Characterization of the Complete Mitochondrial Genome of Ostertagia trifurcata of Small Ruminants and its Phylogenetic Associations for the Trichostrongyloidea Superfamily
Abstract
:1. Introduction
2. Materials and Methods
2.1. Collection of Worms and Extraction of DNA
2.2. Amplification of the ITS-2 of Ostertagia trifurcata
2.3. Amplification of Long Fragments and Sequencing
2.4. Gene Annotation and Sequence Analysis
2.5. Phylogenetic Analysis on Basis of the Dataset of Amino Acid Sequences
3. Results and Discussion
3.1. ITS-2 Analysis
3.2. Organization, Content and mt Genome Annotation
3.3. Phylogenetic Analysis
4. Implications and Significance
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Gasser, R.B.; Bott, N.J.; Chilton, N.B.; Hunt, P.; Beveridge, I. Toward practical, DNA-based diagnostic methods for parasitic nematodes of livestock—Bionomic and biotechnological implications. Biotechnol. Adv. 2008, 26, 325–334. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; He, S.W.; Li, H.; Guo, Q.C.; Pan, W.W.; Wang, X.J.; Zhang, J.; Liu, L.Z.; Liu, W.; Liu, Y. First survey of helminths in adult goats in Hunan Province, China. Trop. Biomed. 2014, 31, 261–269. [Google Scholar] [PubMed]
- Blaxter, M.L.; De Ley, P.; Garey, J.R.; Llu, L.X.; Scheldeman, P.; Vierstraete, A.; Vanfleteren, J.R.; Mackey, L.Y.; Dorrls, M.; Frisse, L.M.; et al. A molecular evolutionary framework for the phylum Nematoda. Nature 1998, 392, 71–75. [Google Scholar] [CrossRef] [PubMed]
- Blaxter, M.; Koutsovoulos, G. The evolution of parasitism in Nematoda. Parasitology 2015, 142, S26–S39. [Google Scholar] [CrossRef] [PubMed]
- Waghorn, T.S.; Bouchet, C.L.G.; Bekelaar, K.; Leathwick, D.M. Nematode parasites in young cattle: What role for unexpected species? N. Z. Vet. J. 2019, 67, 40–45. [Google Scholar] [CrossRef] [PubMed]
- Hoberg, E.P.; Lichtenfels, J.R. Phylogenetic systematic analysis of the Trichostrongylidae (Nematoda), with an initial assessment of coevolution and biogeography. J. Parasitol. 1994, 80, 976–996. [Google Scholar] [CrossRef] [PubMed]
- Tariq, K.A. A Review of the Epidemiology and Control of Gastrointestinal Nematode Infections of Small Ruminants. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2015, 85, 693–703. [Google Scholar] [CrossRef]
- Wall, R. Veterinary Parasitology, 4th ed.; Wiley: Hoboken, NJ, USA, 2016. [Google Scholar]
- Sun, M.M.; Liu, G.H.; Ando, K.; Woo, H.C.; Ma, J.; Sohn, W.M.; Sugiyama, H.; Zhu, X.Q. Complete mitochondrial genomes of Gnathostoma nipponicum and Gnathostoma sp., and their comparison with other Gnathostoma species. Infect. Genet. Evol. 2017, 48, 109–115. [Google Scholar] [CrossRef]
- Wolstenholme, D.R. Animal Mitochondrial DNA: Structure and Evolution. Int. Rev. Cytol. 1992, 141, 173–216. [Google Scholar]
- Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27, 1767–1780. [Google Scholar] [CrossRef] [Green Version]
- Liu, G.-H.; Lin, R.-Q.; Li, M.-W.; Liu, W.; Liu, Y.; Yuan, Z.-G.; Song, H.-Q.; Zhao, G.-H.; Zhang, K.-X.; Zhu, X.-Q. The complete mitochondrial genomes of three cestode species of Taenia infecting animals and humans. Mol. Biol. Rep. 2011, 38, 2249–2256. [Google Scholar] [CrossRef] [PubMed]
- Song, F.; Li, H.; Shao, R.; Shi, A.; Bai, X.; Zheng, X.; Heiss, E.; Cai, W. Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae). Sci. Rep. 2016, 6, 2–11. [Google Scholar] [CrossRef] [PubMed]
