New Insights in Microplastic Cellular Uptake Through a Cell-Based Organotypic Rainbow-Trout (Oncorhynchus mykiss) Intestinal Platform
Abstract
1. Introduction
2. Materials and Methods
2.1. Microplastic Features
2.2. Cell Lines
2.3. Preliminary Experiments on Plastic Surfaces
2.4. Neutral Red Uptake (NRU) Assay
2.5. Estimation of MP Internalization
2.6. Immunostaining for Zonula Occludens-1 (ZO-1)
2.7. Cell-Based Organotypic Platform Assembling
2.8. Establishment of an Effective Intestinal Barrier In Vitro
2.9. MP Exposure and Evaluation of Cellular Response
2.10. Histology
2.11. Evaluation of MP Distribution with Confocal Microscopy
2.12. Molecular Analyses
2.13. Statistical Analysis
3. Results
3.1. Cell Morphology and Viability
3.2. MP Internalization
3.3. Zonula Occludens-1 (ZO-1) Immunostaining
3.4. Measurements of the Transepithelial Electrical Resistance (TEER)
3.5. MP Migration Throught the 3D Scaffold
3.6. Confocal Microscopy
3.7. Gene Expression Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rajendran, S.; Hodzic, A.; Soutis, C.; MariamAl-Maadeed, A. Review of Life Cycle Assessment on Polyolefins and Related Materials. Plast. Rubber Compos. 2012, 41, 159–168. [Google Scholar] [CrossRef]
- Heidbreder, L.M.; Bablok, I.; Drews, S.; Menzel, C. Tackling the Plastic Problem: A Review on Perceptions, Behaviors, and Interventions. Sci. Total Environ. 2019, 668, 1077–1093. [Google Scholar] [CrossRef] [PubMed]
- Leal Filho, W.; Saari, U.; Fedoruk, M.; Iital, A.; Moora, H.; Klöga, M.; Voronova, V. An Overview of the Problems Posed by Plastic Products and the Role of Extended Producer Responsibility in Europe. J. Clean. Prod. 2019, 214, 550–558. [Google Scholar] [CrossRef]
- Geyer, R.; Jambeck, J.R.; Law, K.L. Production, Use, and Fate of All Plastics Ever Made. Sci. Adv. 2017, 3, e1700782. [Google Scholar] [CrossRef] [PubMed]
- Nikiema, J.; Asiedu, Z. A Review of the Cost and Effectiveness of Solutions to Address Plastic Pollution. Environ. Sci. Pollut. Res. 2022, 29, 24547–24573. [Google Scholar] [CrossRef]
- Du, H.; Xie, Y.; Wang, J. Microplastic Degradation Methods and Corresponding Degradation Mechanism: Research Status and Future Perspectives. J. Hazard. Mater. 2021, 418, 126377. [Google Scholar] [CrossRef]
- Tirkey, A.; Upadhyay, L.S.B. Microplastics: An Overview on Separation, Identification and Characterization of Microplastics. Mar. Pollut. Bull. 2021, 170, 112604. [Google Scholar] [CrossRef]
- Wu, C.; Xiong, X.; Hamidian, A.H.; Zhang, Y.; Xu, X. A Review on Source, Occurrence, and Impacts of Microplastics in Freshwater Aquaculture Systems in China. Water Biol. Secur. 2022, 1, 100040. [Google Scholar] [CrossRef]
- Vázquez-Rowe, I.; Ita-Nagy, D.; Kahhat, R. Microplastics in Fisheries and Aquaculture: Implications to Food Sustainability and Safety. Curr. Opin. Green Sustain. Chem. 2021, 29, 100464. [Google Scholar] [CrossRef]
