Association of LPP and ZMIZ1 Gene Polymorphism with Celiac Disease in Subjects from Punjab, Pakistan
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and DNA Extraction
2.2. Genetic Analysis
2.3. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gallegos, C.; Merkel, R. Current evidence in the diagnosis and treatment of children with celiac disease. Gastroenterol. Nurs. 2019, 42, 41–48. [Google Scholar] [CrossRef] [PubMed]
- Cummins, A.G.; Roberts-Thomson, I.C. Prevalence of celiac disease in the Asia–Pacific region. J. Gastroenterol. Hepatol. 2009, 24, 1347–1351. [Google Scholar] [CrossRef] [PubMed]
- Al-Hakami, A.M. Seroprevalence of coeliac disease in at-risk subjects at the main tertiary hospital, southwest of Saudi Arabia. Arab J. Gastroenterol. 2016, 17, 41–44. [Google Scholar] [CrossRef] [PubMed]
- Younes, N.; Younes, S.; Alsharabasi, O.; El Zowalaty, M.E.; Mustafa, I.; Jahromi, M.; Uddin, S.; Al-Nesf, M.; Pintus, G.; Zayed, H. Immunogenetics of Celiac Disease: A focus on Arab countries. Curr. Mol. Med. 2020, 20, 275–285. [Google Scholar] [CrossRef] [PubMed]
- Rubio-Tapia, A.; Ludvigsson, J.F.; Brantner, T.L.; Murray, J.A.; Everhart, J.E. The prevalence of celiac disease in the United States. Off. J. Am. Coll. Gastroenterol.|ACG 2012, 107, 1538–1544. [Google Scholar] [CrossRef] [PubMed]
- Mustalahti, K.; Catassi, C.; Reunanen, A.; Fabiani, E.; Heier, M.; McMillan, S.; Murray, L.; Metzger, M.-H.; Gasparin, M.; Bravi, E. The prevalence of celiac disease in Europe: Results of a centralized, international mass screening project. Ann. Med. 2010, 42, 587–595. [Google Scholar] [CrossRef]
- Gujral, N.; Freeman, H.J.; Thomson, A.B. Celiac disease: Prevalence, diagnosis, pathogenesis and treatment. World J. Gastroenterol. WJG 2012, 18, 6036. [Google Scholar] [CrossRef]
- Roshanzamir, N.; Zakeri, Z.; Rostami-Nejad, M.; Sadeghi, A.; Pourhoseingholi, M.-A.; Shahbakhsh, Y.; Asadzadeh-Aghdaei, H.; Elli, L.; Zali, M.-R.; Rezaei-Tavirani, M. Prevalence of celiac disease in patients with atypical presentations. Arab. J. Gastroenterol. 2021, 22, 220–223. [Google Scholar] [CrossRef]
- Lebwohl, B.; Sanders, D.S.; Green, P.H. Coeliac disease. Lancet 2018, 391, 70–81. [Google Scholar] [CrossRef]
- Kamiński, M.; Nowak, J.K.; Skonieczna-Żydecka, K.; Stachowska, E. Gluten-free diet yesterday, today and tomorrow: Forecasting using Google Trends data. Arab. J. Gastroenterol. Off. Publ. Pan-Arab. Assoc. Gastroenterol. 2020, 21, 67–68. [Google Scholar] [CrossRef]
- Green, P.H.; Cellier, C. Celiac disease. N. Engl. J. Med. 2007, 357, 1731–1743. [Google Scholar] [CrossRef] [PubMed]
- Rubio-Tapia, A.; Hill, I.D.; Kelly, C.P.; Calderwood, A.H.; Murray, J.A. American College of Gastroenterology clinical guideline: Diagnosis and management of celiac disease. Am. J. Gastroenterol. 2013, 108, 656. [Google Scholar] [CrossRef] [PubMed]