- Song, N.; Cai, W.; Li, H. Deep-level phylogeny of Cicadomorpha inferred from mitochondrial genomes sequenced by NGS. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Herd, K.E.; Barker, S.C.; Shao, R. The mitochondrial genome of the chimpanzee louse, Pediculus schaeffi: Insights into the process of mitochondrial genome fragmentation in the blood-sucking lice of great apes. BMC Genom. 2015, 16, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Leavengood, J.M.; Chapman, E.G.; Burkhardt, D.; Song, F.; Jiang, P.; Liu, J.; Zhou, X.; Cai, W. Mitochondrial phylogenomics of Hemiptera reveals adaptive innovations driving the diversification of true bugs. Proc. R. Soc. B Biol. Sci. 2017, 284, 20171223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, B.J.; Gu, X.B.; Yang, G.Y.; Wang, T.; Lai, W.M.; Zhong, Z.J.; Liu, G.H. Mitochondrial genomes of Heterakis gallinae and Heterakis beramporia support that they belong to the infraorder Ascaridomorpha. Infect. Genet. Evol. 2016, 40, 228–235. [Google Scholar] [CrossRef] [PubMed]
- Gouÿ De Bellocq, J.; Ferté, H.; Depaquit, J.; Justine, J.L.; Tillier, A.; Durette-Desset, M.C. Phylogeny of the Trichostrongylina (Nematoda) inferred from 28S rDNA sequences. Mol. Phylogenet. Evol. 2001, 19, 430–442. [Google Scholar] [CrossRef]
- Jex, A.R.; Hall, R.S.; Littlewood, D.T.J.; Gasser, R.B. An integrated pipeline for next-generation sequencing and annotation of mitochondrial genomes. Nucleic Acids Res. 2009, 38, 522–533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Durette-Desset, M.-C. Trichostrongyloid Nematodes and their Vertebrate Hosts: Reconstruction of the Phylogeny of a Parasitic Group. Adv. Parasitol. 1985, 24, 239–306. [Google Scholar] [PubMed]
- Durette-Desset, M.C.; Chabaud, A.G. Strongylida Nomenclature for Taxa above the Family Group. Ann. Parasitol. Hum. Comp. 1993, 68, 111–112. [Google Scholar] [CrossRef]
- Zhao, G.H.; Jia, Y.Q.; Cheng, W.Y.; Zhao, W.; Bian, Q.Q.; Liu, G.H. Characterization of the complete mitochondrial genomes of Nematodirus oiratianus and Nematodirus spathiger of small ruminants. Parasites Vectors 2014, 7, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Lin, R.Q.; Liu, G.H.; Hu, M.; Song, H.Q.; Wu, X.Y.; Li, M.W.; Zhang, Y.; Zou, F.C.; Zhu, X.Q. Oesophagostomum dentatum and Oesophagostomum quadrispinulatum: Characterization of the complete mitochondrial genome sequences of the two pig nodule worms. Exp. Parasitol. 2012, 131, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Anshary, H.; Sriwulan; Freeman, M.A.; Ogawa, K. Occurrence and molecular identification of Anisakis Dujardin, 1845 from marine fish in southern Makassar Strait, Indonesia. Korean J. Parasitol. 2014, 52, 9–19. [Google Scholar] [CrossRef]
- Hu, M.; Chilton, N.B.; Gasser, R.B. Long PCR-based amplification of the entire mitochondrial genome from single parasitic nematodes. Mol. Cell. Probes 2002, 16, 261–267. [Google Scholar] [CrossRef] [PubMed]
