PubMed]
- Wu, T.; Zhu, G.; Wang, Z.; Zhu, M.; Xu, H. Seasonal dynamics of odor compounds concentration driven by phytoplankton succession in a subtropical drinking water reservoir, southeast China. J. Hazard. Mater. 2022, 425, 128056. [Google Scholar] [CrossRef] [PubMed]
- Hooper, A.S.; Kille, P.; Watson, S.E.; Christofides, S.R.; Perkins, R.G. The importance of nutrient ratios in determining elevations in geosmin synthase (geoA) and 2-MIB cyclase (mic) resulting in taste and odour events. Water Res. 2023, 232, 119693. [Google Scholar] [CrossRef] [PubMed]
- Mustapha, S.; Tijani, J.O.; Ndamitso, M.; Abdulkareem, A.S.; Shuaib, D.T.; Mohammed, A.K. A critical review on geosmin and 2-methylisoborneol in water: Sources, effects, detection, and removal techniques. Environ. Monit. Assess. 2021, 193, 204. [Google Scholar] [CrossRef]
- Adams, H.; Southard, M.; Reeder, S.; Buerkens, F.; Hallford, R.L.; Ikehata, K.; Nix, D.K. Successfully Detecting and Mitigating Algal Blooms and Taste and Odor Compounds. J. AWWA 2021, 113, 10–19. [Google Scholar] [CrossRef]
- Bruder, S.; Babbar-Sebens, M.; Tedesco, L.; Soyeux, E. Use of fuzzy logic models for prediction of taste and odor compounds in algal bloom-affected inland water bodies. Environ. Monit. Assess. 2014, 186, 1525–1545. [Google Scholar] [CrossRef]
- Hayes, K.P.; Burch, M.D. Odorous compounds associated with algal blooms in South Australian water. Water Res. 1989, 23, 115–121. [Google Scholar] [CrossRef]
- Newton, R.J.; Jones, S.E.; Eiler, A.; McMahon, K.D.; Bertilsson, S.; Yamada, Y.; Kuzuyama, T.; Komatsu, M.; Shin-ya, K.; Omura, S.; et al. Chemotactic and Growth Responses of Marine Bacteria to Algal Extracellular Products. PLoS ONE 2015, 10, 265–277. [Google Scholar]
- Zimmerman, W.J.; Soliman, B.H.; Rosen, B.H. Growth and 2-methylisoborneol production by the cyanobacterium Phormidium LM689. Water Sci. Technol. 1995, 31, 181–186. [Google Scholar] [CrossRef]
- Graham, J.L.; Loftin, K.A.; Meyer, M.T.; Ziegler, A.C. Cyanotoxin mixtures and taste-and-odor compounds in cyanobacterial blooms from the midwestern united states. Environ. Sci. Technol. 2010, 44, 7361–7368. [Google Scholar] [CrossRef] [PubMed]
- Watson, S.B.; Ridal, J.; Boyer, G.L. Taste and odour and cyanobacterial toxins: Impairment, prediction, and management in the Great Lakes. Can. J. Fish. Aquat. Sci. 2008, 65, 1779–1796. [Google Scholar] [CrossRef]
- Kim, K.; Park, C.; Yoon, Y.; Hwang, S.J. Harmful cyanobacterial material production in the north han river (South Korea): Genetic potential and temperature-dependent properties. Int. J. Environ. Res. Public Health 2018, 15, 444. [Google Scholar] [CrossRef]
- Perkins, R.G.; Slavin, E.I.; Andrade, T.M.C.; Blenkinsopp, C.; Pearson, P.; Froggatt, T.; Godwin, G.; Parslow, J.; Hurley, S.; Luckwell, R.; et al. Managing taste and odour metabolite production in drinking water reservoirs: The importance of ammonium as a key nutrient trigger. J. Environ. Manag. 2019, 244, 276–284. [Google Scholar] [CrossRef]
- Harris, T.D.; Smith, V.H.; Graham, J.L.; Waa, D.B.V.d.; Tedesco, L.P.; Clercin, N. Combined effects of nitrogen to phosphorus and nitrate to ammonia ratios on cyanobacterial metabolite concentrations in eutrophic Midwestern USA reservoirs. Inland Waters 2016, 6, 199–210. [Google Scholar] [CrossRef]
- Montgomery, B.L. The regulation of light sensing and light-harvesting impacts the use of cyanobacteria as biotechnology platforms. Front. Bioeng. Biotechnol. 2014, 2, 22. [Google Scholar] [CrossRef]
- Robarts, R.D.; Zohary, T. Temperature effects on photosynthetic capacity, respiration, and growth rates of bloom—Forming cyanobacteria. New Zealand J. Mar. Freshw. Res. 1987, 21, 391–399. [Google Scholar] [CrossRef]
- Salomon, P.S.; Janson, S.; Granéli, E. Molecular identification of bacteria associated with filaments of Nodularia spumigena and their effect on the cyanobacterial growth. Harmful Algae 2003, 2, 261–272. [Google Scholar] [CrossRef]
- Louati, I.; Pascault, N.; Debroas, D.; Bernard, C.; Humbert, J.F.; Leloup, J. Structural diversity of bacterial communities associated with bloom-forming freshwater cyanobacteria differs according to the cyanobacterial genus. PLoS ONE 2015, 10, e0140614. [Google Scholar] [CrossRef]