- Murray, J.A.; Watson, T.; Clearman, B.; Mitros, F. Effect of a gluten-free diet on gastrointestinal symptoms in celiac disease. Am. J. Clin. Nutr. 2004, 79, 669–673. [Google Scholar] [CrossRef]
- Lebwohl, B.; Murray, J.A.; Rubio-Tapia, A.; Green, P.H.; Ludvigsson, J.F. Predictors of persistent villous atrophy in coeliac disease: A population-based study. Aliment. Pharmacol. Ther. 2014, 39, 488–495. [Google Scholar] [CrossRef]
- Fasano, A.; Berti, I.; Gerarduzzi, T.; Not, T.; Colletti, R.B.; Drago, S.; Elitsur, Y.; Green, P.H.; Guandalini, S.; Hill, I.D. Prevalence of celiac disease in at-risk and not-at-risk groups in the United States: A large multicenter study. Arch. Intern. Med. 2003, 163, 286–292. [Google Scholar] [CrossRef] [PubMed]
- Murad, H.; Jazairi, B.; Khansaa, I.; Olabi, D.; Khouri, L. HLA-DQ2 and-DQ8 genotype frequency in Syrian celiac disease children: HLA-DQ relative risks evaluation. BMC Gastroenterol. 2018, 18, 70. [Google Scholar] [CrossRef] [PubMed]
- Serena, G.; Lima, R.; Fasano, A. Genetic and environmental contributors for celiac disease. Curr. Allergy Asthma Rep. 2019, 19, 40. [Google Scholar] [CrossRef]
- Gnodi, E.; Meneveri, R.; Barisani, D. Celiac disease: From genetics to epigenetics. World J. Gastroenterol. 2022, 28, 449. [Google Scholar] [CrossRef]
- Huang, S.-Q.; Zhang, N.; Zhou, Z.-X.; Huang, C.-C.; Zeng, C.-L.; Xiao, D.; Guo, C.-C.; Han, Y.-J.; Ye, X.-H.; Ye, X.-G. Association of LPP and TAGAP polymorphisms with celiac disease risk: A meta-analysis. Int. J. Environ. Res. Public Health 2017, 14, 171. [Google Scholar] [CrossRef]
- Nanayakkara, M.; Kosova, R.; Lania, G.; Sarno, M.; Gaito, A.; Galatola, M.; Greco, L.; Cuomo, M.; Troncone, R.; Auricchio, S. A celiac cellular phenotype, with altered LPP sub-cellular distribution, is inducible in controls by the toxic gliadin peptide P31-43. PLoS ONE 2013, 8, e79763. [Google Scholar] [CrossRef]
- Sun, Y.; Zuo, X.; Zheng, X.; Zhou, F.; Liang, B.; Liu, H.; Chang, R.; Gao, J.; Sheng, Y.; Cui, H. A comprehensive association analysis confirms ZMIZ1 to be a susceptibility gene for vitiligo in Chinese population. J. Med. Genet. 2014, 51, 345–353. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Fan, Y.; Wang, Y.; Xu, J.; Xu, H. ZMIZ1 promotes the proliferation and migration of melanocytes in vitiligo. Exp. Ther. Med. 2020, 20, 1371–1378. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Han, H.; Niu, Y.; Li, X.; Du, X.; Wang, Q. LPP polymorphisms are risk factors for allergic rhinitis in the Chinese Han population. Cytokine 2022, 159, 156027. [Google Scholar] [CrossRef] [PubMed]
- Howarth, S.; Sneddon, G.; Allinson, K.R.; Razvi, S.; Mitchell, A.L.; Pearce, S.H. Replication of association at the LPP and UBASH3A loci in a UK autoimmune Addison’s disease cohort. Eur. J. Endocrinol. 2023, 188, lvac010. [Google Scholar] [CrossRef] [PubMed]
- Mirjalali, H.; Tavakoli, S. Genetic and environmental factors of gluten-related disorders. In Gluten-Related Disorders; Elsevier: Amsterdam, The Netherlands, 2022; pp. 83–94. [Google Scholar]
