Chloroplast Genes Are Involved in The Male-Sterility of K-Type CMS in Wheat
Abstract
1. Introduction
2. Materials and Methods
2.1. Material Planting
2.2. CTAB Extraction of DNA and Chloroplast Genome Sequencing
2.3. Genome Assembly and Annotation
2.4. Codon Preference Analysis of Chloroplast Gene
2.5. Simple Sequence Repeat (SSR) and Long Repeat Sequence Analysis
2.6. Gene Alignment Analysis and Phylogenetic Analysis
2.7. Quantitative Real-Time PCR (qPCR) Analysis
2.8. Functional Verification of Candidate Genes via the BSMV-VIGS Method
2.8.1. Construction of γ-Gene Vector
2.8.2. Linearization and in Vitro Transcription of γ-Gene Vector
2.8.3. Creation of Transfection Mixture and Virus Infection of Seedlings
2.8.4. Detection of Silencing Efficiency and Phenotypes
3. Results
3.1. Genome Sequencing and Chloroplast Assembly
3.2. Genome Content and Characteristics
3.3. Discovery of Possible SSRs in K519A and 519B
3.4. Discovery of Possible Long Repeat Sequences in K519A and 519B
3.5. Alignment for Protein-Coding Genes between CS, 519B, K519A, and YS3038
3.6. The Verification of Nonsynonymous Mutant Sites between K519A and 519B by First-Generation Sequencing
3.7. Phylogenetic Analysis of K519A and 519B
3.8. The qPCR of Nonsynonymous Mutation Genes
3.9. Function Analysis of Candidate Genes by BSMV-VIGS Method
4. Discussion
4.1. Plant Chloroplast Genomics Research and Phylogenetic Analysis
4.2. SSR Molecular Marker
4.3. Chloroplast Genes Related to Cytoplasmic Male Sterility
4.4. Phylogenetic Relationship of Important Crops Based on Chloroplast Sequences
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| BSMV-VIGS | Barley stripe mosaic virus-induced gene silencing |
| CMS | Cytoplasmic male sterility |
| GMS | Genic male sterility |
| FGS | First-generation sequencing |
References
- Asseng, S.; Foster, L.; Neil, C.T. The impact of temperature variability on wheat yields. Glob. Change Biol. 2011, 17, 997–1012. [Google Scholar] [CrossRef]
- Hussain, S.S.; Rivandi, A. Molecualr breeding for drought tolerance in plants:wheat perspective. Proc. Pak. Acad. Sci. 2007, 44, 35–62. [Google Scholar]
- Stachel, M.; Lelley, T.; Grausgruber, H.; Vollmann, J. Application of microsatellites in wheat (Triticum aestivum L.) for studying genetic differentiation caused by selection for adaptation and use. Theor. Appl. Genet. 2000, 100, 242–248. [Google Scholar] [CrossRef]
- Day, L.; Augustin, M.A.; Batey, I.L.; Wrigley, C.W. Wheat-gluten uses and industry needs. Trends Food Sci. Technol. 2006, 17, 82–90. [Google Scholar] [CrossRef]
- Li, W.; Liu, S. The relationship among yield structure heterosis of strong heterosis hybrid wheat. J. Triticeae Crops 2002, 22, 1–6. [Google Scholar]
- Wu, L.; Ni, Z.; Wang, Z.; Lin, Z.; Sun, Q. Relationship between differential expression patterns of multigene families and heterosis in a wheat diallel crosses. Acta Genet. Sin. 2001, 28, 256–266. [Google Scholar] [PubMed]
- Kihara, H. Substitution of nucleus and its effects on genome manifestations. Cytologia 1951, 16, 177–193. [Google Scholar] [CrossRef]
- Wilson, J.A.; Ross, W.M. Male sterility interaction of the Triticum aestivum nueleus and Triticum timopheevi cytoplasm. Wheat Inf. Serv. Kyoto Univ. 1962, 14, 14–29. [Google Scholar]
- Wilson, J.A.; Ross, W.M. Crossbreeding in wheat, Triticum aestivum. L. frequensy of the pollen-restoring character in hybrid wheats having Aegilops ovata Cytoplasm1. Crop Sci. 1961, 1, 191–193. [Google Scholar] [CrossRef]
- Zhang, G.; Yang, T. A preliminary on the male sterile lines of wheat with Ae.ventricosa, Ae.kotschyi and Ae.vauiabilis cytoplasms. Crop J. 1989, 15, 1–10. [Google Scholar]
- He, B.; Ning, Y.; Liu, S.; Feng, Y. A preliminary studies on the male sterile system of 1B/1R wheat varieties with Ae.Kotschyi cytoplasm. J. Northwest A F Univ. 1987, 15, 107–109. [Google Scholar]
- Gong, H.; Ma, L.; He, B.; Fan, C.; Wu, H.; Li, W. Changes of RNase and protein content in the fertility sensitive period of wheat male sterile lines. J. Triticeae Crops 2008, 28, 37–40. [Google Scholar]
- Yao, Y.; Zhang, G.; Liu, H.; Wang, J. Correlation between the inner wall of pollen grains of K-type wheat and ATPase activity and male sterility. Acta Bot. Boreali-Occident. Sin. 2002, 22, 333–337. [Google Scholar]
- Zhang, F.; Li, G.; Ding, Q.; Wang, Z.; Ma, X.; Zhang, H.; Zhang, Z.; Jin, F.; Ma, L. Proteome analysis of pollen in the K-type male sterility line 732A and its maintainer 732B in wheat (Triticum aestivum L.) by two-dimensional gel electrophoresis. Acta Physiol. Plant. 2016, 38, 84. [Google Scholar] [CrossRef]
- Yang, W.; Lou, X.; Li, J.; Pu, M.; Mirbahar, A.A.; Liu, D.; Sun, J.; Zhan, K.; He, L.; Zhang, A. Cloning and functional analysis of MADS-box genes, TaAG-A and TaAG-B, from a wheat K-type cytoplasmic male sterile line. Front. Plant Sci. 2017, 8, 1081. [Google Scholar] [CrossRef]