- Havens, K.E. Cyanobacteria blooms: Effects on aquatic ecosystems. Adv. Exp. Med. Biol. 2008, 619, 733–747. [Google Scholar]
- Steffen, M.M.; Li, Z.; Effler, T.C.; Hauser, L.J.; Boyer, G.L.; Wilhelm, S.W. Comparative Metagenomics of Toxic Freshwater Cyanobacteria Bloom Communities on Two Continents. PLoS ONE 2012, 7, e44002. [Google Scholar] [CrossRef] [PubMed]
- Berg, K.A.; Lyra, C.; Sivonen, K.; Paulin, L.; Suomalainen, S.; Tuomi, P.; Rapala, J. High diversity of cultivable heterotrophic bacteria in association with cyanobacterial water blooms. ISME J. 2009, 3, 314–325. [Google Scholar] [CrossRef] [PubMed]
- Ploug, H.; Adam, B.; Musat, N.; Kalvelage, T.; Lavik, G.; Wolf-Gladrow, D.; Kuypers, M.M.M. Carbon, nitrogen and O 2 fluxes associated with the cyanobacterium Nodularia spumigena in the Baltic Sea. ISME J. 2011, 5, 1549–1558. [Google Scholar] [CrossRef] [PubMed]
- Youn, S.J.; Kim, H.N.; Yu, S.J.; Byeon, M.S. Cyanobacterial occurrence and geosmin dynamics in Paldang Lake watershed, South Korea. Water Environ. J. 2020, 34, 634–643. [Google Scholar] [CrossRef]
- Cai, H.; Jiang, H.; Krumholz, L.R.; Yang, Z. Bacterial Community Composition of Size-Fractioned Aggregates within the Phycosphere of Cyanobacterial Blooms in a Eutrophic Freshwater Lake. PLoS ONE 2014, 9, e102879. [Google Scholar] [CrossRef]
- Paerl, H.W.; Kellar, P.E. Significance of bacterial (cyanophyceae) Anabaena associations with respect to N2 fixation in freshwater. J. Phycol. 1978, 14, 254–260. [Google Scholar] [CrossRef]
- Simon, M.; Grossart, H.-P.; Schweitzer, B.; Ploug, H. Microbial ecology of organic aggregates in aquatic ecosystems. Aquat. Microb. Ecol. 2002, 28, 175–211. [Google Scholar] [CrossRef]
- Eiler, A.; Bertilsson, S. Composition of freshwater bacterial communities associated with cyanobacterial blooms in four Swedish lakes. Environ. Microbiol. 2004, 6, 1228–1243. [Google Scholar] [CrossRef]
- Foster, R.A.; Kuypers, M.M.M.; Vagner, T.; Paerl, R.W.; Musat, N.; Zehr, J.P. Nitrogen fixation and transfer in open ocean diatom-cyanobacterial symbioses. ISME J. 2011, 5, 1484–1493. [Google Scholar] [CrossRef]
- Hilton, J.A.; Foster, R.A.; James Tripp, H.; Carter, B.J.; Zehr, J.P.; Villareal, T.A. Genomic deletions disrupt nitrogen metabolism pathways of a cyanobacterial diatom symbiont. Nat. Commun. 2013, 4, 1767. [Google Scholar] [CrossRef]
- Thompson, A.W.; Foster, R.A.; Krupke, A.; Carter, B.J.; Musat, N.; Vaulot, D.; Kuypers, M.M.; Zehr, J.P. Unicellular cyanobacterium symbiotic with a single-celled eukaryotic alga. Science 2012, 6101, 1546–1560. [Google Scholar] [CrossRef] [PubMed]
- Bar-Yosef, Y.; Sukenik, A.; Hadas, O.; Viner-Mozzini, Y.; Kaplan, A. Enslavement in the water body by toxic aphanizomenon ovalisporum, inducing alkaline phosphatase in phytoplanktons. Curr. Biol. 2010, 20, 1557–1561. [Google Scholar] [CrossRef] [PubMed]
- Paerl, H.W.; Pinckney, J.L. A mini-review of microbial consortia: Their roles in aquatic production and biogeochemical cycling. Microb. Ecol. 1996, 31, 225–247. [Google Scholar] [CrossRef]
- Barberán, A.; Bates, S.T.; Casamayor, E.O.; Fierer, N. Using network analysis to explore co-occurrence patterns in soil microbial communities. ISME J. 2012, 6, 343–351. [Google Scholar] [CrossRef]
- Eiler, A.; Heinrich, F.; Bertilsson, S. Coherent dynamics and association networks among lake bacterioplankton taxa. ISME J. 2012, 6, 330–342. [Google Scholar] [CrossRef]
- Ju, F.; Zhang, T. Bacterial assembly and temporal dynamics in activated sludge of a full-scale municipal wastewater treatment plant. ISME J. 2015, 9, 683–695. [Google Scholar] [CrossRef]
- Faust, K.; Raes, J. Microbial interactions: From networks to models. Nat. Rev. Microbiol. 2012, 10, 538–550. [Google Scholar] [CrossRef]
- Faust, K. Open challenges for microbial network construction and analysis. ISME J. 2021, 15, 3111–3118. [Google Scholar] [CrossRef]
- Cheng, J.; Karambelkar, B.; Xie, Y. leaflet: Create Interactive Web Maps with the JavaScript ’Leaflet’ Library. 2017. Available online: https://rstudio.r-universe.dev/leaflet (accessed on 7 December 2024).