- Almeida, R.; Ricaño-Ponce, I.; Kumar, V.; Deelen, P.; Szperl, A.; Trynka, G.; Gutierrez-Achury, J.; Kanterakis, A.; Westra, H.-J.; Franke, L. Fine mapping of the celiac disease-associated LPP locus reveals a potential functional variant. Hum. Mol. Genet. 2014, 23, 2481–2489. [Google Scholar] [CrossRef] [PubMed]
- Dubois, P.C.; Trynka, G.; Franke, L.; Hunt, K.A.; Romanos, J.; Curtotti, A.; Zhernakova, A.; Heap, G.A.; Ádány, R.; Aromaa, A. Multiple common variants for celiac disease influencing immune gene expression. Nat. Genet. 2010, 42, 295–302. [Google Scholar] [CrossRef] [PubMed]
- Hunt, K.A.; Zhernakova, A.; Turner, G.; Heap, G.A.; Franke, L.; Bruinenberg, M.; Romanos, J.; Dinesen, L.C.; Ryan, A.W.; Panesar, D. Newly identified genetic risk variants for celiac disease related to the immune response. Nat. Genet. 2008, 40, 395–402. [Google Scholar] [CrossRef]
- Coenen, M.J.; Trynka, G.; Heskamp, S.; Franke, B.; Van Diemen, C.C.; Smolonska, J.; Van Leeuwen, M.; Brouwer, E.; Boezen, M.H.; Postma, D.S. Common and different genetic background for rheumatoid arthritis and coeliac disease. Hum. Mol. Genet. 2009, 18, 4195–4203. [Google Scholar] [CrossRef]
- Rashid, M.; Khan, A.G. Celiac disease in Pakistan: Challenges and opportunities. J. Ayub Med. Coll. Abbottabad 2009, 21, 1–2. [Google Scholar]
- Rashid, M.; Rashid, H. Coeliac disease in Pakistan: A bibliographic review of current research status. JPMA J. Pak. Med. Assoc. 2019, 69, 1883–1888. [Google Scholar] [CrossRef]
- Marsh, M.N. Gluten, major histocompatibility complex, and the small intestine: A molecular and immunobiologic approach to the spectrum of gluten sensitivity (‘celiac sprue’). Gastroenterology 1992, 102, 330–354. [Google Scholar] [CrossRef] [PubMed]
- Yousaf, M.; Khan, W.A.; Shahzad, K.; Khan, H.N.; Ali, B.; Hussain, M.; Awan, F.R.; Mustafa, H.; Sheikh, F.N. Genetic Association of Beta-Myosin Heavy-Chain Gene (MYH7) with Cardiac Dysfunction. Genes 2022, 13, 1554. [Google Scholar] [CrossRef] [PubMed]
- Hussain, M.; Khan, H.N.; Awan, F.R. Development and application of low-cost T-ARMS-PCR assay for AGT and CYP11B1 gene polymorphisms. Mol. Biol. Rep. 2019, 46, 443–449. [Google Scholar] [CrossRef] [PubMed]
- Stricker, S.; Müller, M.; Zimmer, K.-P.; Jacob, R. Altered Posttranslational Modification of Microtubules Contributes to Disturbed Enterocyte Morphology in Celiac Disease. Int. J. Mol. Sci. 2023, 24, 2635. [Google Scholar] [CrossRef]
- Plaza-Izurieta, L.; Castellanos-Rubio, A.; Irastorza, I.; Fernández-Jimenez, N.; Gutierrez, G.; Bilbao, J.R. Revisiting genome wide association studies (GWAS) in coeliac disease: Replication study in Spanish population and expression analysis of candidate genes. J. Med. Genet. 2011, 48, 493–496. [Google Scholar] [CrossRef]
