Bioinformatics Identification of Aberrantly Methylated Differentially Expressed Genes Associated with Arteriosclerosis by Integrative Analysis of Gene Expression and DNA Methylation Datasets
Abstract
1. Introduction
2. Materials and Methods
2.1. Microarray Data Profile
2.2. Data Processing and Identification of DEGs and DMGs
2.3. Integrative Analysis of DNA Methylation and Gene Expression
2.4. Functional Enrichment Analysis
2.5. Protein–Protein Interaction (PPI) Network Construction and Hub Gene Identification
2.6. Validation of the Hub Genes with other GEO Datasets
2.7. Validation of Candidate Hub Genes with Human Peripheral Blood Samples
2.7.1. Peripheral Blood Mononuclear Cells Isolation
2.7.2. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)
2.7.3. Western Blot Analysis
2.8. Quantification of DNA Methylation
2.9. Statistical Analysis
3. Results
3.1. Identification of DEGs and DMGs in Human Atherosclerotic Plaques
3.2. Identification of DMGs in AS Based on Different Region CpGs
3.3. The Identification and CpG Sites Distribution of AMDEGs
3.4. DEG Enrichment Analysis
3.5. DMG Enrichment Analysis
3.6. AMDEG Enrichment Analysis
3.7. PPI Network Analysis and Hub Genes Identification
3.8. Validation of the Hub Genes in other Datasets
3.9. Validation of the Candidate Hub Genes in Human Peripheral Blood Samples
3.10. The Methylation Levels of CpG Sites in LMOD1 Promoter
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Punch, E.; Klein, J.; Diaba-Nuhoho, P.; Morawietz, H.; Garelnabi, M. Effects of PCSK9 Targeting: Alleviating Oxidation, Inflammation, and Atherosclerosis. J. Am. Heart Assoc. 2022, 11, e023328. [Google Scholar] [CrossRef] [PubMed]
- Prasher, D.; Greenway, S.C.; Singh, R.B. The Impact of Epigenetics on Cardiovascular Disease. Biochem. Cell Biol. 2020, 98, 12–22. [Google Scholar] [CrossRef] [PubMed]
- Koch, A.; Joosten, S.C.; Feng, Z.; de Ruijter, T.C.; Draht, M.X.; Melotte, V.; Smits, K.M.; Veeck, J.; Herman, J.G.; Van Neste, L.; et al. Analysis of DNA Methylation in Cancer: Location Revisited. Nat. Rev. Clin. Oncol. 2018, 15, 459–466. [Google Scholar] [CrossRef]
- Jiang, D.; Sun, M.; You, L.; Lu, K.; Gao, L.; Hu, C.; Wu, S.; Chang, G.; Tao, H.; Zhang, D. DNA Methylation and Hydroxymethylation Are Associated with the Degree of Coronary Atherosclerosis in Elderly Patients with Coronary Heart Disease. Life Sci. 2019, 224, 241–248. [Google Scholar] [CrossRef]
- Rangel-Salazar, R.; Wickström-Lindholm, M.; Aguilar-Salinas, C.A.; Alvarado-Caudillo, Y.; Døssing, K.B.V.; Esteller, M.; Labourier, E.; Lund, G.; Nielsen, F.C.; Rodríguez-Ríos, D.; et al. Human Native Lipoprotein-Induced de Novo DNA Methylation Is Associated with Repression of Inflammatory Genes in THP-1 Macrophages. BMC Genom. 2011, 12, 582. [Google Scholar] [CrossRef]