- Fawley, M.W.; Fawley, K.P. A simple and rapid technique for the isolation of DNA from microalgae. J. Phycol. 2004, 40, 223–225. [Google Scholar] [CrossRef]
- Glover, R. Biomonitoring and Surveillance with Short-and Long-Read Metabarcoding. Ph.D. Thesis, University of Exeter, Exeter, UK, 2019. [Google Scholar]
- Caporaso, J.G.; Lauber, C.L.; Walters, W.A.; Berg-Lyons, D.; Lozupone, C.A.; Turnbaugh, P.J.; Fierer, N.; Knight, R. Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample. Proc. Natl. Acad. Sci. USA 2011, 108, 4516–4522. [Google Scholar] [CrossRef]
- Bolyen, E.; Rideout, J.R.; Dillon, M.R.; Bokulich, N.A.; Abnet, C.C.; Al-Ghalith, G.A.; Alexander, H.; Alm, E.J.; Arumugam, M.; Asnicar, F.; et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat. Biotechnol. 2019, 37, 852–857. [Google Scholar] [CrossRef] [PubMed]
- Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef] [PubMed]
- Callahan, B.J. Silva Taxonomic Training Data Formatted for DADA2 (Silva Version 132). [Dataset]. 2018. Available online: https://zenodo.org/records/1172783 (accessed on 7 December 2024).
- Rimet, F.; Gusev, E.; Kahlert, M.; Kelly, M.G.; Kulikovskiy, M.; Maltsev, Y.; Mann, D.G.; Pfannkuchen, M.; Trobajo, R.; Vasselon, V.; et al. Diat.barcode, an open-access curated barcode library for diatoms. Sci. Rep. 2019, 9, 15116. [Google Scholar] [CrossRef] [PubMed]
- R_Core_Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2021. [Google Scholar]
- Cuff, J.P.; Windsor, F.M.; Tercel, M.P.T.G.; Kitson, J.J.N.; Evans, D.M. Overcoming the pitfalls of merging dietary metabarcoding into ecological networks. Methods Ecol. Evol. 2022, 13, 545–559. [Google Scholar] [CrossRef]
- Oksanen, J. Vegan: Ecological diversity. R Proj. 2013, 368, 1–11. [Google Scholar]
- Wickham, H. ggplot2. Use R! In Data Analysis; Springer: Cham, Switzerland, 2016; pp. 1–13. [Google Scholar]
- Breiman, L. Random Forests. Mach. Learn. 2001, 45, 5–32. [Google Scholar] [CrossRef]
- Veech, J.A. A probabilistic model for analysing species co-occurrence. Glob. Ecol. Biogeogr. 2013, 22, 252–260. [Google Scholar] [CrossRef]
- Csardi, G.; Nepusz, T. The Igraph Software Package for Complex Network Research. 2006, 1695. Available online: https://www.researchgate.net/publication/221995787_The_Igraph_Software_Package_for_Complex_Network_Research (accessed on 7 December 2024).
- Briatte, F. ggnetwork: Geometries to Plot Networks with ’ggplot2’. 2023. Available online: https://briatte.github.io/ggnetwork/ (accessed on 7 December 2024).
- Almende, B.; Thieurmel, B.; Robert, T. visNetwork: Network Visualization Using ’vis. js’ Library. R Package Version 2.0.9. 2019, 1–105. Available online: https://cran.r-project.org/web/packages/visNetwork/visNetwork.pdf (accessed on 7 December 2024).
- Driscoll, C.B.; Meyer, K.A.; Šulčius, S.; Brown, N.M.; Dick, G.J.; Cao, H.; Gasiūnas, G.; Timinskas, A.; Yin, Y.; Landry, Z.C.; et al. A closely-related clade of globally distributed bloom-forming cyanobacteria within the Nostocales. Harmful Algae 2018, 77, 93–107. [Google Scholar] [CrossRef]
- Jakubowska, N.; Szeląg-Wasielewska, E. Toxic picoplanktonic cyanobacteria—Review. Mar. Drugs 2015, 13, 1497–1518. [Google Scholar] [CrossRef]
- Zhi, Y.; Wu, Q.; Du, H.; Xu, Y. Biocontrol of geosmin-producing Streptomyces spp. by two Bacillus strains from Chinese liquor. Int. J. Food Microbiol. 2016, 231, 1–9. [Google Scholar] [CrossRef]
- Zhang, J.; Li, L.; Qiu, L.; Wang, X.; Meng, X.; You, Y.; Yu, J.; Ma, W. Effects of Climate Change on 2-Methylisoborneol Production in Two Cyanobacterial Species. Water 2017, 9, 859. [Google Scholar] [CrossRef]
- Driscoll, C.B. Comparative Genomics of Freshwater Bloom-Forming Cyanobacteria and Associated Organisms. 2016. Available online: https://www.pacificorp.com/content/dam/pcorp/documents/en/pacificorp/energy/hydro/klamath-river/khsa-implementation/technical-documents/2016-DNA-Special-Study(Final_4-12-17).pdf (accessed on 7 December 2024).