- Downie, S.R.; Jansen, R.K. A comparative analysis of whole plastid genomes from the Apiales: Expansion and contraction of the inverted repeat, mitochondrial to plastid transfer of DNA, and identification of highly divergent noncoding regions. Syst. Bot. 2015, 40, 336–351. [Google Scholar] [CrossRef]
- Sundberg, E.; Slagter, J.G.; Fridborg, I.; Cleary, S.P.; Robinson, C.; Coupland, G. ALBINO3, an Arabidopsis nuclear gene essential for chloroplast differentiation, encodes a chloroplast protein that shows homology to proteins present in bacterial membranes and yeast mitochondria. Plant Cell 1997, 9, 717–730. [Google Scholar]
- Woodson, J.D.; Chory, J. Coordination of gene expression between organellar and nuclear genomes. Nat. Rev. Genet. 2008, 9, 383–395. [Google Scholar] [CrossRef]
- Kenji, O.; Katsuyuki, Y.; Eiji, O.; Yasukazu, N.; Miho, T.; Naoko, N.; Kinya, A.; Kanji, O. Transfer RNA genes in the mitochondrial genome from a liverwort, Marchantia polymorpha: The absence of chloroplast-like tRNAs. Nucleic Acids Res. 1992, 20, 3773–3777. [Google Scholar]
- Tsunewaki, K. Interorganellar DNA transfer in wheat: Dynamics and phylogenetic origin. Proc. Jpn. Acad.B-Phys. 2011, 87, 529–549. [Google Scholar] [CrossRef][Green Version]
- Xing, Q.; Ru, Z.; Li, J.; Zhou, C.; Jin, D.; Sun, Y.; Wang, B. Cloning a second form of adenine phosphoribosyl transferase gene (TaAPT2) from wheat and analysis of its association with thermo-sensitive genic male sterility (TGMS). Plant Sci. 2005, 169, 37–45. [Google Scholar] [CrossRef]
- Timmis, J.N.; Ayliffe, M.A.; Huang, C.Y.; Martin, W. Endosymbiotic gene transfer: Organelle genomes forge eukaryotic chromosomes. Nat. Rev. Genet. 2004, 5, 123–135. [Google Scholar] [CrossRef]
- Lough, A.N.; Roark, L.M.; Kato, A.; Ream, T.S.; Lamb, J.C.; Birchler, J.A.; Newton, K.J. Mitochondrial DNA transfer to the nucleus generates extensive insertion site variation in maize. Genetics 2008, 178, 47–55. [Google Scholar] [CrossRef]
- Shaya, F.; Gaiduk, S.; Keren, I.; Shevtsov, S.; Zemah, H.; Belausov, E.; Evenor, D.; Reuveni, M.; Ostersetzerbiran, O. Expression of mitochondrial gene fragments within the tapetum induce male sterility by limiting the biogenesis of the respiratory machinery in transgenic tobacco. J. Integr. Plant Biol. 2012, 54, 115–130. [Google Scholar] [CrossRef] [PubMed]
- Reddemann, A.; Horn, R. Recombination events involving the atp9 gene are associated with male sterility of CMS PET2 in sunflower. Int. J. Mol. Sci. 2018, 19, 806. [Google Scholar] [CrossRef]
- Naresh, V.; Singh, S.; Watts, A.; Kumar, P.; Kumar, V.; Rao, K.R.S.S.; Bhat, S.R. Mutations in the mitochondrial orf108 render Moricandia arvensis restorer ineffective in restoring male fertility to Brassica oxyrrhina-based cytoplasmic male sterile line of B. juncea. Mol. Breed. 2016, 36, 67. [Google Scholar] [CrossRef]
- Kazama, T.; Itabashi, E.; Fujii, S.; Nakamura, T.; Toriyama, K. Mitochondrial ORF79 levels determine pollen abortion in cytoplasmic male sterile rice. Plant J. 2016, 85, 707–716. [Google Scholar] [CrossRef] [PubMed]
- Ohta, H.; Ogino, A.; Kasai, M.; Sano, Y.; Kanazawa, A. Fertility restoration by Ifr1 in rice with BT-type cytoplasmic male sterility is associated with a reduced level, but not processing, of atp6-orf79 cotranscribed RNA. Plant Cell Rep. 2010, 29, 359–369. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Liu, Y. Male sterility and fertility restoration in crops. Annu. Rev. Plant Biol. 2014, 65, 579–606. [Google Scholar] [CrossRef] [PubMed]
- Tang, H.; Zheng, X.; Li, C.; Xie, X.; Chen, Y. Multi-step formation, evolution and functionalization of new cytoplasmic male sterility genes in the plant mitochondrial genomes. Cell Res. 2016, 27, 130–146. [Google Scholar] [CrossRef] [PubMed]
- Charlesworth, D. Origins of rice cytoplasmic male sterility genes. Cell Res. 2017, 27, 3–4. [Google Scholar] [CrossRef][Green Version]
- Kazama, T.; Nakamura, T.; Watanabe, M.; Sugita, M.; Toriyama, K. Suppression mechanism of mitochondrial ORF79 accumulation by Rf1 protein in BT-type cytoplasmic male sterile rice. Plant J. 2008, 55, 619–628. [Google Scholar] [CrossRef]
- Yang, J.H.; Zhang, M.F.; Yu, J.Q. Mitochondrial nad2 gene is co-transcripted with CMS-associated orfB gene in cytoplasmic male-sterile stem mustard (Brassica juncea). Mol. Biol. Rep. 2009, 36, 345–351. [Google Scholar] [CrossRef]
- An, H.; Yang, Z.; Yi, B.; Wen, J.; Shen, J.; Tu, J.; Ma, C.; Fu, T. Comparative transcript profiling of the fertile and sterile flower buds of pol CMS in B. napus. BMC Genom. 2014, 15, 258. [Google Scholar] [CrossRef]