- Yoo, T.; Yoon, Y.S.; Ryu, S.H.; Ahn, J.Y.; Kim, S.; Ha, T.Y.; Chung, J.H.; Joe, C.O. Hypermethylation of Repetitive DNA Elements in Livers of Mice Fed an Atherogenic Diet. Nutrition 2012, 28, 127–130. [Google Scholar] [CrossRef]
- Chan, Y.; Fish, J.E.; D’Abreo, C.; Lin, S.; Robb, G.B.; Teichert, A.-M.; Karantzoulis-Fegaras, F.; Keightley, A.; Steer, B.M.; Marsden, P.A. The Cell-Specific Expression of Endothelial Nitric-Oxide Synthase: A Role for DNA Methylation. J. Biol. Chem. 2004, 279, 35087–35100. [Google Scholar] [CrossRef] [PubMed]
- Yideng, J.; Jianzhong, Z.; Ying, H.; Juan, S.; Jinge, Z.; Shenglan, W.; Xiaoqun, H.; Shuren, W. Homocysteine-Mediated Expression of SAHH, DNMTs, MBD2, and DNA Hypomethylation Potential Pathogenic Mechanism in VSMCs. DNA Cell Biol. 2007, 26, 603–611. [Google Scholar] [CrossRef] [PubMed]
- Steucke, K.E.; Tracy, P.V.; Hald, E.S.; Hall, J.L.; Alford, P.W. Vascular Smooth Muscle Cell Functional Contractility Depends on Extracellular Mechanical Properties. J. Biomech. 2015, 48, 3044–3051. [Google Scholar] [CrossRef]
- Lee, D.-Y.; Chiu, J.-J. Atherosclerosis and Flow: Roles of Epigenetic Modulation in Vascular Endothelium. J. Biomed. Sci. 2019, 26, 56. [Google Scholar] [CrossRef] [PubMed]
- Vemmos, K.N.; Tsivgoulis, G.; Spengos, K.; Papamichael, C.M.; Zakopoulos, N.; Daffertshofer, M.; Lekakis, J.P.; Mavrikakis, M. Common Carotid Artery Intima-Media Thickness in Patients with Brain Infarction and Intracerebral Haemorrhage. Cerebrovasc. Dis. 2004, 17, 280–286. [Google Scholar] [CrossRef]
- Stary, H.C.; Chandler, A.B.; Dinsmore, R.E.; Fuster, V.; Glagov, S.; Insull, W.; Rosenfeld, M.E.; Schwartz, C.J.; Wagner, W.D.; Wissler, R.W. A Definition of Advanced Types of Atherosclerotic Lesions and a Histological Classification of Atherosclerosis: A Report from the Committee on Vascular Lesions of the Council on Arteriosclerosis, American Heart Association. Circulation 1995, 92, 1355–1374. [Google Scholar] [CrossRef]
- Spence, J.D.; Eliasziw, M.; DiCicco, M.; Hackam, D.G.; Galil, R.; Lohmann, T. Carotid Plaque Area: A Tool for Targeting and Evaluating Vascular Preventive Therapy. Stroke 2002, 33, 2916–2922. [Google Scholar] [CrossRef]
- Song, H.; Zhang, J.; Liu, B.; Xu, J.; Cai, B.; Yang, H.; Straube, J.; Yu, X.; Ma, T. Biological Roles of RNA M5C Modification and Its Implications in Cancer Immunotherapy. Biomark. Res. 2022, 10, 15. [Google Scholar] [CrossRef]
- Martins-Ferreira, R.; Leal, B.G.; Costa, P.P. The Potential of Circulating Cell-Free DNA Methylation as an Epilepsy Biomarker. Front. Cell. Neurosci. 2022, 16, 852151. [Google Scholar] [CrossRef]
- Heikkinen, A.; Bollepalli, S.; Ollikainen, M. The Potential of DNA Methylation as a Biomarker for Obesity and Smoking. J. Intern. Med. 2022, 292, 390–408. [Google Scholar] [CrossRef]