- Yancheva, V.; Georgieva, E.; Velcheva, I.; Iliev, I.; Stoyanova, S.; Vasileva, T.; Bivolarski, V.; Todorova-Bambaldokova, D.; Zulkipli, N.; Antal, L.; et al. Assessment of the Exposure of Two Pesticides on Common Carp (Cyprinus carpio Linnaeus, 1758): Are the Prolonged Biomarker Responses Adaptive or Destructive? Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2022, 261, 109446. [Google Scholar] [CrossRef]
- Nyeste, K.; Dobrocsi, P.; Czeglédi, I.; Czédli, H.; Harangi, S.; Baranyai, E.; Simon, E.; Nagy, S.A.; Antal, L. Age and Diet-Specific Trace Element Accumulation Patterns in Different Tissues of Chub (Squalius cephalus): Juveniles Are Useful Bioindicators of Recent Pollution. Ecol. Indic. 2019, 101, 1–10. [Google Scholar] [CrossRef]
- Nyeste, K.; Zulkipli, N.; Uzochukwu, I.E.; Somogyi, D.; Nagy, L.; Czeglédi, I.; Harangi, S.; Baranyai, E.; Simon, E.; Nagy, S.A.; et al. Assessment of Trace and Macroelement Accumulation in Cyprinid Juveniles as Bioindicators of Aquatic Pollution: Effects of Diets and Habitat Preferences. Sci. Rep. 2024, 14, 11288. [Google Scholar] [CrossRef] [PubMed]
- Saad, D.; Chauke, P.; Cukrowska, E.; Richards, H.; Nikiema, J.; Chimuka, L.; Tutu, H. First Biomonitoring of Microplastic Pollution in the Vaal River Using Carp Fish (Cyprinus carpio) “as a Bio-Indicator”. Sci. Total Environ. 2022, 836, 155623. [Google Scholar] [CrossRef] [PubMed]
- Kılıç, E.; Yücel, N. Microplastic Occurrence in the Gastrointestinal Tract and Gill of Bioindicator Fish Species in the Northeastern Mediterranean. Mar. Pollut. Bull. 2022, 177, 113556. [Google Scholar] [CrossRef]
- Yao, C.; Liu, X.; Wang, H.; Sun, X.; Qian, Q.; Zhou, J. Occurrence of Microplastics in Fish and Shrimp Feeds. Bull. Environ. Contam. Toxicol. 2021, 107, 684–692. [Google Scholar] [CrossRef]
- Gomiero, A.; Haave, M.; Bjorøy, Ø.; Herzke, D.; Kögel, T.; Nikiforov, V.; Øysaed, K.B. Quantification of Microplastic in Fillet and Organs of Farmed and Wild Salmonids—A Comparison of Methods for Detection and Quantification; NORCE Reports; NORCE: Bergen, Norway, 2020; Volume 43. [Google Scholar]
- Collard, F.; Gilbert, B.; Compère, P.; Eppe, G.; Das, K.; Jauniaux, T.; Parmentier, E. Microplastics in Livers of European Anchovies (Engraulis encrasicolus, L.). Environ. Pollut. 2017, 229, 1000–1005. [Google Scholar] [CrossRef]
- McIlwraith, H.K.; Kim, J.; Helm, P.; Bhavsar, S.P.; Metzger, J.S.; Rochman, C.M. Evidence of Microplastic Translocation in Wild-Caught Fish and Implications for Microplastic Accumulation Dynamics in Food Webs. Environ. Sci. Technol. 2021, 55, 12372–12382. [Google Scholar] [CrossRef]
- Li, Z.; Chao, M.; He, X.; Lan, X.; Tian, C.; Feng, C.; Shen, Z. Microplastic Bioaccumulation in Estuary-Caught Fishery Resource. Environ. Pollut. 2022, 306, 119392. [Google Scholar] [CrossRef]
- Goswami, P.; Vinithkumar, N.V.; Dharani, G. First Evidence of Microplastics Bioaccumulation by Marine Organisms in the Port Blair Bay, Andaman Islands. Mar. Pollut. Bull. 2020, 155, 111163. [Google Scholar] [CrossRef]