- Pattanaik, B.; Lindberg, P. Terpenoids and Their Biosynthesis in Cyanobacteria. Life 2015, 5, 269–293. [Google Scholar] [CrossRef] [PubMed]
- Clercin, N.A.; Druschel, G.K.; Gray, M. Occurrences of 2-methylisoborneol and geosmin –degrading bacteria in a eutrophic reservoir and the role of cell-bound versus dissolved fractions. J. Environ. Manag. 2021, 297, 113304. [Google Scholar] [CrossRef]
- Eaton, R.W.; Sandusky, P. Biotransformations of (+/−)-geosmin by terpene-degrading bacteria. Biodegradation 2010, 21, 71–79. [Google Scholar] [CrossRef]
- Ho, L.; Hoefel, D.; Bock, F.; Saint, C.P.; Newcombe, G. Biodegradation rates of 2-methylisoborneol (MIB) and geosmin through sand filters and in bioreactors. Chemosphere 2007, 66, 2210–2218. [Google Scholar] [CrossRef]
- Ma, N.N.; Luo, G.Z.; Tan, H.X.; Yao, M.L.; Wange, X.Y. Kinetic Characteristics of Degradation of Geosmin and 2-Methylisoborneol by Bacillus subtilis. Huan Jing Ke Xue 2015, 36, 1379–1384. [Google Scholar]
- Churro, C.; Semedo-Aguiar, A.P.; Silva, A.D.; Pereira-Leal, J.B.; Leite, R.B. A novel cyanobacterial geosmin producer, revising GeoA distribution and dispersion patterns in Bacteria. Sci. Rep. 2020, 10, 8679. [Google Scholar] [CrossRef]
- Bertos-Fortis, M.; Farnelid, H.M.; Lindh, M.V.; Casini, M.; Andersson, A.; Pinhassi, J.; Legrand, C. Unscrambling cyanobacteria community dynamics related to environmental factors. Front. Microbiol. 2016, 7, 625. [Google Scholar] [CrossRef]
- Salmaso, N.; Albanese, D.; Capelli, C.; Boscaini, A.; Pindo, M.; Donati, C. Diversity and Cyclical Seasonal Transitions in the Bacterial Community in a Large and Deep Perialpine Lake. Microb. Ecol. 2018, 76, 125–143. [Google Scholar] [CrossRef]
- Pérez-Pantoja, D.; Donoso, R.; Agulló, L.; Córdova, M.; Seeger, M.; Pieper, D.H.; González, B. Genomic analysis of the potential for aromatic compounds biodegradation in Burkholderiales. Environ. Microbiol. 2012, 14, 1091–1117. [Google Scholar] [CrossRef]
- Vedler, E.; Heinaru, E.; Jutkina, J.; Viggor, S.; Koressaar, T.; Remm, M.; Heinaru, A. Limnobacter spp. as newly detected phenol-degraders among Baltic Sea surface water bacteria characterised by comparative analysis of catabolic genes. Syst. Appl. Microbiol. 2013, 36, 525–532. [Google Scholar] [CrossRef] [PubMed]
- Numberger, D.; Zoccarato, L.; Woodhouse, J.; Ganzert, L.; Sauer, S.; Márquez, J.R.G.; Domisch, S.; Grossart, H.P.; Greenwood, A.D. Urbanization promotes specific bacteria in freshwater microbiomes including potential pathogens. Sci. Total Environ. 2022, 845, 157321. [Google Scholar] [CrossRef] [PubMed]
- Paster, B.J.; Russell, J.B.; Yang, C.M.J.; Chow, J.M. Phylogeny of the Ammonia-Producing Ruminal Bacteria. Int. J. Syst. Bacteriol. 1993, 43, 107–110. [Google Scholar] [CrossRef] [PubMed]
- Van de Vijver, B.; Crawford, R.M. Melosira jeanbertrandiana, a new Melosira species (Bacillariophyceae) from the sub-Antarctic region. Bot. Lett. 2020, 167, 50–56. [Google Scholar] [CrossRef]
- Xu, Z.; Te, S.H.; He, Y.; Gin, K.Y.H. The characteristics and dynamics of cyanobacteria-heterotrophic bacteria between two estuarine reservoirs—Tropical versus subtropical regions. Front. Microbiol. 2018, 9, 2531. [Google Scholar] [CrossRef]
- Reynolds, C.S.; Huszar, V.; Kruk, C.; Naselli-Flores, L.; Melo, S. Towards a functional classification of the freshwater phytoplankton. J. Plankton Res. 2002, 24, 417–428. [Google Scholar] [CrossRef]
- Slavin, E. Using Artificial Circulation for In-Reservoir Management of Cyanobacteria and Taste and Odour Metabolite Production. 2020, 1–248. Available online: https://www.fao.org/fishery/en/openasfa/b6727947-d718-4bbe-860f-af0a258e2c33 (accessed on 7 December 2024).