- Hu, M.; Jex, A.R.; Campbell, B.E.; Gasser, R.B. Long pcr amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nat. Protoc. 2007, 2, 2339–2344. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.H.; Jia, Y.Q.; Wang, Y.N.; Zhao, G.H.; Zhu, X.Q. The complete mitochondrial genome of the gullet worm gongylonema pulchrum: Gene content, arrangement, composition and phylogenetic implications. Parasites Vectors 2015, 8, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Guo, A. Complete mitochondrial genome of Anoplocephala magna solidifying the species. Korean J. Parasitol. 2016, 54, 369–373. [Google Scholar] [CrossRef]
- Laslett, D.; Canbäck, B. ARWEN: A program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 2008, 24, 172–175. [Google Scholar] [CrossRef]
- Hu, M.; Chilton, N.B.; Gasser, R.B. The mitochondrial genomes of the human hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea). Int. J. Parasitol. 2002, 32, 145–158. [Google Scholar] [CrossRef]
- Sun, M.M.; Han, L.; Zhang, F.K.; Zhou, D.H.; Wang, S.Q.; Ma, J.; Zhu, X.Q.; Liu, G.H. Characterization of the complete mitochondrial genome of Marshallagia marshalli and phylogenetic implications for the superfamily Trichostrongyloidea. Parasitol. Res. 2018, 117, 307–313. [Google Scholar] [CrossRef]
- VAN DER VEER, M.; DE VRIES, E. A single nucleotide polymorphism map of the mitochondrial genome of the parasitic nematode Cooperia oncophora. Parasitology 2004, 128, 421–431. [Google Scholar] [CrossRef] [PubMed]
- Jex, A.R.; Hu, M.; Littlewood, D.T.J.; Waeschenbach, A.; Gasser, R.B. Using 454 technology for long-PCR based sequencing of the complete mitochondrial genome from single Haemonchus contortus (Nematoda). BMC Genom. 2008, 9, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Gasser, R.B.; Jabbar, A.; Mohandas, N.; Höglund, J.; Hall, R.S.; Littlewood, D.T.J.; Jex, A.R. Assessment of the genetic relationship between Dictyocaulus species from Bos taurus and Cervus elaphus using complete mitochondrial genomic datasets. Parasites Vectors 2012, 5, 241. [Google Scholar] [CrossRef] [PubMed]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.H.; Nadler, S.A.; Liu, S.S.; Podolska, M.; D’Amelio, S.; Shao, R.; Gasser, R.B.; Zhu, X.Q. Mitochondrial phylogenomics yields strongly supported hypotheses for ascaridomorph nematodes. Sci. Rep. 2016, 6, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.H.; Wang, Y.; Xu, M.J.; Zhou, D.H.; Ye, Y.G.; Li, J.Y.; Song, H.Q.; Lin, R.Q.; Zhu, X.Q. Characterization of the complete mitochondrial genomes of two whipworms Trichuris ovis and Trichuris discolor (Nematoda: Trichuridae). Infect. Genet. Evol. 2012, 12, 1635–1641. [Google Scholar] [CrossRef] [PubMed]
- Shadel, G.S.; Clayton, D.A. Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 1997, 66, 409–435. [Google Scholar] [CrossRef]
- Lodh, N.; Caro, R.; Sofer, S.; Scott, A.; Krolewiecki, A.; Shiff, C. Diagnosis of Strongyloides stercoralis: Detection of parasite-derived DNA in urine. Acta Trop. 2016, 163, 9–13. [Google Scholar] [CrossRef]
- Fernández-Soto, P.; Sánchez-Hernández, A.; Gandasegui, J.; Bajo Santos, C.; López-Abán, J.; Saugar, J.M.; Rodríguez, E.; Vicente, B.; Muro, A. Strong-LAMP: A LAMP Assay for Strongyloides spp. Detection in Stool and Urine Samples. Towards the Diagnosis of Human Strongyloidiasis Starting from a Rodent Model. PLoS Negl. Trop. Dis. 2016, 10, e0004836. [Google Scholar] [CrossRef]