- Bhatt, V.; Chauhan, J.S. Microplastic in Freshwater Ecosystem: Bioaccumulation, Trophic Transfer, and Biomagnification. Environ. Sci. Pollut. Res. 2022, 30, 9389–9400. [Google Scholar] [CrossRef]
- Batel, A.; Linti, F.; Scherer, M.; Erdinger, L.; Braunbeck, T. Transfer of Benzo[a]Pyrene from Microplastics to Artemia Nauplii and Further to Zebrafish via a Trophic Food Web Experiment: CYP1A Induction and Visual Tracking of Persistent Organic Pollutants. Environ. Toxicol. Chem. 2016, 35, 1656–1666. [Google Scholar] [CrossRef] [PubMed]
- Egea-Corbacho, A.; Martín-García, A.P.; Franco, A.A.; Albendín, G.; Arellano, J.M.; Rodríguez-Barroso, R.; Coello, M.D.; Quiroga, J.M.; Cabello, J.F.; Iglesias Prado, I.; et al. Microplastic in Industrial Aquaculture: Occurrence in the Aquatic Environment, Feed and Organisms (Dicentrarchus labrax). Sci. Total Environ. 2023, 904, 166774. [Google Scholar] [CrossRef] [PubMed]
- Matias, R.S.; Gomes, S.; Barboza, L.G.A.; Almeida, C.M.R.; Marques, A.; Guilhermino, L.; Valente, L.M.P. Occurrence of Microplastics and Metals in European Seabass Produced in Different Aquaculture Systems: Implications for Human Exposure, Risk, and Food Safety. Sci. Total Environ. 2024, 929, 172535. [Google Scholar] [CrossRef] [PubMed]
- Alberghini, L.; Truant, A.; Santonicola, S.; Colavita, G.; Giaccone, V. Microplastics in Fish and Fishery Products and Risks for Human Health: A Review. Int. J. Environ. Res. Public Health 2023, 20, 789. [Google Scholar] [CrossRef] [PubMed]
- Guzzetti, E.; Sureda, A.; Tejada, S.; Faggio, C. Microplastic in Marine Organism: Environmental and Toxicological Effects. Environ. Toxicol. Pharmacol. 2018, 64, 164–171. [Google Scholar] [CrossRef]
- Bobori, D.C.; Dimitriadi, A.; Feidantsis, K.; Samiotaki, A.; Fafouti, D.; Sampsonidis, I.; Kalogiannis, S.; Kastrinaki, G.; Lambropoulou, D.A.; Kyzas, G.Z.; et al. Differentiation in the Expression of Toxic Effects of Polyethylene-Microplastics on Two Freshwater Fish Species: Size Matters. Sci. Total Environ. 2022, 830, 154603. [Google Scholar] [CrossRef]
- Choi, J.S.; Jung, Y.-J.; Hong, N.-H.; Hong, S.H.; Park, J.-W. Toxicological Effects of Irregularly Shaped and Spherical Microplastics in a Marine Teleost, the Sheepshead Minnow (Cyprinodon variegatus). Mar. Pollut. Bull. 2018, 129, 231–240. [Google Scholar] [CrossRef]
- Chouchene, K.; da Costa, J.P.; Chamkha, M.; Ksibi, M.; Sayadi, S. Effects of Microplastics’ Physical and Chemical Properties on Aquatic Organisms: State-of-the-Art and Future Research Trends. TrAC Trends Anal. Chem. 2023, 166, 117192. [Google Scholar] [CrossRef]
- Zhang, C.; Pan, Z.; Wang, S.; Xu, G.; Zou, J. Size and Concentration Effects of Microplastics on Digestion and Immunity of Hybrid Snakehead in Developmental Stages. Aquac. Rep. 2022, 22, 100974. [Google Scholar] [CrossRef]
- Lu, Y.; Zhang, Y.; Deng, Y.; Jiang, W.; Zhao, Y.; Geng, J.; Ding, L.; Ren, H. Uptake and Accumulation of Polystyrene Microplastics in Zebrafish (Danio rerio) and Toxic Effects in Liver. Environ. Sci. Technol. 2016, 50, 4054–4060. [Google Scholar] [CrossRef]