- Krivtsov, V.; Bellinger, E.G.; Sigee, D.C. Changes in the elemental composition of Asterionella formosa during tim diatom spring bloom. J. Plankton Res. 2000, 22, 169–184. [Google Scholar] [CrossRef]
- Wu, L.; Zhang, C.; Vadiveloo, A.; Montes, M.L.; Xia, L.; Song, S.; Fernandez, M.A.; Lan, S. Efficient nutrient recycling from wastewater to deserts: A comparative study on biocrust cyanobacteria performance. Chem. Eng. J. 2024, 491, 151927. [Google Scholar] [CrossRef]
- Ye, Q.; Liu, J.; Du, J.; Zhang, J. Bacterial Diversity in Submarine Groundwater along the Coasts of the Yellow Sea. Front Microbiol 2016, 6, 1519. [Google Scholar] [CrossRef]
- Kim, M.; Lee, J.; Yang, D.; Park, H.Y.; Park, W. Seasonal dynamics of the bacterial communities associated with cyanobacterial blooms in the Han River. Environ. Pollut. 2020, 266, 115198. [Google Scholar] [CrossRef]
- Takebe, H.; Tominaga, K.; Isozaki, T.; Watanabe, T.; Yamamoto, K.; Kamikawa, R.; Yoshida, T. Taxonomic difference in marine bloom-forming phytoplanktonic species affects the dynamics of both bloom-responding prokaryotes and prokaryotic viruses. mSystems 2024, 9, e00949-23. [Google Scholar] [CrossRef] [PubMed]
- Reintjes, G.; Heins, A.; Wang, C.; Amann, R. Abundance and composition of particles and their attached microbiomes along an Atlantic Meridional Transect. Front. Mar. Sci. 2023, 10, 1051510. [Google Scholar] [CrossRef]
- Kulichevskaya, I.S.; Ivanova, A.A.; Naumoff, D.G.; Beletsky, A.V.; Rijpstra, W.I.C.; Sinninghe Damsté, J.S.; Mardanov, A.V.; Ravin, N.V.; Dedysh, S.N. Frigoriglobus tundricola gen. nov., sp. nov., a psychrotolerant cellulolytic planctomycete of the family Gemmataceae from a littoral tundra wetland. Syst. Appl. Microbiol. 2020, 43, 126129. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez-Sanchez, A.; Muñoz-Palazon, B.; Hurtado-Martinez, M.; Maza-Marquez, P.; Gonzalez-Lopez, J.; Vahala, R.; Gonzalez-Martinez, A. Microbial ecology dynamics of a partial nitritation bioreactor with Polar Arctic Circle activated sludge operating at low temperature. Chemosphere 2019, 225, 73–82. [Google Scholar] [CrossRef]
- Boyett, M.R.; Tavakkoli, A.; Sobolev, D. Mathematical Modeling of Competition for Ammonium among Bacteria, Archaea and Cyanobacteria within Cyanobacterial Mats: Can Ammonia- Oxidizers Force Nitrogen Fixation ? Ocean Sci. J. 2013, 48, 269–277. [Google Scholar] [CrossRef]
- Jeong, J.Y.; Lee, S.H.; Yun, M.R.; Oh, S.E.; Lee, K.H.; Park, H.D. 2-Methylisoborneol (2-Mib) Excretion By Pseudanabaena Yagii Under Low Temperature. Microorganisms 2021, 9, 486. [Google Scholar] [CrossRef]
- Woyke, T.; Chertkov, O.; Lapidus, A.; Nolan, M.; Lucas, S.; del Rio, T.G.; Tice, H.; Cheng, J.F.; Tapia, R.; Han, C.; et al. Complete genome sequence of the gliding freshwater bacterium Fluviicola taffensis type strain (RW262T). Stand. Genom. Sci. 2011, 5, 21–29. [Google Scholar] [CrossRef]
- Cottrell, M.T.; Kirchman, D.L. Natural assemblages of marine proteobacteria and members of the Cytophaga-flavobacter cluster consuming low- and high-molecular-weight dissolved organic matter. Appl. Environ. Microbiol. 2000, 66, 1692–1697. [Google Scholar] [CrossRef]
- Guedes, I.A.; Rachid, C.T.C.C.; Rangel, L.M.; Silva, L.H.S.; Bisch, P.M.; Azevedo, S.M.F.O.; Pacheco, A.B.F. Close link between harmful cyanobacterial dominance and associated bacterioplankton in a tropical eutrophic reservoir. Front. Microbiol. 2018, 9, 424. [Google Scholar] [CrossRef]
- Kust, A.; Urajová, P.; Hrouzek, P.; Vu, D.L.; Čapková, K.; Štenclová, L.; Řeháková, K.; Kozlíková-Zapomělová, E.; Lepšová-Skácelová, O.; Lukešová, A.; et al. A new microcystin producing Nostoc strain discovered in broad toxicological screening of non-planktic Nostocaceae (cyanobacteria). Toxicon 2018, 150, 66–73. [Google Scholar] [CrossRef]