- Dong, X.; Kim, W.K.; Lim, Y.P.; Kim, Y.; Hur, Y. Ogura-CMS in Chinese cabbage (Brassica rapa ssp. pekinensis) causes delayed expression of many nuclear genes. Plant Sci. 2013, 199, 7–17. [Google Scholar]
- Wicke, S.; Schneeweiss, G.M.; de Pamphilis, C.W.; Müller, K.F.; Quandt, D. The evolution of the plastid chromosome in land plants: Gene content, gene order, gene function. Plant Mol. Biol. 2011, 76, 273–297. [Google Scholar] [CrossRef]
- Jansen, R.K.; Raubeson, L.A.; Boore, J.L.; Depamphilis, C.W.; Cui, L. Methods for obtaining and analyzing whole chloroplast genome sequences. Method. Enzymol. 2005, 395, 348–384. [Google Scholar]
- Schaefer, H.; Heibl, C.; Renner, S.S. Gourds afloat: A dated phylogeny reveals an Asian origin of the gourd family (Cucurbitaceae) and numerous oversea dispersal events. Proc. R. Soc. B-Biol. Sci. 2009, 276, 843–851. [Google Scholar] [CrossRef]
- Sajjad, A.; Muhammad, W.; Abdul Latif, K.; Muhammad Aaqil, K.; Sang-Mo, K.; Qari Muhammad, I.; Raheem, S.; Saqib, B.; Byung-Wook, Y.; In-Jung, L. The complete chloroplast genome of wild rice (Oryza minuta) and its comparison to related species. Front. Plant Sci. 2017, 8, 304. [Google Scholar]
- Hu, M.; Chen, Z.; Wang, B. Comparison on leaf ultrastructure in cytoplasmic male sterile line for tuber mustard (Brassica juncea var. tumida). J. Zhejiang Univ. 2001, 27, 535–540. [Google Scholar]
- Li, J.; Li, J. Chloroplast thylakoid membrane peptides and cytoplasmic male sterility. J. Genet. Genom. 1986, 13, 430–436. [Google Scholar]
- Li, J.; Gao, W. Studies on ultrastructure of chloroplast in cytoplasmic male sterile lines and their maintainer lines of rape. J. Genet. Genom. 1983, 10, 280–283. [Google Scholar]
- Chen, Z.; Muthukrishnan, S.; Liang, G.H.; Schertz, K.F.; Hart, G.E. A chloroplast DNA deletion located in RNA polymerase gene rpoC2 in CMS lines of sorghum. Mol. Gen. Genet. MGG 1993, 236, 251–259. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Cheng, Y.; Cui, J.; Zhang, P.; Zhao, H.; Hu, S. Comparative transcriptome analysis reveals carbohydrate and lipid metabolism blocks in Brassica napus L. male sterility induced by the chemical hybridization agent monosulfuron ester sodium. BMC Genom. 2015, 16, 206. [Google Scholar] [CrossRef] [PubMed]
- Hahn, C.; Bachmann, L.; Chevreux, B. Reconstructing mitochondrial genomes directly from genomic next-generation sequencing reads—A baiting and iterative mapping approach. Nucleic Acids Res. 2013, 41, e129. [Google Scholar] [CrossRef] [PubMed]
- Anton, B.; Sergey, N.; Dmitry, A.; Gurevich, A.; Mikhail, D.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar]
- Liu, C.; Shi, L.; Zhu, Y.; Chen, H.; Zhang, J.; Lin, X.; Guan, X. CpGAVAS, an integrated web server for the annotation, visualization, analysis, and GenBank submission of completely sequenced chloroplast genome sequences. BMC Genom. 2012, 13, 715. [Google Scholar] [CrossRef] [PubMed]
- Rédei, G.P. Encyclopedia of Genetics, Genomics, Proteomics and Informatics; Springer: New York, NY, USA, 2008; Volume 1, p. 1102. [Google Scholar]
- Sakai, H.; Washio, T.; Saito, R.; Shinagawa, A.; Tomita, M. Correlation between sequence conservation of the 5′ untranslated region and codon usage bias in Mus musculus genes. Gene 2001, 276, 101–105. [Google Scholar] [CrossRef]
- Thiel, T.; Michalek, W.; Varshney, R.; Graner, A. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor. Appl. Genet. 2003, 106, 411–422. [Google Scholar] [CrossRef]
- Kurtz, S.; Schleiermacher, C. REPuter: Fast computation of maximal repeats in complete genomes. Bioinformatics 1999, 15, 426–427. [Google Scholar] [CrossRef]
- Tamura, K.; Dudley, J.T.; Nei, M.; Kumar, S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 2007, 24, 1596–1599. [Google Scholar] [CrossRef]
- Chung, S.M.; Staub, J.E.; Chen, J.F. Molecular phylogeny of Cucumis species as revealed by consensus chloroplast SSR marker length and sequence variation. Genome 2006, 49, 219–229. [Google Scholar] [CrossRef]
- Vieira, L.D.N.; Helisson, F.; Marcelo, R.; de Freitas Fraga, H.P.; Alves, C.R.L.; de Souza, M.E.; Pedrosa, F.d.O.; Onofre, N.R.; Pedro, G.M.; Gertrud, M.U. The complete chloroplast genome sequence of Podocarpus Lambertii: Genome structure, evolutionary aspects, gene content and SSR detection. PLoS ONE 2014, 9, e90618. [Google Scholar] [CrossRef]
- Cai, Z.; Guisinger, M.; Kim, H.; Ruck, E.; Blazier, J.C.; McMurtry, V.; Kuehl, J.V.; Boore, J.; Jansen, R.K. Extensive reorganization of the plastid genome of Trifolium subterraneum (Fabaceae) is associated with numerous repeated sequences and novel DNA insertions. J. Mol. Evol. 2008, 67, 696–704. [Google Scholar] [CrossRef]
- Biscotti, M.A.; Canapa, A.; Forconi, M.; Olmo, E.; Barucca, M. Transcription of tandemly repetitive DNA: Functional roles. Chromosome Res. 2015, 23, 463–477. [Google Scholar] [CrossRef]