- Su, L.; Deng, H.; Li, B.; Chen, Q.; Pettigrove, V.; Wu, C.; Shi, H. The Occurrence of Microplastic in Specific Organs in Commercially Caught Fishes from Coast and Estuary Area of East China. J. Hazard. Mater. 2019, 365, 716–724. [Google Scholar] [CrossRef] [PubMed]
- Qiao, R.; Lu, K.; Deng, Y.; Ren, H.; Zhang, Y. Combined Effects of Polystyrene Microplastics and Natural Organic Matter on the Accumulation and Toxicity of Copper in Zebrafish. Sci. Total Environ. 2019, 682, 128–137. [Google Scholar] [CrossRef] [PubMed]
- Ma, C.; Chen, Q.; Li, J.; Li, B.; Liang, W.; Su, L.; Shi, H. Distribution and Translocation of Micro- and Nanoplastics in Fish. Crit. Rev. Toxicol. 2021, 51, 740–753. [Google Scholar] [CrossRef] [PubMed]
- Zarantoniello, M.; Cattaneo, N.; Conti, F.; Carrino, M.; Cardinaletti, G.; Şener, İ.; Olivotto, I. Mitigating Dietary Microplastic Accumulation and Oxidative Stress Response in European Seabass (Dicentrarchus labrax) Juveniles Using a Natural Microencapsulated Antioxidant. Antioxidants 2024, 13, 812. [Google Scholar] [CrossRef]
- Cattaneo, N.; Zarantoniello, M.; Conti, F.; Frontini, A.; Chemello, G.; Dimichino, B.; Marongiu, F.; Cardinaletti, G.; Gioacchini, G.; Olivotto, I. Dietary Microplastic Administration during Zebrafish (Danio rerio) Development: A Comprehensive and Comparative Study between Larval and Juvenile Stages. Animals 2023, 13, 2256. [Google Scholar] [CrossRef]
- Capó, X.; Company, J.J.; Alomar, C.; Compa, M.; Sureda, A.; Grau, A.; Hansjosten, B.; López-Vázquez, J.; Quintana, J.B.; Rodil, R.; et al. Long-Term Exposure to Virgin and Seawater Exposed Microplastic Enriched-Diet Causes Liver Oxidative Stress and Inflammation in Gilthead Seabream Sparus Aurata, Linnaeus 1758. Sci. Total Environ. 2021, 767, 144976. [Google Scholar] [CrossRef]
- Rios-Fuster, B.; Arechavala-Lopez, P.; García-Marcos, K.; Alomar, C.; Compa, M.; Álvarez, E.; Julià, M.M.; Solomando Martí, A.; Sureda, A.; Deudero, S. Experimental Evidence of Physiological and Behavioral Effects of Microplastic Ingestion in Sparus Aurata. Aquat. Toxicol. 2021, 231, 105737. [Google Scholar] [CrossRef]
- Wan, Z.; Wang, C.; Zhou, J.; Shen, M.; Wang, X.; Fu, Z.; Jin, Y. Effects of Polystyrene Microplastics on the Composition of the Microbiome and Metabolism in Larval Zebrafish. Chemosphere 2019, 217, 646–658. [Google Scholar] [CrossRef]
- Das, B.C.; Ramanan, P.A.; Gorakh, S.S.; Pillai, D.; Vattiringal Jayadradhan, R.K. Sub-Chronic Exposure of Oreochromis Niloticus to Environmentally Relevant Concentrations of Smaller Microplastics: Accumulation and Toxico-Physiological Responses. J. Hazard. Mater. 2023, 458, 131916. [Google Scholar] [CrossRef]
- Su, Q.-L.; Wu, J.; Tan, S.-W.; Guo, X.-Y.; Zou, D.-Z.; Kang, K. The Impact of Microplastics Polystyrene on the Microscopic Structure of Mouse Intestine, Tight Junction Genes and Gut Microbiota. PLoS ONE 2024, 19, e0304686. [Google Scholar] [CrossRef]