- Solórzano-García, B.; Pérez-Ponce de León, G. Helminth parasites of howler and spider monkeys in Mexico: Insights into molecular diagnostic methods and their importance for zoonotic diseases and host conservation. Int. J. Parasitol. Parasites Wildl. 2017, 6, 76–84. [Google Scholar] [CrossRef]
- Roeber, F.; Morrison, A.; Casaert, S.; Smith, L.; Claerebout, E.; Skuce, P. Multiplexed-tandem PCR for the specific diagnosis of gastrointestinal nematode infections in sheep: An European validation study. Parasites Vectors 2017, 10, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Gasser, R.B.; Chilton, N.B.; Hoste, H.; Beveridge, I. Rapid sequencing of rDNA from single worms and eggs of parasitic helminths. Nucleic Acids Res. 1993, 21, 2525–2526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, Y.; Choi, Y.; Min, B. PCR-RFLP and sequence analysis of the rDNA ITS region in the Fusarium spp. J. Microbiol. 2000, 38, 66–73. [Google Scholar]
- Lotfy, W.M.; Brant, S.V.; Ashmawy, K.I.; Devkota, R.; Mkoji, G.M.; Loker, E.S. A molecular approach for identification of paramphistomes from Africa and Asia. Vet. Parasitol. 2010, 174, 234–240. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, T.D.; Le, Q.D.; Huynh, V.V.; Nguyen, S.T.; Nguyen, T.V.; Vu-Khac, H. The development of PCR methodology for the identification of species of the tapeworm Moniezia from cattle, goats and sheep in central Vietnam. J. Helminthol. 2012, 86, 426–429. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Kern, E.; Kim, T.; Sim, M.; Kim, J.; Kim, Y.; Park, C.; Nadler, S.A.; Park, J.K. Phylogenetic analysis of two Plectus mitochondrial genomes (Nematoda: Plectida) supports a sister group relationship between Plectida and Rhabditida within Chromadorea. Mol. Phylogenet. Evol. 2017, 107, 90–102. [Google Scholar] [CrossRef] [PubMed]
- Aghazadeh, M.; Traub, R.J.; Mohandas, N.; Aland, K.V.; Reid, S.A.; McCarthy, J.S.; Jones, M.K. The mitochondrial genome of Angiostrongylus mackerrasae as a basis for molecular, epidemiological and population genetic studies. Parasites Vectors 2015, 8, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Blouin, M.S. Molecular prospecting for cryptic species of nematodes: Mitochondrial DNA versus internal transcribed spacer. Int. J. Parasitol. 2002, 32, 527–531. [Google Scholar] [CrossRef]
- Sun, M.M.; Ma, J.; Sugiyama, H.; Ando, K.; Li, W.W.; Xu, Q.M.; Liu, G.H.; Zhu, X.Q. The complete mitochondrial genomes of Gnathostoma doloresi from China and Japan. Parasitol. Res. 2016, 115, 4013–4020. [Google Scholar] [CrossRef]
Primer | Sequence (5′ to 3′) | Region |
---|---|---|
NC5 | GTAGGTGAACCTGCGGAAGGAT | ITS-2 |
NC2 | TTAGTTTCTTTTCCTCCGCT | |
37F | GGAGTAAAGTTGTATTTAAAC | rrnS-cytb |
36R | CCTCAAACTAAAACATAACC | |
45F | ACTAGTTTGTTAAGTGTTATTCCT | cytb-ox1 |
48R | ATAAACCTCAGGATGCCCAAAAAA | |
CO1F | TTTTTTGGGCATCCTGAGGTTTAT | cox1-rrnL |
40R | GAATTAAACTAATATCACGT | |
39F | TAAATGGCAGTCTTAGCGTGA | rrnL-rrnS |
4R | TCTACTTTACTACAACTTACTCC |
Gene/codons | Position and sequence length of nt | Amino acids | Start/stop codons | Anticodons |
---|---|---|---|---|
cox1 | 1–1578 (1578) | 525 | ATT/TAA | |
trnC | 1578–1634 (57) | GCA | ||
trnM | 1753–1813 (61) | CAT | ||
trnD | 1823–1876 (54) | GTC | ||
trnG | 1893–1948 (56) | TCC | ||
cox2 | 1937–2644 (708) | 235 | ATT/TAA | |
trnH | 2644–2699 (56) | GTG | ||
rrnL | 2700–4014 (1315) | |||
nad3 | 4048–4398 (351) | 116 | ATA/TAG | |