- Cavalier-Smith, T. Chloroplast evolution: Secondary symbiogenesis and multiple losses. Curr. Biol. 2002, 12, R62–R64. [Google Scholar] [CrossRef]
- Shimda, H.; Sugiuro, M. Fine structural features of the chloroplast genome: Comparison of the sequenced chloroplast genomes. Nucleic Acids Res. 1991, 19, 983–995. [Google Scholar] [CrossRef]
- Shinozaki, K.; Ohme, M.; Tanaka, M.; Wakasugi, T.; Hayashida, N.; Matsubayashi, T.; Zaita, N.; Chunwongse, J.; Obokata, J.; Yamaguchishinozaki, K. The complete nucleotide sequence of the tobacco chloroplast genome: Its gene organization and expression. Plant Mol. Biol. Report. 1986, 5, 2043–2049. [Google Scholar] [CrossRef]
- Zhao, Y.; Yin, J.; Guo, H.; Zhang, Y.; Xiao, W.; Sun, C.; Wu, J.; Qu, X.; Yu, J.; Wang, X. The complete chloroplast genome provides insight into the evolution and polymorphism of Panax ginseng. Front. Plant Sci. 2015, 5, 696. [Google Scholar] [CrossRef]
- Alkan, C.; Sajjadian, S.; Eichler, E.E. Limitations of next-generation genome sequence assembly. Nat. Methods 2010, 8, 61–65. [Google Scholar] [CrossRef]
- Huang, H.; Shi, C.; Liu, Y.; Mao, S.; Gao, L. Thirteen Camellia chloroplast genome sequences determined by high-throughput sequencing: Genome structure and phylogenetic relationships. BMC Evol. Biol. 2014, 14, 151. [Google Scholar] [CrossRef] [PubMed]
- Margulies, M.; Egholm, M.; Altman, W.E.; Attiya, S.; Bader, J.S.; Bemben, L.A.; Berka, J.; Braverman, M.S.; Chen, Y.; Chen, Z. Genome sequencing in microfabricated high-density picolitre reactors. Nature 2005, 437, 376–380. [Google Scholar] [CrossRef]
- Zhong, L.; Zhou, W.; Wang, H.; Ding, S.; Lu, Q.; Wen, X.; Peng, L.; Zhang, L.; Lu, C. Chloroplast small heat shock protein HSP21 interacts with plastid nucleoid protein pTAC5 and is essential for chloroplast development in Arabidopsis under heat stress. Plant Cell 2013, 25, 2925–2943. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Yang, X.; Chen, S.; Wang, Y.; Li, J.; Shen, Q.; Liu, X.; Guo, F.; Qu, L. Downregulation of chloroplast RPS1 negatively modulates nuclear heat-responsive expression of HsfA2 and its target genes in Arabidopsis. PLoS Genet. 2012, 8, e1002669. [Google Scholar] [CrossRef] [PubMed]
- Ueda, M.; Fujimoto, M.; Arimura, S.-I.; Murata, J.; Tsutsumi, N.; Kadowaki, K.I. Loss of the rpl32 gene from the chloroplast genome and subsequent acquisition of a preexisting transit peptide within the nuclear gene in Populus. Gene 2007, 402, 51–56. [Google Scholar] [CrossRef] [PubMed]
- Haberle, R.C.; Fourcade, H.M.; Boore, J.L.; Jansen, R.K. Extensive rearrangements in the chloroplast genome of Trachelium caeruleum are associated with repeats and tRNA genes. J. Mol. Evol. 2008, 66, 350–361. [Google Scholar] [CrossRef]
- Korlach, J.; Bjornson, K.P.; Chaudhuri, B.P.; Cicero, R.L.; Flusberg, B.A.; Gray, J.J.; Holden, D.; Saxena, R.; Wegener, J.L.; Turner, S.W. Chapter 20—Real-Time DNA sequencing from single polymerase molecules. Science 2009, 323, 133–138. [Google Scholar]
- Middleton, C.P.; Senerchia, N.; Stein, N.; Akhunov, E.D.; Keller, B.; Wicker, T.; Kilian, B. Sequencing of chloroplast genomes from wheat, barley, rye and their relatives provides a detailed insight into the evolution of the Triticeae tribe. PLoS ONE 2014, 9, e85761. [Google Scholar] [CrossRef]
- Braslavsky, I.; Hebert, B.; Kartalov, E.P.; Quake, S.R. Sequence information can be obtained from single DNA molecules. Proc. Natl. Acad. Sci. USA 2003, 100, 3960–3964. [Google Scholar] [CrossRef]
- Salameh, A.; Buerstmayr, M.; Steiner, B.; Neumayer, A.; Lemmens, M.; Buerstmayr, H. Effects of introgression of two QTL for fusarium head blight resistance from Asian spring wheat by marker-assisted backcrossing into European winter wheat on fusarium head blight resistance, yield and quality traits. Mol. Breed. 2011, 28, 485–494. [Google Scholar] [CrossRef]
- Shim, D.; Raveendar, S.; Lee, J.; Lee, G.; Ro, N.; Jeon, Y.; Cho, G.; Lee, H.; Ma, K.; Chung, J. The complete chloroplast genome of Capsicum Frutescens (Solanaceae). Appl. Plant Sci. 2016, 4, 1600002. [Google Scholar] [CrossRef]
- Xia, C.; Zhang, L.; Zou, C.; Gu, Y.; Duan, J.; Zhao, G.; Wu, J.; Liu, Y.; Fang, X.; Gao, L. A TRIM insertion in the promoter of Ms2 causes male sterility in wheat. Nat. Commun. 2017, 8, 15407. [Google Scholar] [CrossRef]
- Chen, K.; Meyer, V.G. Mutation in chloroplast DNA coding for the large subunit of fraction 1 protein correlated with male sterility in cotton. J. Hered. 1979, 70, 431–433. [Google Scholar] [CrossRef]
- Von Kohn, C.; Kielkowska, A.; Havey, M.J. Sequencing and annotation of the chloroplast DNAs and identification of polymorphisms distinguishing normal male-fertile and male-sterile cytoplasms of onion. Genome 2013, 56, 737–742. [Google Scholar] [CrossRef]