- Sethuraman, A.; Stancheva, R.; Sanders, C.; Caceres, L.; Castro, D.; Hausknecht-Buss, H.; Henry, S.; Johansen, H.; Kasler, A.; Lastor, S.; et al. Genome of a novel Sediminibacterium discovered in association with two species of freshwater cyanobacteria from streams in Southern California. G3 Genes Genomes Genet. 2022, 12, jkac123. [Google Scholar] [CrossRef] [PubMed]
- Velichko, N.; Chernyaeva, E.; Averina, S.; Gavrilova, O.; Lapidus, A.; Pinevich, A. Consortium of the ’bichlorophyllous’ cyanobacterium Prochlorothrix hollandica and chemoheterotrophic partner bacteria: Culture and metagenome-based description. Environ. Microbiol. Rep. 2015, 7, 623–633. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.; Lee, J.; Lee, T.K.; Woo, S.G.; Baek, G.S.; Park, J. In-depth characterization of wastewater bacterial community in response to algal growth using pyrosequencing. J. Microbiol. Biotechnol. 2013, 23, 1472–1477. [Google Scholar] [CrossRef] [PubMed]
- Pushpakumara, B.L.D.U.; Tandon, K.; Willis, A.; Verbruggen, H. Unravelling microalgal-bacterial interactions in aquatic ecosystems through 16S co-occurrence networks. Sci. Rep. 2022, 13, 2743. [Google Scholar]
- Orsi, W.D.; Smith, J.M.; Liu, S.; Liu, Z.; Sakamoto, C.M.; Wilken, S.; Poirier, C.; Richards, T.A.; Keeling, P.J.; Worden, A.Z.; et al. Diverse, uncultivated bacteria and archaea underlying the cycling of dissolved protein in the ocean. ISME J. 2016, 10, 2158–2173. [Google Scholar] [CrossRef]
- Wang, K.; Razzano, M.; Mou, X. Cyanobacterial blooms alter the relative importance of neutral and selective processes in assembling freshwater bacterioplankton community. Sci. Total Environ. 2020, 706, 135724. [Google Scholar] [CrossRef]
- Newitt, J.T. Roles and Recruitment of Streptomyces Species in the Wheat Root Microbiome. 2020, 1–241. Available online: https://ueaeprints.uea.ac.uk/id/eprint/81445/1/2020NewittJPhDPhD.pdf (accessed on 7 December 2024).
- Rajaneesh, K.M.; Naik, R.K.; Roy, R.; Costa, P.M.D. Cyanobacteria in tropical and subtrop-ical marine environments: Bloom formation and ecological role. In Advances in Cyanobacterial Biology; Academic Press: Cambridge, MA, USA, 2020; pp. 35–46. [Google Scholar]
- Yuan, Q.; Wang, P.; Wang, X.; Hu, B.; Tao, L. Phytoremediation of cadmium-contaminated sediment using Hydrilla verticillata and Elodea canadensis harbor two same keystone rhizobacteria Pedosphaeraceae and Parasegetibacter. Chemosphere 2022, 286, 131648. [Google Scholar] [CrossRef]
- Okazaki, Y.; Fujinaga, S.; Tanaka, A.; Kohzu, A.; Oyagi, H.; Nakano, S.I. Ubiquity and quantitative significance of bacterioplankton lineages inhabiting the oxygenated hypolimnion of deep freshwater lakes. ISME J. 2017, 11, 2279–2293. [Google Scholar] [CrossRef]
- Hallbeck, L.; Pederson, K. The Family Gallionellaceae. In The Prokaryotes; Rosenberg, E., DeLong, E.F., Lory, S.S., Thompson, F., Eds.; Springer: Berlin/Heidelberg, Germany, 2014; pp. 853–858. [Google Scholar]
- Dae-Kyun, P.; Maeng, J.; Ahn, C.-Y.; Chung, A.-S.; Lee, J.-H.; Oh, H.M. Geosmin Concentration and Its Relation to Environmental Factors in Daechung Reservoir, Korea. Korean J. Limnol. 2001, 34, 319–326. [Google Scholar]
- Stoermer, E.F.; Julius, M.L. Centric Diatoms. In Freshwater algae of North America—Ecology and Classification; Wehr, J.D., Sheath, R.G., Eds.; Elsevier: Amsterdam, The Netherlands, 2003; pp. 559–594. [Google Scholar]
- Maldonado, M.; Ribes, M.; van Duyl, F.C. Nutrient Fluxes Through Sponges: Biology, Budgets, and Ecological Implications. In Advances in Marine Biology; Becerro, M.A., Uriz, M.J., Maldonado, M., Turon, X., Eds.; Academic Press: Cambridge, MA, USA, 2012; pp. 113–182. [Google Scholar]