nad5 | 4405–6030 (1626) | 541 | ATT/TAA | |
trnA | 5986–6044 (59) | TGC | ||
trnP | 6102–6162 (61) | TGG | ||
trnR1 (AGR) | 6227–6288 (62) | TCT | ||
LNCR | 6289–6596 (308) | |||
trnV | 6597–6653 (57) | TAC | ||
nad6 | 6623–6928 (306) | 101 | ATT/TAA | |
nad4L | 7110–7352 (243) | 80 | ATG/TAA | |
trnW | 7332–7389 (58) | TCA | ||
trnE | 7523–7577 (55) | TTC | ||
rrnS | 7578–8270 (693) | |||
trnS | 8277–8330 (54) | TGA | ||
trnN | 8376–8431 (56) | GTT | ||
trnY | 8502–8556 (55) | GTA | ||
nad1 | 8578–9432 (855) | 284 | ATT/TAA | |
atp6 | 9428–10045 (618) | 205 | ATT/TAA | |
trnK | 10025–10088(64) | TTT | ||
trnL1 (UUR) | 10153–10210 (58) | TAA | ||
nad2 | 10302–11126 (825) | 274 | ATT/TAA | |
trnI | 11141–11205 (65) | GAT | ||
trnR2 (CGN) | 11211–11277 (67) | ACG | ||
trnQ | 11280–11336 (57) | TTG | ||
trnF | 11337–11403 (67) | GAA | ||
cytb | 11415–12251 (837) | 278 | ATA/TAA | |
trnL2 (CUN) | 12435–12490 (56) | TAG | ||
cox3 | 12401–13294 (894) | 297 | ATA/TAA | |
trnT | 13244–13301 (58) | TGT | ||
nad4 | 13301–14038 (738) | 245 | ATT/TAG | |
SNCR | 14039–14151 (113) |
Gene | A | G | C | T | A+T (%) | AT skew | GC skew |
---|---|---|---|---|---|---|---|
cox1 | 25.98 | 20.08 | 10.89 | 43.02 | 69.00 | −0.24 | −0.29 |
cox2 | 31.35 | 17.37 | 8.61 | 42.65 | 74.00 | −0.15 | −0.33 |
nad3 | 33.33 | 13.96 | 3.70 | 49.00 | 82.33 | −0.19 | −0.58 |
nad5 | 31.54 | 13.71 | 6.39 | 48.33 | 79.87 | −0.21 | −0.36 |
nad6 | 27.12 | 14.05 | 4.90 | 53.92 | 81.04 | −0.33 | −0.48 |
nad4L | 32.09 | 16.87 | 2.46 | 48.55 | 80.64 | −0.20 | −0.74 |
nad1 | 25.84 | 17.66 | 7.95 | 48.53 | 74.37 | −0.30 | −0.37 |
atp6 | 28.96 | 17.31 | 6.14 | 47.57 | 76.53 | −0.24 | −0.47 |
nad2 | 30.42 | 11.63 | 5.21 | 52.72 | 83.14 | −0.26 | −0.38 |
cytb | 27.83 | 18.87 | 9.67 | 43.84 | 71.67 | −0.22 | −0.32 |
cox3 | 28.63 | 16.55 | 7.60 | 47.20 | 75.83 | −0.24 | −0.37 |
nad4 | 29.13 | 13.41 | 7.04 | 50.40 | 79.53 | −0.26 | −0.31 |
rrnL | 37.79 | 12.24 | 6.08 | 43.87 | 81.66 | −0.07 | −0.33 |
rrnS | 36.65 | 14.71 | 7.64 | 40.98 | 77.63 | −0.05 | −0.31 |
LNCR | 37.66 | 16.88 | 2.92 | 42.53 | 80.19 | −0.06 | −0.70 |
SNCR | 32.74 | 10.61 | 13.27 | 43.36 | 76.10 | −0.13 | −0.11 |
Overall | 32.78 | 14.88 | 6.98 | 45.35 | 78.13 | −0.16 | −0.36 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ahmad, A.A.; Yang, X.; Zhang, T.; Wang, C.; Zhou, C.; Yan, X.; Hassan, M.; Ikram, M.; Hu, M. Characterization of the Complete Mitochondrial Genome of Ostertagia trifurcata of Small Ruminants and its Phylogenetic Associations for the Trichostrongyloidea Superfamily. Genes 2019, 10, 107. https://doi.org/10.3390/genes10020107
Ahmad AA, Yang X, Zhang T, Wang C, Zhou C, Yan X, Hassan M, Ikram M, Hu M. Characterization of the Complete Mitochondrial Genome of Ostertagia trifurcata of Small Ruminants and its Phylogenetic Associations for the Trichostrongyloidea Superfamily. Genes. 2019; 10(2):107. https://doi.org/10.3390/genes10020107
Chicago/Turabian StyleAhmad, Awais Ali, Xin Yang, Ting Zhang, Chunqun Wang, Caixian Zhou, Xingrun Yan, Mubashar Hassan, Muhammad Ikram, and Min Hu. 2019. "Characterization of the Complete Mitochondrial Genome of Ostertagia trifurcata of Small Ruminants and its Phylogenetic Associations for the Trichostrongyloidea Superfamily" Genes 10, no. 2: 107. https://doi.org/10.3390/genes10020107