- Jia, J.; Zhang, L.G. mRNA differential display and EST sequence analysis of aborted bud and normal bud in radish (Raphanus sativus). J. Nucl. Agric. Sci. 2008, 22, 426–431. [Google Scholar]
- Ou, L.J.; Huang, G.W.; Li, W.J.; Kang, G.P.; Chen, J.L.; Luan, S.; Chen, L.B. Chloroplast DNA polymorphism in different types of cytoplasmic male sterile rice. Biol. Plant. 2009, 53, 593–596. [Google Scholar] [CrossRef]
- Little, M.C.; Hallick, R.B. Chloroplast rpoA, rpoB, and rpoC genes specify at least three components of a chloroplast DNA-dependent RNA polymerase active in tRNA and mRNA transcription. J. Biol. Chem. 1988, 263, 14302–14307. [Google Scholar] [CrossRef]
- Chen, Z.; Schertz, K.F.; Mullet, J.E.; Dubell, A.; Hart, G.E. Characterization and expression of rpoC2 in CMS and fertile lines of sorghum. Plant Mol. Biol. 1995, 28, 799–809. [Google Scholar] [CrossRef]
- Källersjö, M.; Farris, J.S.; Chase, M.W.; Bremer, B.; Fay, M.F.; Humphries, C.J.; Petersen, G.; Seberg, O.; Bremer, K. Simultaneous parsimony jackknife analysis of 2538 rbcL DNA sequences reveals support for major clades of green plants, land plants, seed plants and flowering plants. Plant Syst. Evol. 1998, 213, 259–287. [Google Scholar] [CrossRef]
- Bruneau, A.; Forest, F.; Herendeen, P.S.; Klitgaard, B.B.; Lewis, G.P. Phylogenetic relationships in the Caesalpinioideae (Leguminosae) as inferred from chloroplast trnL intron sequences. Syst. Bot. 2001, 26, 487–514. [Google Scholar]
- Kim, K.J.; Lee, H.L. Complete chloroplast genome wequences from Korean Ginseng (Panax schinseng Nees) and comparative analysis of sequence evolution among 17 Vascular plants. DNA Res. 2004, 11, 247–261. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.X.; Li, R.; Worth, J.R.P.; Li, X.; Li, P.; Cameron, K.M.; Fu, C.X. The complete chloroplast genome of chinese bayberry (Morella rubra, Myricaceae): Implications for understanding the evolution of Fagales. Front. Plant Sci. 2017, 8, 968. [Google Scholar] [CrossRef] [PubMed]
- Saski, C.A.; Lee, S.B.; Fjellheim, S.; Guda, C.; Jansen, R.K.; Luo, H.; Tomkins, J.P.; Rognli, O.A.; Daniell, H.; Clarke, J.L. Complete chloroplast genome sequences of Hordeum vulgare, Sorghum bicolor and Agrostis stolonifera, and comparative analyses with other grass genomes. Theor. Appl. Genet. 2007, 115, 571–590. [Google Scholar] [CrossRef] [PubMed]
- Matsuoka, Y.; Yamazaki, Y.; Ogihara, Y.; Tsunewaki, K. Whole chloroplast genome comparison of rice, maize, and wheat: Implications for chloroplast gene diversification and phylogeny of cereals. Mol. Biol. Evol. 2002, 19, 2084–2091. [Google Scholar] [CrossRef][Green Version]
- Saarela, J.M.; Burke, S.V.; Wysocki, W.P.; Barrett, M.D.; Clark, L.G.; Craine, J.M.; Peterson, P.M.; Soreng, R.J.; Vorontsova, M.S.; Duvall, M.R. A 250 plastome phylogeny of the grass family (Poaceae): Topological support under different data partitions. PeerJ 2018, 6, e4299. [Google Scholar] [CrossRef]
- Hollingsworth, P.M.; Graham, S.W.; Little, D.P.; Steinke, D. Choosing and using a plant DNA barcode. PLoS ONE 2011, 6, e19254. [Google Scholar] [CrossRef]
- Lima, M.S.; Woods, L.C.; Cartwright, M.W.; Smith, D.R. The (in)complete organelle genome: Exploring the use and non-use of available technologies for characterizing mitochondrial and plastid chromosomes. Mol. Ecol. Resour. 2016, 16, 1279–1286. [Google Scholar] [CrossRef]









| Category for Genes | Group of Genes | Gene Names |
|---|---|---|
| Genes for photosynthesis | ATP synthase | atpA, atpB, atpE, atpF *, atpH, atpI |
| Cytochrome b/f complex | petA, petB *, petD *, petG, petL, petN | |
| NADH dehydrogenase | ndhA *, ndhB *, ndhC, ndhD, ndhE, ndhF, ndhG, ndhH, ndhI, ndhJ, ndhK | |
| Photosystem I | psaA, psaB, psaC, psaI, psaJ | |
| Photosystem II | psbA, psbB, psbC, psbD, psbE, psbF, psbH, psbI, psbJ, psbK, psbL, psbM, psbN, psbT, psbZ | |
| Large subunit of rubisco | rbcL | |
| ATP-dependent protease subunits P gene | Clp P ** | |
| Expression related gene | Proteins of small ribosomal (SSU) | rps2, rps3, rps4, rps7, rps8, rps11, rps12 #, rps14, rps15, rps16, rps18, rps19 |
| Proteins of large ribosomal (LSU) | rpl2 *, rpl14, rpl16, rpl20, rpl23, rpl32, rpl33, rpl36 | |
| Ribosomal RNAs | rrn4.5, rrn5, rrn16, rrn23 | |
| RNA polymerase | rpoA, rpoB, rpoC1, rpoC2 | |
| Transfer RNAs | trnA-UGC *, trnC-GCA, trnD-GUC, trnE-UUC, trnF-GAA, trnfM-CAU, trnG-GCC, trnG-UCC *, trnH-GUG, trnI-CAU, trnI-GAU *, trnK-UUU *, trnL-CAA, trnL-UAA *, trnL-UAG, trnM-CAU, trnN-GUU, trnP-UGG, trnQ-UUG, trnR-UCU, trnR-ACG, trnS-GCU, trnS-GGA, trnS-UGA, trnT-GGU, trnT-UGU, trnV-GAC, trnV-UAC *, trnW-CCA, trnY-GUA | |
| Other genes | Maturase | matK |
| Envelope membrane protein | cemA | |
| C-type cytochrome synthesis gene | ccsA | |
| Translation initiation factor | infA | |