- Xiao, Z.; Zhang, S.; Yan, P.; Huo, J.; Aurangzeib, M. Microbial Community and Their Potential Functions after Natural Vegetation Restoration in Gullies of Farmland in Mollisols of Northeast China. Land 2022, 11, 2231. [Google Scholar] [CrossRef]
- Farkas, M.; Kaszab, E.; Radó, J.; Háhn, J.; Tóth, G.; Harkai, P.; Ferincz, Á.; Lovász, Z.; Táncsics, A.; Vörös, L.; et al. Planktonic and Benthic Bacterial Communities of the Largest Central European Shallow Lake, Lake Balaton and Its Main Inflow Zala River. Curr. Microbiol. 2020, 77, 4016–4028. [Google Scholar] [CrossRef] [PubMed]
- Kozak, A.; Celewicz-Gołdyn, S.; Kuczyńska-Kippen, N. Cyanobacteria in small water bodies: The effect of habitat and catchment area conditions. Sci. Total Environ. 2019, 646, 1578–1587. [Google Scholar] [CrossRef] [PubMed]
- Flores, E.; Herrero, A. Nitrogen assimilation and nitrogen control in cyanobacteria. Biochem. Soc. Trans. 2005, 33, 164–168. [Google Scholar] [CrossRef]
- Saadoun, I.M.K.; Schrader, K.K.; Blevins, W.T. Environmental and nutritional factors affecting geosmin synthesis by Anabaena sp. Water Res. 2001, 35, 1209–1218. [Google Scholar] [CrossRef]
- Collos, Y.; Berges, J. Nitrogen metabolism in phytoplankton. In Marine Ecology; Duarte, C.M., Lot Helgueras, A., Eds.; Encyclopaedia of Life Support Systems (EOLSS): Oxford, UK, 2003; pp. 262–280. [Google Scholar]
- Clercin, N.A.; Koltsidou, I.; Picard, C.J.; Druschel, G.K. Prevalence of Actinobacteria in the production of 2-methylisoborneol and geosmin, over Cyanobacteria in a temperate eutrophic reservoir. Chem. Eng. J. Adv. 2022, 9, 100226. [Google Scholar] [CrossRef]
- Hojun, L.; Depuydt, S.; Choi, S.; Kim, G.; Pandey, L.K.; Hader, D.P.; Han, T.; Park, J. Potential use of nuisance cyanobacteria as a source of anticancer agents. In Natural Bioactive Compounds; Sinha, R.P., Hader, D.P., Eds.; Academic Press: Cambridge, MA, USA, 2021; pp. 203–231. [Google Scholar]
- Śliwińska-Wilczewska, S.; Maculewicz, J.; Felpeto, A.B.; Latała, A. Allelopathic and bloom-forming picocyanobacteria in a changing world. Toxins 2018, 10, 48. [Google Scholar] [CrossRef]
- Khanh Tran, H.N.; Kim, J.A.; Youn, U.J.; Kim, S.; Woo, M.H.; Min, B.S. Investigation of chemical compounds from Chlamydomonas sp. KSF108 (Chlamydomonadaceae). Biochem. Syst. Ecol. 2019, 83, 4–6. [Google Scholar] [CrossRef]
- Cattaneo, C.R.; Rodríguez, Y.; Rene, E.R.; García-Depraect, O.; Muñoz, R. Biogas bioconversion into poly(3-hydroxybutyrate) by a mixed microbial culture in a novel Taylor flow bioreactor. Waste Manag. 2022, 150, 364–372. [Google Scholar] [CrossRef]
- Khairunisa, B.H.; Loganathan, U.; Ogejo, J.A.; Mukhopadhyay, B. Nitrogen Transformation Processes in Manure Microbiomes of Earthen Pit and Concrete Storages on Commercial Dairy Farms. Res. Sq. 2022, PREPRINT, 1–24. [Google Scholar] [CrossRef]
- Veraart, A.J.; Romaní, A.M.; Tornés, E.; Sabater, S. Algal response to nutrient enrichment in forested oligotrophic stream. J. Phycol. 2008, 44, 564–572. [Google Scholar] [CrossRef]
- Thacker, M.; Karthick, B. Response of Diatoms to the Changing Water Quality in the Myristica Swamps of the Western Ghats, India. Diversity 2022, 14, 202. [Google Scholar] [CrossRef]
- Tamura, T. The Family Sporichthyaceae. In The Prokaryotes, 4th ed.; Rosenberg, E., DeLong, E.F., Stackebrandt, E., Thompson, F., Eds.; Springer: Berlin/Heidelberg, Germany, 2014; pp. 883–888. [Google Scholar]
- Deemer, B.R.; Harrison, J.A. Summer Redox Dynamics in a Eutrophic Reservoir and Sensitivity to a Summer ’s End Drawdown Event. Ecosystems 2019, 22, 1618–1632. [Google Scholar] [CrossRef]
- Lee, J.E.; Youn, S.J.; Byeon, M.; Yu, S.J. Occurrence of cyanobacteria, actinomycetes, and geosmin in drinking water reservoir in Korea: A case study from an algal bloom in 2012. Water Sci. Technol. Water Supply 2020, 20, 1862–1870. [Google Scholar] [CrossRef]