- Kim, S.A.; Kim, L.; Kim, T.H.; An, Y.J. Assessing the Size-Dependent Effects of Microplastics on Zebrafish Larvae through Fish Lateral Line System and Gut Damage. Mar. Pollut. Bull. 2022, 185, 114279. [Google Scholar] [CrossRef] [PubMed]
- Gao, N.; Rezaee, F. Airway Epithelial Cell Junctions as Targets for Pathogens and Antimicrobial Therapy. Pharmaceutics 2022, 14, 2619. [Google Scholar] [CrossRef] [PubMed]
- Tsukita, K.; Yano, T.; Tamura, A.; Tsukita, S. Reciprocal Association between the Apical Junctional Complex and AMPK: A Promising Therapeutic Target for Epithelial/Endothelial Barrier Function? Int. J. Mol. Sci. 2019, 20, 6012. [Google Scholar] [CrossRef] [PubMed]
- Von Moos, N.; Burkhardt-Holm, P.; Köhler, A. Uptake and Effects of Microplastics on Cells and Tissue of the Blue Mussel Mytilus edulis L. after an Experimental Exposure. Environ. Sci. Technol. 2012, 46, 11327–11335. [Google Scholar] [CrossRef]
- González-Acedo, A.; García-Recio, E.; Illescas-Montes, R.; Ramos-Torrecillas, J.; Melguizo-Rodríguez, L.; Costela-Ruiz, V.J. Evidence from In Vitro and In Vivo Studies on the Potential Health Repercussions of Micro- and Nanoplastics. Chemosphere 2021, 280, 130826. [Google Scholar] [CrossRef]
- Powell, J.J.; Faria, N.; Thomas-McKay, E.; Pele, L.C. Origin and Fate of Dietary Nanoparticles and Microparticles in the Gastrointestinal Tract. J. Autoimmun. 2010, 34, J226–J233. [Google Scholar] [CrossRef]
- Liu, Y.; Workalemahu, B.; Jiang, X. The Effects of Physicochemical Properties of Nanomaterials on Their Cellular Uptake In Vitro and In Vivo. Small 2017, 13, 1701815. [Google Scholar] [CrossRef]
- Kulkarni, S.A.; Feng, S.S. Effects of Particle Size and Surface Modification on Cellular Uptake and Biodistribution of Polymeric Nanoparticles for Drug Delivery. Pharm. Res. 2013, 30, 2512–2522. [Google Scholar] [CrossRef]
- Weisbrod, A.V.; Woodburn, K.B.; Koelmans, A.A.; Parkerton, T.F.; McElroy, A.E.; Borgå, K. Evaluation of Bioaccumulation Using In Vivo Laboratory and Field Studies. Integr. Environ. Assess. Manag. 2009, 5, 598–623. [Google Scholar] [CrossRef]
- Rodríguez-Seijo, A.; da Costa, J.P.; Rocha-Santos, T.; Duarte, A.C.; Pereira, R. Oxidative Stress, Energy Metabolism and Molecular Responses of Earthworms (Eisenia fetida) Exposed to Low-Density Polyethylene Microplastics. Environ. Sci. Pollut. Res. 2018, 25, 33599–33610. [Google Scholar] [CrossRef]
- Mendis, E.; Kim, M.-M.; Rajapakse, N.; Kim, S.-K. An in Vitro Cellular Analysis of the Radical Scavenging Efficacy of Chitooligosaccharides. Life Sci. 2007, 80, 2118–2127. [Google Scholar] [CrossRef] [PubMed]
- Yan, L.; Wang, P.; Zhao, C.; Zhang, B.; Zhang, B.; Guo, J.; Qiu, L. Development of a Spotted Sea Bass (Lateolabrax maculatus) Bulbus Arteriosus Cell Line and Its Application to Fish Virology and Immunology. Fish Shellfish Immunol. 2024, 144, 109298. [Google Scholar] [CrossRef] [PubMed]