- Romanos, J.; Van Diemen, C.C.; Nolte, I.M.; Trynka, G.; Zhernakova, A.; Fu, J.; Bardella, M.T.; Barisani, D.; McManus, R.; Van Heel, D.A. Analysis of HLA and non-HLA alleles can identify individuals at high risk for celiac disease. Gastroenterology 2009, 137, 834–840.e833. [Google Scholar] [CrossRef]
- Sallese, M.; Efthymakis, K.; Marchioni, M.; Neri, B.; Dufrusine, B.; Dainese, E.; Di Nicola, M.; Neri, M. Gene Expression Profiling in Coeliac Disease Confirmed the Key Role of the Immune System and Revealed a Molecular Overlap with Non-Celiac Gluten Sensitivity. Int. J. Mol. Sci. 2023, 24, 7769. [Google Scholar] [CrossRef]
- Sharma, A.; Liu, X.; Hadley, D.; Hagopian, W.; Liu, E.; Chen, W.-M.; Onengut-Gumuscu, S.; Simell, V.; Rewers, M.; Ziegler, A.-G. Identification of non-HLA genes associated with celiac disease and country-specific differences in a large, international pediatric cohort. PLoS ONE 2016, 11, e0152476. [Google Scholar] [CrossRef]
- Amundsen, S.S.; Rundberg, J.; Adamovic, S.; Gudjónsdóttir, A.; Ascher, H.; Ek, J.; Nilsson, S.; Lie, B.A.; Naluai, Å.T.; Sollid, L.M. Four novel coeliac disease regions replicated in an association study of a Swedish–Norwegian family cohort. Genes Immun. 2010, 11, 79–86. [Google Scholar] [CrossRef]
- Garner, C.; Murray, J.; Ding, Y.; Tien, Z.; Van Heel, D.; Neuhausen, S. Replication of celiac disease UK genome-wide association study results in a US population. Hum. Mol. Genet. 2009, 18, 4219–4225. [Google Scholar] [CrossRef]
- Romanos, J.; Barisani, D.; Trynka, G.; Zhernakova, A.; Bardella, M.T.; Wijmenga, C. Six new coeliac disease loci replicated in an Italian population confirm association with coeliac disease. J. Med. Genet. 2009, 46, 60–63. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Yao, W.; Pan, Q.; Tang, X.; Zhao, S.; Wang, W.; Zhu, Z.; Gao, J.; Sheng, Y.; Zhou, F. Association analysis revealed one susceptibility locus for vitiligo with immune-related diseases in the Chinese Han population. Immunogenetics 2015, 67, 347–354. [Google Scholar] [CrossRef] [PubMed]
- Taylor, J.C.; Bongartz, T.; Massey, J.; Mifsud, B.; Spiliopoulou, A.; Scott, I.C.; Wang, J.; Morgan, M.; Plant, D.; Colombo, M. Genome-wide association study of response to methotrexate in early rheumatoid arthritis patients. Pharmacogenom. J. 2018, 18, 528–538. [Google Scholar] [CrossRef] [PubMed]
- Alghamdi, T.A.; Krentz, N.A.; Smith, N.; Spigelman, A.F.; Rajesh, V.; Jha, A.; Ferdaoussi, M.; Suzuki, K.; Yang, J.; Fox, J.E.M. Zmiz1 is required for mature β-cell function and mass expansion upon high fat feeding. Mol. Metab. 2022, 66, 101621. [Google Scholar] [CrossRef]
- Abenavoli, L.; Dastoli, S.; Bennardo, L.; Boccuto, L.; Passante, M.; Silvestri, M.; Proietti, I.; Potenza, C.; Luzza, F.; Nisticò, S.P. The skin in celiac disease patients: The other side of the coin. Medicina 2019, 55, 578. [Google Scholar] [CrossRef]

| Primer Name | Primer Sequence (5′ to 3′) | Amplicon Size | Annealing Temperature |
|---|---|---|---|
| rs1464510 F inner | GTCCATAGATGTGATCCTGAAACTGATTTGAGAA | Control = 678 bp Allele A = 233 bp Allele C = 509 bp | 66 °C |