- Luo, F.; Chen, H.; Wu, X.; Liu, L.; Chen, Y.; Wang, Z. Insights into the Seasonal Olfactory Mechanism of Geosmin in Raw Water of Huangpu River. Toxics 2022, 10, 485. [Google Scholar] [CrossRef]
- Heudre, D.; Wetzel, C.E.; Moreau, L.; Van de Vijver, B.; Ector, L. On the identity of the rare fragilaria subconstricta (fragilariaceae), with fragilaria species forming ribbon-like colonies shortly reconsidered. Plant Ecol. Evol. 2019, 152, 327–339. [Google Scholar] [CrossRef]
- Kulichevskaya, I.S.; Ivanova, A.O.; Belova, S.E.; Baulina, O.I.; Bodelier, P.L.E.; Rijpstra, W.I.C.; Sinninghe Damsté, J.S.; Zavarzin, G.A.; Dedysh, S.N. Schlesneria paludicola gen. nov., sp. nov., the first acidophilic member of the order Planctomycetales, from Sphagnum-dominated boreal wetlands. Int. J. Syst. Evol. Microbiol. 2007, 57, 2680–2687. [Google Scholar] [CrossRef]
- Molot, L.A.; Watson, S.B.; Creed, I.F.; Trick, C.G.; McCabe, S.K.; Verschoor, M.J.; Sorichetti, R.J.; Powe, C.; Venkiteswaran, J.J.; Schiff, S.L. A novel model for cyanobacteria bloom formation: The critical role of anoxia and ferrous iron. Freshw. Biol. 2014, 59, 1323–1340. [Google Scholar] [CrossRef]
T&O Compound | Category | Concentrations (ng L−1) |
---|---|---|
Geosmin | Low | <5.00 |
Medium | 5.00–20.00 | |
High | >20.00 | |
2-MIB | Low | <2.50 |
Medium | 2.50–10.00 | |
High | >10.00 |
Name | Sequence (5′–3′) | Length (Bases) | Amplicon Size (Bases) | Reference |
---|---|---|---|---|
Forward Overhang | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | 33 | - | - |
Reverse Overhang | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG | 34 | - | - |
rbcL646F | ATGCGTTGGAGAGARCGTTTC | 21 | 419 | [41] |
rbcL998R | GATCACCTTCTAATTTACCWACAACTG | 27 | ||
515F | GTGCCAGCMGCCGCGGTAA | 19 | 358 | [42] |
806R | GGACTACHVGGGTWTCTAAT | 20 |
Key Taxa Identified by RF Analysis | Key Taxa Co-Occurring with T&O-Producing Cyanobacteria | |||
---|---|---|---|---|
T&O Risk Category | Geosmin | 2-MIB | Geosmin | 2-MIB |
Cyanobacterial T&O Producers | Aphanizomenon NIES81 | Cyanobium PCC-6307 | Aphanizomenon NIES81, Nostocaceae | Cyanobium PCC-6307, Dolichospermum NIES41 |
T&O Degraders | Pseudomonas, Bacillus | Limnobacter | Bacillus | - |
Nutrient Enrichment Indicators87 | Peptostreptococcaceae, Vicinamibacterales Order, Melosira | Armatimonas, Nitzschia | Peptostreptococcaceae, Aulacoseira | Asterionella, Melosira |
Nutrient Exchange/Recycling | - | Limnohabitans, NS9 marine group, Gemmataceae | Fluviicola, Chlamydomonadaceae | Gemmataceae, Rhizobiales A0939 |
Cyanobacterial Benefactors | OM27 Clade | Sediminibacterium, OM190 | - | - |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hooper, A.S.; Christofides, S.R.; Windsor, F.M.; Watson, S.E.; Kille, P.; Perkins, R.G. Algae-Bacteria Community Analysis for Drinking Water Taste and Odour Risk Management. Water 2025, 17, 79. https://doi.org/10.3390/w17010079
Hooper AS, Christofides SR, Windsor FM, Watson SE, Kille P, Perkins RG. Algae-Bacteria Community Analysis for Drinking Water Taste and Odour Risk Management. Water. 2025; 17(1):79. https://doi.org/10.3390/w17010079
Chicago/Turabian StyleHooper, Annalise Sara, Sarah R. Christofides, Fredric M. Windsor, Sophie E. Watson, Peter Kille, and Rupert G. Perkins. 2025. "Algae-Bacteria Community Analysis for Drinking Water Taste and Odour Risk Management" Water 17, no. 1: 79. https://doi.org/10.3390/w17010079
APA StyleHooper, A. S., Christofides, S. R., Windsor, F. M., Watson, S. E., Kille, P., & Perkins, R. G. (2025). Algae-Bacteria Community Analysis for Drinking Water Taste and Odour Risk Management. Water, 17(1), 79. https://doi.org/10.3390/w17010079