- Louisse, J.; de Jong, E.; van de Sandt, J.J.M.; Blaauboer, B.J.; Woutersen, R.A.; Piersma, A.H.; Rietjens, I.M.C.M.; Verwei, M. The Use of In Vitro Toxicity Data and Physiologically Based Kinetic Modeling to Predict Dose-Response Curves for In Vivo Developmental Toxicity of Glycol Ethers in Rat and Man. Toxicol. Sci. 2010, 118, 470–484. [Google Scholar] [CrossRef] [PubMed]
- Fröhlich, E. Comparison of Conventional and Advanced in Vitro Models in the Toxicity Testing of Nanoparticles. Artif. Cells Nanomed. Biotechnol. 2018, 46, 1091–1107. [Google Scholar] [CrossRef]
- Aarattuthodi, S.; Dharan, V.; Koshy, M. Fish Cell Cultures-Uses and Prospects. J. Aquac. Res. Dev. 2021, 13, 667. [Google Scholar]
- Verdile, N.; Camin, F.; Pavlovic, R.; Pasquariello, R.; Stuknyté, M.; De Noni, I.; Brevini, T.A.L.; Gandolfi, F. Distinct Organotypic Platforms Modulate Rainbow Trout (Oncorhynchus mykiss) Intestinal Cell Differentiation In Vitro. Cells 2023, 12, 1843. [Google Scholar] [CrossRef]
- Verdile, N.; Pasquariello, R.; Cardinaletti, G.; Tibaldi, E.; Brevini, T.A.L.; Gandolfi, F. Telocytes: Active Players in the Rainbow Trout (Oncorhynchus mykiss) Intestinal Stem-Cell Niche. Animals 2022, 12, 74. [Google Scholar] [CrossRef]
- Pasquariello, R.; Pavlovic, R.; Chacon, M.A.; Camin, F.; Verdile, N.; Løkka, G.; Panseri, S.; Faustini, M.; Tandler, A.; Peggs, D.; et al. Development of a Rainbow Trout (Oncorhynchus mykiss) Intestinal In Vitro Platform for Profiling Amino Acid Digestion and Absorption of a Complete Diet. Animals 2023, 13, 2278. [Google Scholar] [CrossRef]
- Verdile, N.; Camin, F.; Chacon, M.A.; Pasquariello, R.; Pavlovic, R.; Peggs, D.; Fontanillas, R.; Tandler, A.; Kortner, T.M.; Bitan, A.; et al. Evaluation of Rainbow Trout (Oncorhynchus mykiss) Organotypic Intestinal Platforms: Cellular Responses after Long-Term Exposure to In Vitro Digested Feed. Front. Mar. Sci. 2023, 10, 1239682. [Google Scholar] [CrossRef]
- Kapoor, B.G.; Smit, H.; Verighina, I.A. The Alimentary Canal and Digestion in Teleosts. In Advances in Marine Biology; Academic Press: Cambridge, MA, USA, 1976; Volume 13, pp. 109–239. [Google Scholar]
- Gonçalves, M.; Lopes, C.; Silva, P. Comparative Histological Description of the Intestine in Platyfish (Xiphophorus maculatus) and Swordtail Fish (Xiphophorus helleri). Tissue Cell 2024, 87, 102306. [Google Scholar] [CrossRef]
- De Marco, G.; Cappello, T.; Maisano, M. Histomorphological Changes in Fish Gut in Response to Prebiotics and Probiotics Treatment to Improve Their Health Status: A Review. Animals 2023, 13, 2860. [Google Scholar] [CrossRef] [PubMed]
- Pasquariello, R.; Verdile, N.; Pavlovic, R.; Panseri, S.; Schirmer, K.; Brevini, T.A.L.; Gandolfi, F. New Stable Cell Lines Derived from the Proximal and Distal Intestine of Rainbow Trout (Oncorhynchus mykiss) Retain Several Properties Observed In Vivo. Cells 2021, 10, 1555. [Google Scholar] [CrossRef] [PubMed]
- Conti, F.; Zarantoniello, M.; Antonucci, M.; Cattaneo, N.; Rattin, M.; De Russi, G.; Secci, G.; Lucon-Xiccato, T.; Lira de Medeiros, A.C.; Olivotto, I. The Application of Synthetic Flavors in Zebrafish (Danio rerio) Rearing with Emphasis on Attractive Ones: Effects on Fish Development, Welfare, and Appetite. Animals 2023, 13, 3368. [Google Scholar] [CrossRef] [PubMed]