| Proteins of unknown function | Conserved open reading frame | ycf1, ycf2, ycf3 **, ycf4 |
| Amino Acid Name | Total Number of Amino Acids | Total Number of Amino Acids |
|---|---|---|
| Ala(A) | 832 | GCU (37.26%), GCC (21.63%), GCA (25.96%), GCG (15.14%) |
| Arg(R) | 1250 | CGU (16.88%), CGC (10.08%), CGA (14.16%), CGG (7.84%), AGA (31.68%), AGG (19.36%) |
| Asn(N) | 1043 | AAU (70.85%), AAC (29.15%) |
| Asp(D) | 595 | GAU (74.29%), GAC (25.71%) |
| Cys(C) | 468 | UGU (53.21%), UGC (46.79%) |
| Gln(Q) | 603 | CAA (77.78%), CAG (22.22%) |
| Glu(E) | 862 | GAA (73.20%), GAG (26.80%) |
| Gly(G) | 1166 | GGU (29.07%), GGC (14.84%), GGA (35.59%), GGG (20.50%) |
| His(H) | 562 | CAU (78.83%), CAC (21.17%) |
| Ile(I) | 1697 | AUU (42.78%), AUC (25.34%), AUA (31.88%) |
| Leu(L) | 1651 | UUA (22.71%), UUG (26.83%), CUU (21.93%), CUC (10.60%), CUA (10.30%), CUG (7.63%) |
| Lys(K) | 1148 | AAA (66.90%), AAG (33.10%) |
| Met(M) | 378 | AUG (100.00%) |
| Phe(F) | 1259 | UUU (57.11%), UUC (42.89%) |
| Pro(p) | 838 | CCU (28.28%), CCC (24.70%), CCA (36.28%), CCG (10.74%) |
| Ser(S) | 1866 | UCU (21.01%), UCC (23.26%), UCA (6.91%), UCG (10.77%), AGU (19.13%), AGC (18.92%) |
| Thr(T) | 1178 | ACU (34.38%), ACC (28.61%), ACA (19.44%), ACG (17.57%) |
| Trp(W) | 271 | UGG (100.00%) |
| Tyr(Y) | 851 | UAU (64.98%), UAC (35.02%) |
| Val(V) | 942 | GUU (35.35%), GUC (15.61%), GUA (33.01%), GUG (16.03%) |
| Stop Codon | 709 | UAG (22.99%), UGA (18.62%), UAA (58.39%) |
| Amino Acid Name | Total Number of Amino Acids | Total Number of Amino Acids |
|---|---|---|
| Ala(A) | 837 | GCU (37.40%), GCC (21.74%), GCA (26.16%), GCG (14.70%) |
| Arg(R) | 1250 | CGU (16.80%), CGC (10.16%), CGA (14.56%), CGG (8.08%), AGA (31.04%), AGG (19.36%) |
| Asn(N) | 1033 | AAU (70.86%), AAC (29.14%) |
| Asp(D) | 595 | GAU (74.29%), GAC (25.71%) |
| Cys(C) | 471 | UGU (53.08%), UGC (46.92%) |
| Gln(Q) | 601 | CAA (77.54%), CAG (22.46%) |
| Glu(E) | 861 | GAA (73.17%), GAG (26.83%) |
| Gly(G) | 1158 | GGU (28.67%), GGC (14.94%), GGA (35.84%), GGG (20.55%) |
| His(H) | 560 | CAU (78.57%), CAC (21.43%) |
| Ile(I) | 1692 | AUU (42.43%), AUC (25.24%), AUA (32.33%) |
| Leu(L) | 1675 | UUA (23.28%), UUG (26.63%), CUU (21.61%) CUC (10.69%), CUA (10.15%), CUG (7.64%) |
| Lys(K) | 1153 | AAA (67.13%), AAG (32.87%) |
| Met(M) | 380 | AUG (100.00%) |
| Phe(F) | 1261 | UUU (56.78%), UUC (43.22%) |
| Pro(p) | 848 | CCU (28.42%), CCC (24.17%), CCA (37.62%), CCG (9.79%) |
| Ser(S) | 1860 | UCU (21.08%), UCC (23.33%), UCA (7.10%), UCG (10.54%), AGU (19.25%), AGC (18.71%) |
| Thr(T) | 1177 | ACU (34.41%), ACC (28.21%), ACA (19.46%), ACG (17.93%) |
| Trp(W) | 268 | UGG (100.00%) |
| Tyr(Y) | 843 | UAU (65.36%), UAC (34.64%) |
| Val(V) | 948 | GUU (35.55%), GUC (15.30%), GUA (33.44%), GUG (15.72%) |
| Stop Codon | 710 | UAG (23.80%), UGA (18.73%), UAA (57.46%) |
| Microsatellite Sequences | Number of Base Repeats (SSR Number) | Microsatellite Sequences | Number of Base Repeats (SSR Number) |
|---|---|---|---|
| A | 8(37), 9(10), 10(5), 11(3), 12(2), 13(3), 16(1), 23(1) | GCA | 3(1) |
| C | 8(2), 9(2) | GTT | 3(2) |
| G | 8(2), 9(1) | TAA | 3(1) |
| T | 8(25), 9(18), 10(9), 11(5), 13(1) | TAT | 3(2), 4(1) |
| AT | 5(3) | TCT | 3(1) |
| TA | 5(3) | TGC | 3(1) |
| TC | 5(2) | TTC | 3(7), 4(1) |
| AAC | 3(7) | TTG | 3(1) |
| AAG | 3(3) | AACG | 3(1) |
| AAT | 3(1), 5(1) | AAGA | 3(1) |
| AGA | 3(5) | AATA | 3(1) |
| AGC | 3(1) | AGAA | 3(1) |
| AGT | 3(1) | TCCT | 3(1) |
| ATA | 3(1) | TCGT | 3(1) |
| CTT | 3(1) | TTCA | 3(1) |
| GAA | 3(2) | TTCT | 3(1) |
| GAT | 3(1) | CCATA | 3(1) |
| Microsatellite Sequences | Number of Base Repeats (SSR Number) | Microsatellite Sequences | Number of Base Repeats (SSR Number) |
|---|---|---|---|
| A | 8(40), 9(13), 10(3), 11(3), 12(3), 17(1), 18(1) | GTT | 3(2) |
| C | 8(3), 10(1) | TAA | 3(1) |
| G | 8(1), 10(1) | TAT | 3(2), 4(1) |
| T | 8(27), 9(13), 10(11), 11(2), 12(2), 13(1) | TCT | 3(1) |
| AT | 5(3), 6(1) | TGC | 3(1) |
| TA | 5(3) | TTC | 3(6), 4(1) |
| TC | 5(2) | TTG | 3(1) |
| AAC | 3(7) | AACG | 3(1) |
| AAG | 3(3) | AAGA | 3(1) |
| AAT | 3(1), 5(1) | AATA | 3(1) |
| AGA | 3(5) | AGAA | 3(1) |
| AGC | 3(1) | TCCT | 3(1) |
| AGT | 3(1) | TCGT | 3(1) |
| ATA | 3(1) | TTCA | 3(1) |
| ATT | 3(1) | TTCT | 3(1) |
| CTT | 3(1) | ATAGA | 3(1) |
| GAA | 3(2) | CCATA | 3(1) |
| GAT | 3(1) | TTTAT | 3(1) |
| GCA | 3(1) |
| K519A | 519B | ||||||
|---|---|---|---|---|---|---|---|
| Repeat Length | Starting Position | Match Direction | Starting Position | Repeat Length | Starting Position | Match Direction | Starting Position |
| 286 | 56,620 | F | 134,618 | 286 | 56,605 | F | 133,861 |
| 77 | 0 | F | 136,919 | 263 * | 56,628 | F | 133,884 |
| 40 | 66,331 | F | 66,373 | 77 | 0 | F | 136,158 |