| rs1464510 R inner | AATGGCAACACAGTAAAAATGAACCAGGGTG | ||
| rs1464510 F outer | GGTGGTACTTATGGGAATACAGGCTTCAG | ||
| rs1464510 R outer | CAAGCTACTCACTAGTTTTTGTAAGAGAGGCTAG | ||
| rs1250552 F inner | GCAGGACAGAGATCTGCGAGAGAGACGG | Control = 646 bp Allele G = 316 bp Allele A = 384 bp | 54 °C |
| rs1250552 R inner | GGAGGAGAGCCTCCTCCAGGGAACCT | ||
| rs1250552 F outer | AAACAAGGAGAGGGAGAGGGGTTCCTGG | ||
| rs1250552 R outer | ATATTTGGCTTGATGTCAGGCGGGAAGG |
| Genetic Variants | Healthy Control N = 39 | Patients N = 31 | Significance | ||
|---|---|---|---|---|---|
| LPP rs1464510 | Genotypes | AA | 20 (51%) | 7 (23%) | χ2 = 6.033 p = 0.049 |
| AC | 15 (39%) | 19 (61%) | |||
| CC | 4 (10%) | 5 (16%) | |||
| Alleles | A | 55 (71%) | 33 (53%) | χ2 = 4.421 p = 0.035 | |
| C | 23 (29%) | 29 (47%) | |||
| ZMIZ1 rs1254552 | Genotypes | AA | 9(23%) | 16(52%) | χ2 = 5.49 p = 0.064 |
| GG | 9(23%) | 10(32%) | |||
| AG | 21(54%) | 5(16%) | |||
| Alleles | A | 39(50%) | 37(60%) | χ2 = 3.867 p = 0.049 | |
| G | 39(50%) | 25(40%) | |||
| Genetic Variant | Model | Multinomial Regression Odds Ratio (95% Confidence Interval) p-Value | |
|---|---|---|---|
| LPP rs1464510 | Co-dominant model | AA | 0.28 (0.058–1.35) 0.11 |
| AC | 1.01 (0.23–4.45) 0.98 | ||
| CC | Ref | ||
| Recessive | CA+CC | 3.65 (1.25–10.63) 0.017 | |
| AA | Ref | ||
| Dominant | CA+AA | 0.68 (0.15–2.60) 0.52 | |
| CC | Ref | ||
| alleles | A | 0.48 (0.24–0.96) 0.037 | |
| C | Ref | ||
| ZMIZ1 rs1250552 | Co-dominant model | AA | Ref |
| AG | 0.26 (0.077–0.867) 0.028 | ||
| GG | 0.31 (0.069–1.36) 0.121 | ||
| Recessive | GG | Ref | |
| AA+AG | 1.56 (0.41–5.86) 0.52 | ||
| Dominant | AA | Ref | |
| AG+GG | 0.27 (0.09–0.83) 0.022 | ||
| Alleles | A | Ref | |
| G | 0.47 (0.22–1.00) 0.051 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zulfiqar, S.; Fiaz, A.; Khan, W.A.; Hussain, M.; Ali, A.; Ahmed, N.; Ali, B.; Masood, M.A. Association of LPP and ZMIZ1 Gene Polymorphism with Celiac Disease in Subjects from Punjab, Pakistan. Genes 2024, 15, 852. https://doi.org/10.3390/genes15070852
Zulfiqar S, Fiaz A, Khan WA, Hussain M, Ali A, Ahmed N, Ali B, Masood MA. Association of LPP and ZMIZ1 Gene Polymorphism with Celiac Disease in Subjects from Punjab, Pakistan. Genes. 2024; 15(7):852. https://doi.org/10.3390/genes15070852
Chicago/Turabian StyleZulfiqar, Sumaira, Amna Fiaz, Waqas Ahmed Khan, Misbah Hussain, Ansar Ali, Nadeem Ahmed, Basharat Ali, and Muhammad Adnan Masood. 2024. "Association of LPP and ZMIZ1 Gene Polymorphism with Celiac Disease in Subjects from Punjab, Pakistan" Genes 15, no. 7: 852. https://doi.org/10.3390/genes15070852
APA StyleZulfiqar, S., Fiaz, A., Khan, W. A., Hussain, M., Ali, A., Ahmed, N., Ali, B., & Masood, M. A. (2024). Association of LPP and ZMIZ1 Gene Polymorphism with Celiac Disease in Subjects from Punjab, Pakistan. Genes, 15(7), 852. https://doi.org/10.3390/genes15070852