- Pérez, R.F.; Alba-Linares, J.J.; Tejedor, J.R.; Fernández, A.F.; Calero, M.; Román-Domínguez, A.; Borrás, C.; Viña, J.; Ávila, J.; Medina, M.; et al. Blood DNA Methylation Patterns in Older Adults with Evolving Dementia. J. Gerontol. A Biol. Sci. Med. Sci. 2022, glac068. [Google Scholar] [CrossRef]
- Zaina, S.; Heyn, H.; Carmona, F.J.; Varol, N.; Sayols, S.; Condom, E.; Ramírez-Ruz, J.; Gomez, A.; Gonçalves, I.; Moran, S.; et al. DNA Methylation Map of Human Atherosclerosis. Circ. Cardiovasc. Genet. 2014, 7, 692–700. [Google Scholar] [CrossRef]
- Mangge, H.; Prüller, F.; Schnedl, W.; Renner, W.; Almer, G. Beyond Macrophages and T Cells: B Cells and Immunoglobulins Determine the Fate of the Atherosclerotic Plaque. Int. J. Mol. Sci. 2020, 21, 4082. [Google Scholar] [CrossRef]
- Chidambaram, V.; Ruelas Castillo, J.; Kumar, A.; Wei, J.; Wang, S.; Majella, M.G.; Gupte, A.; Wang, J.-Y.; Karakousis, P.C. The Association of Atherosclerotic Cardiovascular Disease and Statin Use with Inflammation and Treatment Outcomes in Tuberculosis. Sci. Rep. 2021, 11, 15283. [Google Scholar] [CrossRef]
- Huaman, M.A.; De Cecco, C.N.; Bittencourt, M.S.; Ticona, E.; Kityo, C.; Ballena, I.; Nalukwago, S.; Nazzinda, R.; Ticona, C.; Azañero, R.; et al. Latent Tuberculosis Infection and Subclinical Coronary Atherosclerosis in Peru and Uganda. Clin. Infect. Dis. 2021, 73, e3384–e3390. [Google Scholar] [CrossRef]
- Yang, H.; Sun, Y.; Li, Q.; Jin, F.; Dai, Y. Diverse Epigenetic Regulations of Macrophages in Atherosclerosis. Front. Cardiovasc. Med. 2022, 9, 868788. [Google Scholar] [CrossRef]
- Nakaoka, T.; Saito, Y.; Saito, H. Aberrant DNA Methylation as a Biomarker and a Therapeutic Target of Cholangiocarcinoma. Int. J. Mol. Sci. 2017, 18, 1111. [Google Scholar] [CrossRef]
- Hu, C.; Peng, K.; Wu, Q.; Wang, Y.; Fan, X.; Zhang, D.-M.; Passerini, A.G.; Sun, C. HDAC1 and 2 Regulate Endothelial VCAM-1 Expression and Atherogenesis by Suppressing Methylation of the GATA6 Promoter. Theranostics 2021, 11, 5605–5619. [Google Scholar] [CrossRef]
- Niu, P.-P.; Cao, Y.; Gong, T.; Guo, J.-H.; Zhang, B.-K.; Jia, S.-J. Hypermethylation of DDAH2 Promoter Contributes to the Dysfunction of Endothelial Progenitor Cells in Coronary Artery Disease Patients. J. Transl. Med. 2014, 12, 170. [Google Scholar] [CrossRef]
- Saigusa, R.; Winkels, H.; Ley, K. T Cell Subsets and Functions in Atherosclerosis. Nat. Rev. Cardiol. 2020, 17, 387–401. [Google Scholar] [CrossRef]
- Halim, D.; Wilson, M.P.; Oliver, D.; Brosens, E.; Verheij, J.B.G.M.; Han, Y.; Nanda, V.; Lyu, Q.; Doukas, M.; Stoop, H.; et al. Loss of LMOD1 Impairs Smooth Muscle Cytocontractility and Causes Megacystis Microcolon Intestinal Hypoperistalsis Syndrome in Humans and Mice. Proc. Natl. Acad. Sci. USA 2017, 114, E2739–E2747. [Google Scholar] [CrossRef]