| 38 | 38,456 | F | 40,680 | 40 | 65,528 | F | 65,570 |
| 30 | 87,709 | F | 130,393 | 38 | 38,432 | F | 40,656 |
| 30 | 130,393 | P | 130,393 | 30 | 86,907 | F | 129,632 |
| 36 | 43,404 | F | 90,709 | 30 | 129,632 | P | 129,632 |
| 36 | 43,404 | P | 127,387 | 36 | 43,403 | F | 89,907 |
| 33 | 66,338 | F | 66,380 | 36 | 43,403 | P | 126,626 |
| 29 | 7614 | P | 44,922 | 33 | 65,535 | F | 65,577 |
| 35 | 76,836 | F | 76,854 | 29 | 7613 | P | 44,931 |
| 35 | 76,845 | F | 76,863 | 35 | 76,031 | F | 76,049 |
| 37 | 66,351 | F | 66,393 | 35 | 76,040 | F | 76,058 |
| 33 | 27,173 | F | 27,224 | 37 | 65,548 | F | 65,590 |
| 29 | 27,177 | F | 27,228 | 33 | 27,181 | F | 27,232 |
| 34 | 27,251 | F | 27,272 | 29 | 27,185 | F | 27,236 |
| 34 | 66,373 | F | 66,394 | 34 | 27,259 | F | 27,280 |
| 25 | 80,343 | F | 80,388 | 34 * | 27,321 | F | 27,396 |
| 31 | 27,376 | F | 27,442 | 34 | 65,570 | F | 65,591 |
| 31 | 66,389 | F | 66,410 | 25 | 79,542 | F | 79,587 |
| 33 | 27,256 | F | 27,277 | 31 | 27,384 | F | 27,450 |
| 30 | 12,940 | F | 36,397 | 31 | 65,586 | F | 65,607 |
| 30 | 16,817 | P | 16,817 | 33 | 27,264 | F | 27,285 |
| 30 | 66,787 | P | 66,787 | 30 | 12,893 | F | 36,373 |
| 32 | 27,132 | F | 27,231 | 30 | 16,815 | P | 16,815 |
| 32 | 27,309 | F | 27,384 | 30 | 65,984 | P | 65,984 |
| 32 | 27,313 | F | 27,388 | 32 | 27,140 | F | 27,239 |
| 29 | 11,348 | P | 44,925 | 32 | 27,287 | F | 27,341 |
| 26 | 27,138 | F | 27,237 | 32 | 27,317 | F | 27,392 |
| 31 * | 27,114 | F | 27,384 | 29 | 11,303 | P | 44,934 |
| 31 | 27,301 | F | 27,442 | 26 | 27,146 | F | 27,245 |
| 28 | 36,250 | R | 36,250 | 31 | 27,309 | F | 27,450 |
| 22 | 16,821 | P | 16,821 | 28 * | 27,327 | F | 27,402 |
| 25 | 7615 | F | 11,352 | 28 | 36,225 | R | 36,225 |
| 25 | 11,352 | P | 44,925 | 22 | 16,819 | P | 16,819 |
| 30 | 66,320 | F | 66,425 | 22 * | 78,893 | R | 78,893 |
| 30 | 66,408 | F | 66,429 | 25 | 7614 | F | 11,307 |
| 27 | 27,160 | F | 27,355 | 25 | 11,307 | P | 44,934 |
| 27 | 66,373 | F | 66,415 | 30 | 65,517 | F | 65,622 |
| 21 | 7619 | F | 11,356 | 30 | 65,605 | F | 65,626 |
| 21 | 11,356 | P | 44,925 | 27 | 27,168 | F | 27,363 |
| 21 | 14,855 | P | 46,177 | 27 | 65,570 | F | 65,612 |
| 21 | 27,124 | F | 27,319 | 21 | 7618 | F | 11,311 |
| 21 | 113,039 | R | 113,039 | 21 | 11,311 | P | 44,934 |
| 29 | 27,092 | F | 27,146 | 21 | 14,864 | P | 46,185 |
| 29 | 38,447 | F | 40,671 | 21 | 27,132 | F | 27,327 |
| 26 * | 27,319 | F | 27,394 | 21 | 112,256 | R | 112,256 |
| 26 | 77,132 | F | 77,150 | 24 * | 27,259 | F | 27,334 |
| 26 * | 107,460 | P | 107,460 | 29 | 27,100 | F | 27,154 |
| 20 | 7684 | F | 11,421 | 29 | 38,423 | F | 40,647 |
| 26 | 76,327 | F | 76,345 | ||||
| 20 | 7683 | F | 11,376 | ||||
| Genes | CS (Reference Sequence) | 519B | K519A | YS3038 | Genes | CS (Reference Sequence) | 519B | K519A | YS3038 |
|---|---|---|---|---|---|---|---|---|---|
| atpA | 792C, 1164T | C, T | T, G | T, G | psaB | 456G, 750C, 940C, 1155G, 1644G | G, C, C, G, G | A, G, A, C, A | A, G, A, C, A |
| atpB | 35C-12A, 56G-19S, 164A-55D, 321T, 651G, 1215T, 1489C-497Q | C-A, A-N, A-D, T, G, T, C-Q | T-V, G-S, C-A, C, A, C, A-K | T-V, G-S, C-A, C, A, C, A-K | psbB | 1188C, 1523C-508A | C, C-A | T, T-V | T, T-V |
| atpE | 54G | G | A | A | psbC | 147A | A | G | G |
| atpF | 378C | C, 146D:15 | T, 146D:15 | T, 146D:15 | psbD | 558T, 738A | C, A | C, C | C, C |
| atpI | 225C, 477C-159S, 555A | C, A-R, A | T, C-S, G | T, C-S, G | psbH | 133G-45V | G-V | A-I | A-I |
| ccsA | 78G-26L, 553C-185L, 858C | G-L, C-L, T | T-F, T-F, T | T-F, T-F, T | psbI | 3D:36 | 3D:36 | 3D:36 | |
| cemA | 642C | C | T | T | psbJ | 51C | C | T | T |
| clpP | 210C, 309A | G, A | A, G | A, G | psbZ | 126T | T | C | C |
| infA | none | 4I:93 | 4I:93 | 4I:93 | rbcL | 40A-14K, 284C-95S, 1429A, 1431G | A-K, G-S, A, G | C-Q, A-N, T, A, 1432I:3 | C-Q, A-N, T, A, 1432I:3 |
| matK | 54C, 100G-34D, 423T-141F, 537G, 564C, 608T-203F, 927A-309L, 1377G, 1465T-489C | C, G-D, T-F, A, C, T-F, C-F, A, T-C | T, C-H, A-L, G, T, A-Y, C-F, A, A-S | T, C-H, A-L, G, T, A-Y, C-F, A, A-S | rpl14 | 326G-109G | G-G | A-E | A-E |
| ndhA | 44G-15W, 102C, 444G, 550T | G-W, T, G, C | C-S, C, A, C | C-S, C, A, C | rpl16 | 4T, 5A, 8A, 9C, 237A | C, T, G, T, A, 4D:81 | C, T, G, T, G, 4D:81 | C, T, G, T, G, 4D:81 |
| ndhB | 783T | T | C | C | rpl2 | none | 1I:336 | 1I:336 | 1I:336 |
| ndhC | 84A, 276C | A, C | T, T | T, T | rpl32 | 172A-58N, 186T-62F | A-N, T-F | G-D, G-L | G-D, G-L |
| ndhD | 240G | A | G | G | rpoA | 219A, 625C | A, C | G, T | G, T |
| ndhE | 264G | G | A | A | rpoB | 438G, 459A, 1245A, 1284C, 1366G-456E, 1899T, 1908A, 2628A, 2937G | G, A, A, T, G-E, T, A, A, G | C, G, G, T, A-K, C, G, G, C | C, G, G, T, A-K, C, G, G, C |