- Richard, N.; Costas, B.; Machado, M.; Fernández-Boo, S.; Girons, A.; Dias, J.; Corraze, G.; Terrier, F.; Marchand, Y.; Skiba-Cassy, S. Inclusion of a Protein-Rich Yeast Fraction in Rainbow Trout Plant-Based Diet: Consequences on Growth Performances, Flesh Fatty Acid Profile and Health-Related Parameters. Aquaculture 2021, 544, 737132. [Google Scholar] [CrossRef]
- Mandal, S.C.; Weidmann, M.; Albalat, A.; Carrick, E.; Morro, B.; MacKenzie, S. Polarized Trout Epithelial Cells Regulate Transepithelial Electrical Resistance, Gene Expression, and the Phosphoproteome in Response to Viral Infection. Front. Immunol. 2020, 11, 564827. [Google Scholar] [CrossRef]
- Zarantoniello, M.; Pulido Rodriguez, L.F.; Randazzo, B.; Cardinaletti, G.; Giorgini, E.; Belloni, A.; Secci, G.; Faccenda, F.; Pulcini, D.; Parisi, G.; et al. Conventional Feed Additives or Red Claw Crayfish Meal and Dried Microbial Biomass as Feed Supplement in Fish Meal-Free Diets for Rainbow Trout (Oncorhynchus mykiss): Possible Ameliorative Effects on Growth and Gut Health Status. Aquaculture 2022, 554, 738137. [Google Scholar] [CrossRef]
- Castelvetro, V.; Corti, A.; Bianchi, S.; Giacomelli, G.; Manariti, A.; Vinciguerra, V. Microplastics in Fish Meal: Contamination Level Analyzed by Polymer Type, Including Polyester (PET), Polyolefins, and Polystyrene. Environ. Pollut. 2021, 273, 115792. [Google Scholar] [CrossRef]
- Hentschel, V.; Seufferlein, T.; Armacki, M. Intestinal Organoids in Coculture: Redefining the Boundaries of Gut Mucosa Ex Vivo Modeling. Am. J. Physiol.—Gastrointest. Liver Physiol. 2021, 321, G693–G704. [Google Scholar] [CrossRef]
- Lee, B.R.; Yang, H.; Lee, S.I.; Haq, I.; Ock, S.A.; Wi, H.; Lee, H.C.; Lee, P.; Yoo, J.G. Robust Three-Dimensional (3d) Expansion of Bovine Intestinal Organoids: An In Vitro Model as a Potential Alternative to an In Vivo System. Animals 2021, 11, 2115. [Google Scholar] [CrossRef]
- Pinto, E.P.; Scott, J.; Hess, K.; Paredes, E.; Bellas, J.; Gonzalez-Estrella, J.; Minghetti, M. Role of UV Radiation and Oxidation on Polyethylene Micro- and Nanoplastics: Impacts on Cadmium Sorption, Bioaccumulation, and Toxicity in Fish Intestinal Cells. Environ. Sci. Pollut. Res. 2024, 31, 47974–47990. [Google Scholar] [CrossRef]
- Dudefoi, W.; Ferrari, B.J.D.; Breider, F.; Masset, T.; Leger, G.; Vermeirssen, E.; Bergmann, A.J.; Schirmer, K. Evaluation of Tire Tread Particle Toxicity to Fish Using Rainbow Trout Cell Lines. Sci. Total Environ. 2024, 912, 168933. [Google Scholar] [CrossRef]
- Jakubowska, M.; Białowąs, M.; Stankevičiūtė, M.; Chomiczewska, A.; Pažusienė, J.; Jonko-Sobuś, K.; Hallmann, A.; Urban-Malinga, B. Effects of Chronic Exposure to Microplastics of Different Polymer Types on Early Life Stages of Sea Trout Salmo Trutta. Sci. Total Environ. 2020, 740, 139922. [Google Scholar] [CrossRef] [PubMed]