- Meng, L.-B.; Shan, M.-J.; Qiu, Y.; Qi, R.; Yu, Z.-M.; Guo, P.; Di, C.-Y.; Gong, T. TPM2 as a Potential Predictive Biomarker for Atherosclerosis. Aging 2019, 11, 6960–6982. [Google Scholar] [CrossRef]
- Lacey, M.; Baribault, C.; Ehrlich, K.C.; Ehrlich, M. Atherosclerosis-Associated Differentially Methylated Regions Can Reflect the Disease Phenotype and Are Often at Enhancers. Atherosclerosis 2019, 280, 183–191. [Google Scholar] [CrossRef]
- Miano, J.M. Myocardin in Biology and Disease. J. Biomed. Res. 2015, 29, 3–19. [Google Scholar] [CrossRef]
- Nanda, V.; Miano, J.M. Leiomodin 1, a New Serum Response Factor-Dependent Target Gene Expressed Preferentially in Differentiated Smooth Muscle Cells. J. Biol. Chem. 2012, 287, 2459–2467. [Google Scholar] [CrossRef] [PubMed]
- Korff, T.; Pfisterer, L.; Schorpp-Kistner, M. MiR-663 and the MiRaculous Vascular Smooth Muscle Phenotypic Switch. Circ. Res. 2013, 113, 1102–1105. [Google Scholar] [CrossRef] [PubMed]
- Licht, A.H.; Nübel, T.; Feldner, A.; Jurisch-Yaksi, N.; Marcello, M.; Demicheva, E.; Hu, J.-H.; Hartenstein, B.; Augustin, H.G.; Hecker, M.; et al. Junb Regulates Arterial Contraction Capacity, Cellular Contractility, and Motility via Its Target Myl9 in Mice. J. Clin. Invest. 2010, 120, 2307–2318. [Google Scholar] [CrossRef]
- Kosiński, K.; Malinowski, D.; Safranow, K.; Dziedziejko, V.; Pawlik, A. PECAM1, COL4A2, PHACTR1, and LMOD1 Gene Polymorphisms in Patients with Unstable Angina. J. Clin. Med. 2022, 11, 373. [Google Scholar] [CrossRef]
- Miller, C.L.; Pjanic, M.; Wang, T.; Nguyen, T.; Cohain, A.; Lee, J.D.; Perisic, L.; Hedin, U.; Kundu, R.K.; Majmudar, D.; et al. Integrative Functional Genomics Identifies Regulatory Mechanisms at Coronary Artery Disease Loci. Nat. Commun. 2016, 7, 12092. [Google Scholar] [CrossRef] [PubMed]
- Shankman, L.S.; Gomez, D.; Cherepanova, O.A.; Salmon, M.; Alencar, G.F.; Haskins, R.M.; Swiatlowska, P.; Newman, A.A.C.; Greene, E.S.; Straub, A.C.; et al. KLF4-Dependent Phenotypic Modulation of Smooth Muscle Cells Has a Key Role in Atherosclerotic Plaque Pathogenesis. Nat. Med. 2015, 21, 628–637. [Google Scholar] [CrossRef]
- Howson, J.M.M.; Zhao, W.; Barnes, D.R.; Ho, W.-K.; Young, R.; Paul, D.S.; Waite, L.L.; Freitag, D.F.; Fauman, E.B.; Salfati, E.L.; et al. Fifteen New Risk Loci for Coronary Artery Disease Highlight Arterial-Wall-Specific Mechanisms. Nat. Genet. 2017, 49, 1113–1119. [Google Scholar] [CrossRef] [PubMed]
- Kasikara, C.; Schilperoort, M.; Gerlach, B.; Xue, C.; Wang, X.; Zheng, Z.; Kuriakose, G.; Dorweiler, B.; Zhang, H.; Fredman, G.; et al. Deficiency of Macrophage PHACTR1 Impairs Efferocytosis and Promotes Atherosclerotic Plaque Necrosis. J. Clin. Invest. 2021, 131, 145275. [Google Scholar] [CrossRef]