| ndhF | 661G-221V, 768A, 783A, 1764T, 1989T, 2052A, 2127A | G-V, A, G, T, T, A, A | A-I, G, G, C, C, C, G | A-I, G, G, C, C, C, G | rpoC1 | 712C, 783A, 1036A, 1683T | C, A, A, T | A, T, C, C | A, T, C, C |
| ndhH | 519G-173E, 793G-265V | G-E, G-V | T-D, A-I | T-D, A-I | rpoC2 | 351C, 1002A, 1695A, 2083C-695P, 2125A-709I, 2223T, 2780C-927S, 2984A-995D, 3564C, 3789G, 4074G, 4334T-1445I, 4413C | C, A, T, C-P, A-I, T, C-S, A-D, C, A, G, T-I, C | A, G, A, T-S, C-L, C, T-F, G-G, T, G, A, A-K, T | A, G, A, T-S, C-L, C, T-F, G-G, T, G, A, A-K, T |
| ndhH-2 | none | 211 | 211D:6 | 211D:6 | rps14 | 132T, 276A | G, A | G, G | G, G |
| ndhI | 232C | C | T | T | rps16 | none | 120G, 177C-59S, 178A-60T, 4D:81 | A, A-R, G-A, 4D:81 | A, A-R, G-A, 4D:81 |
| ndhJ | 54A | A | G | G | rps18 | 162T | T | C | C |
| ndhK | 96T, 484G-162G | T, G-V, 4D:60 | C, A-I, 4D:60 | C, A-I, 4D:60 | rps2 | 552G | A | G | G |
| petA | 606C, 666A | T, A | C, G | C, G | rps3 | 90G, 597C | G, C | T, T | T, T |
| petB | 5A, 252C | G, C, 5D:51 | G, A, 5D:51 | G, A, 5D:51 | rps4 | 397A | A | C | C |
| petD | 4C, 5C, 7A, 297C, 360T | G, G, G, C, T, 4D:42 | G, G, G, T, C, 4D:42 | G, G, G, T, C, 4D:42 | rps8 | 108G | T | T | T |
| Genes | Forward Primers | Reverse Primers |
|---|---|---|
| matK | TCAACCCTTTCCTGTTTCTT | CGTCAACAATACTTTGTCTACC |
| rps16 | GCTTATGTTGGATTGGCACGAT | CCCGAAGTAATGTCTAAACCCA |
| rpoB | CGGATTGGCTCTTGGTCGTT | CGATTCGCATCATTGTGCTCAA |
| rpoC2 | GGAATCCTAGAAGACGAATACG | GACCTGTTAGTGTTCTAAGTTC |
| atpI | TCCCTGGGTTCCCTTTATTGG | AGAGCTTGAATACCGCTTGTAA |
| ndhK | GCAATTCTTGCTCATAAGTTCC | GGGAATGTTCAGTACGGATTC |
| atpB | GGACCCATATCTACTGCTGTGT | GGGCAACGAAATCAAGTCCTG |
| rbcL | CATACACAGGGTGTACGCATTA | AGATTGAGCCGAGTTTAATTGC |
| psbB | TGGTGGCGAACTTAATGGAGTA | TTGGAGTTGGTGGAACCTTAGG |
| psbH | GGCGACTAAAGTTGCTGTTTCC | CAGTCTGGTTGCGAGGTCTTAA |
| rpl14 | GGGTCGGCTGATACGCTTTA | ATGATGACAATGCTGCGGTTAT |
| ndhH | GCCAGCATATTCAGGACCAAT | AGAGCGAGTTGAAGGAGTAGG |
| ndhF | AGAGGAAGAAGTCGAGCTAGAA | TGGTCTTGGACCGTCAATAATG |
| Rpl32 | GCAGCAATAGATGTCTTTCACA | TGGAGAAGATAGGTGGAAGTTG |
| ccsA | CGAGTGGCGGCATTCTTGA | TGGAAATGAAGGGACAGAGGTT |
| ndhA | GCTTCCGAATTGATCTCATCCT | AGTTAGTGAAGGGTTAGGAACA |
| Genes | Forward Primers | Reverse Primers |
|---|---|---|
| atpB | TTGATAACCCACTGCGGAGG | CTGCCCTAACTATGGCGGAA |
| ccsA | CGGAGCGTTTGGATTCTTGG | GCCTCATTAGCCCATACTGC |
| matK | AGCGCATGAAAGTCGAAGTA | TCTTGATCGATTTGGTCGGA |
| ndhH | GTAGATCGGCGGCTACTCCT | TCGGCGCACAGACTCCTTT |
| rbcL | TGAATGCGACTGCGGGTACA | AGGCCATTGTCGCGGCAATA |
| rpoC2 | GGCTGGTGCTTCCCTTGTTG | ATCGGTCCTGCACTTGTCCT |
| Name | Forward Primers | Reverse Primers |
|---|---|---|
| atpB-VIGS | CCTTAATTAAGCAGGGTCGGTCAAATCGT | ATAAGAATGCGGCCGCTTGTTCAAGCAGGATCAGAGGT |
| ndhH-VIGS | CCTTAATTAAACCTACTCCTTCAACTCGCTCT | ATAAGAATGCGGCCGCGCTGCTACAGGTATGCGAATGA |
| atpB-qPCR | TTGATAACCCACTGCGGAGG | CTGCCCTAACTATGGCGGAA |
| ndhH-qPCR | GTAGATCGGCGGCTACTCCT | TCGGCGCACAGACTCCTTT |
| atpB-Silenced Plants | ndhH-Silenced Plants | Negative Control Plants | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Grain Number | Effective Spikelet Number | Seed Setting Percentage (%) | Grain Number | Effective Spikelet Number | Seed Setting Percentage (%) | Grain Number | Effective Spikelet Number | Seed Setting Percentage (%) | Statistical P | |
| 6 | 10 | 30.0% | 4 | 8 | 25.0% | 17 | 10 | 85.0% | 1.34448 × 10−56 | |
| 3 | 12 | 12.5% | 5 | 9 | 27.8% | 17 | 9 | 94.4% | ||
| 6 | 10 | 30.0% | 3 | 9 | 16.7% | 18 | 10 | 90.0% | ||
| 4 | 10 | 20.0% | 7 | 10 | 35.0% | 15 | 8 | 93.8% | ||
| 3 | 8 | 18.8% | 5 | 9 | 27.8% | 18 | 10 | 90.0% | ||
| 5 | 10 | 25.0% | 4 | 10 | 20.0% | 19 | 10 | 95.0% | ||
| 3 | 9 | 16.7% | 2 | 7 | 14.3% | 16 | 8 | 100.0% | ||
| 3 | 10 | 15.0% | 6 | 10 | 30.0% | 18 | 9 | 100.0% | ||
| 4 | 10 | 20.0% | 3 | 8 | 18.8% | 17 | 9 | 94.4% | ||
| 3 | 8 | 18.8% | 6 | 10 | 30.0% | 21 | 11 | 95.5% | ||
| Average | 20.7% | 24.5% | 93.8% | |||||||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, Y.; Gao, Y.; Li, Y.; Zhai, X.; Zhou, H.; Ding, Q.; Ma, L. Chloroplast Genes Are Involved in The Male-Sterility of K-Type CMS in Wheat. Genes 2022, 13, 310. https://doi.org/10.3390/genes13020310
Han Y, Gao Y, Li Y, Zhai X, Zhou H, Ding Q, Ma L. Chloroplast Genes Are Involved in The Male-Sterility of K-Type CMS in Wheat. Genes. 2022; 13(2):310. https://doi.org/10.3390/genes13020310
Chicago/Turabian StyleHan, Yucui, Yujie Gao, Yun Li, Xiaoguang Zhai, Hao Zhou, Qin Ding, and Lingjian Ma. 2022. "Chloroplast Genes Are Involved in The Male-Sterility of K-Type CMS in Wheat" Genes 13, no. 2: 310. https://doi.org/10.3390/genes13020310
APA StyleHan, Y., Gao, Y., Li, Y., Zhai, X., Zhou, H., Ding, Q., & Ma, L. (2022). Chloroplast Genes Are Involved in The Male-Sterility of K-Type CMS in Wheat. Genes, 13(2), 310. https://doi.org/10.3390/genes13020310