- Levula, M.; Oksala, N.; Airla, N.; Zeitlin, R.; Salenius, J.-P.; Järvinen, O.; Venermo, M.; Partio, T.; Saarinen, J.; Somppi, T.; et al. Genes Involved in Systemic and Arterial Bed Dependent Atherosclerosis--Tampere Vascular Study. PLoS ONE 2012, 7, e33787. [Google Scholar] [CrossRef]
- Xie, S.-A.; Zhang, T.; Wang, J.; Zhao, F.; Zhang, Y.-P.; Yao, W.-J.; Hur, S.S.; Yeh, Y.-T.; Pang, W.; Zheng, L.-S.; et al. Matrix Stiffness Determines the Phenotype of Vascular Smooth Muscle Cell in Vitro and in Vivo: Role of DNA Methyltransferase 1. Biomaterials 2018, 155, 203–216. [Google Scholar] [CrossRef]
- Zhu, B.; Gong, Y.; Yan, G.; Wang, D.; Wang, Q.; Qiao, Y.; Hou, J.; Liu, B.; Tang, C. Atorvastatin Treatment Modulates P16 Promoter Methylation to Regulate P16 Expression. FEBS J. 2017, 284, 1868–1881. [Google Scholar] [CrossRef]
- Elia, L.; Kunderfranco, P.; Carullo, P.; Vacchiano, M.; Farina, F.M.; Hall, I.F.; Mantero, S.; Panico, C.; Papait, R.; Condorelli, G.; et al. UHRF1 Epigenetically Orchestrates Smooth Muscle Cell Plasticity in Arterial Disease. J. Clin. Invest. 2018, 128, 2473–2486. [Google Scholar] [CrossRef]














| Gene | Primer Sequences | |
|---|---|---|
| ACTG2 | Forward | CTCAAATACCCCATTGAACACG |
| Reverse | TCAAGTGTTCATTGCTTTCTGG | |
| C1QA | Forward | GGCTACTACTACTTCACCTTCC |
| Reverse | TGGTAAATGTGACCCTTTTTGG | |
| LMOD1 | Forward | TCTAGAGTAGCCAAATATCGCC |
| Reverse | TTTTCACAGAAGTTGAGCATGG | |
| TLR1 | Forward | CTGCAACATAACTCTGCTGATC |
| Reverse | TTCTTCACCCAGAAAGAATCGT | |
| β-actin | Forward | ACAGAGCCTCGCCTTTGC |
| Reverse | CCACCATCACGCCCTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cheng, J.; Hou, Y.; Wang, C.; Guo, L. Bioinformatics Identification of Aberrantly Methylated Differentially Expressed Genes Associated with Arteriosclerosis by Integrative Analysis of Gene Expression and DNA Methylation Datasets. Genes 2022, 13, 1818. https://doi.org/10.3390/genes13101818
Cheng J, Hou Y, Wang C, Guo L. Bioinformatics Identification of Aberrantly Methylated Differentially Expressed Genes Associated with Arteriosclerosis by Integrative Analysis of Gene Expression and DNA Methylation Datasets. Genes. 2022; 13(10):1818. https://doi.org/10.3390/genes13101818
Chicago/Turabian StyleCheng, Jin, Yuli Hou, Cong Wang, and Lianrui Guo. 2022. "Bioinformatics Identification of Aberrantly Methylated Differentially Expressed Genes Associated with Arteriosclerosis by Integrative Analysis of Gene Expression and DNA Methylation Datasets" Genes 13, no. 10: 1818. https://doi.org/10.3390/genes13101818
APA StyleCheng, J., Hou, Y., Wang, C., & Guo, L. (2022). Bioinformatics Identification of Aberrantly Methylated Differentially Expressed Genes Associated with Arteriosclerosis by Integrative Analysis of Gene Expression and DNA Methylation Datasets. Genes, 13(10), 1818. https://doi.org/10.3390/genes13101818