- Paul, M.B.; Fahrenson, C.; Givelet, L.; Herrmann, T.; Loeschner, K.; Böhmert, L.; Thünemann, A.F.; Braeuning, A.; Sieg, H. Beyond Microplastics—Investigation on Health Impacts of Submicron and Nanoplastic Particles after Oral Uptake In Vitro. Microplastics Nanoplastics 2022, 2, 16. [Google Scholar] [CrossRef]
- Cui, M.; He, Q.; Wang, Z.; Yu, Y.; Gao, H.; Liu, Z.; Peng, H.; Wang, H.; Zhang, X.; Li, D.; et al. Mucin2 Regulated by Ho1/P38/IL-10 Axis Plays a Protective Role in Polystyrene Nanoplastics-Mediated Intestinal Toxicity. Environ. Pollut. 2023, 330, 121808. [Google Scholar] [CrossRef] [PubMed]
- Fleury, J.-B.; Baulin, V.A. Microplastics Destabilize Lipid Membranes by Mechanical Stretching. Proc. Natl. Acad. Sci. USA 2021, 118, e2104610118. [Google Scholar] [CrossRef] [PubMed]
- Bjørgen, H.; Li, Y.; Kortner, T.M.; Krogdahl, Å.; Koppang, E.O. Anatomy, Immunology, Digestive Physiology and Microbiota of the Salmonid Intestine: Knowns and Unknowns under the Impact of an Expanding Industrialized Production. Fish Shellfish Immunol. 2020, 107, 172–186. [Google Scholar] [CrossRef]
- Wang, W.; Guan, J.; Feng, Y.; Nie, L.; Xu, Y.; Xu, H.; Fu, F. Polystyrene Microplastics Induced Nephrotoxicity Associated with Oxidative Stress, Inflammation, and Endoplasmic Reticulum Stress in Juvenile Rats. Front. Nutr. 2023, 9, 1059660. [Google Scholar] [CrossRef]
- Wang, F.; Zhang, Q.; Cui, J.; Bao, B.; Deng, X.; Liu, L.; Guo, M. Polystyrene Microplastics Induce Endoplasmic Reticulum Stress, Apoptosis and Inflammation by Disrupting the Gut Microbiota in Carp Intestines. Environ. Pollut. 2023, 323, 121233. [Google Scholar] [CrossRef]
- Rejman, J.; Oberle, V.; Zuhorn, I.S.; Hoekstra, D. Size-Dependent Internalization of Particles via the Pathways of Clathrin- and Caveolae-Mediated Endocytosis. Biochem. J. 2004, 377, 159–169. [Google Scholar] [CrossRef]
- Hou, Z.; Meng, R.; Chen, G.; Lai, T.; Qing, R.; Hao, S.; Deng, J.; Wang, B. Distinct Accumulation of Nanoplastics in Human Intestinal Organoids. Sci. Total Environ. 2022, 838, 155811. [Google Scholar] [CrossRef]
- Liu, L.; Xu, K.; Zhang, B.; Ye, Y.; Zhang, Q.; Jiang, W. Cellular Internalization and Release of Polystyrene Microplastics and Nanoplastics. Sci. Total Environ. 2021, 779, 146523. [Google Scholar] [CrossRef] [PubMed]
- Williams, T.M.; Lisanti, M.P. The Caveolin Proteins. Genome Biol. 2004, 5, 214. [Google Scholar] [CrossRef]
- Volonte, D.; Galbiati, F. Caveolin-1, a Master Regulator of Cellular Senescence. Cancer Metastasis Rev. 2020, 39, 397–414. [Google Scholar] [CrossRef] [PubMed]
- Simón, L.; Campos, A.; Leyton, L.; Quest, A.F.G. Caveolin-1 Function at the Plasma Membrane and in Intracellular Compartments in Cancer. Cancer Metastasis Rev. 2020, 39, 435–453. [Google Scholar] [CrossRef] [PubMed]
- Ni, K.; Wang, C.; Carnino, J.M.; Jin, Y. The Evolving Role of Caveolin-1: A Critical Regulator of Extracellular Vesicles. Med. Sci. 2020, 8, 46. [Google Scholar] [CrossRef]
- Lin, X.P.; Mintern, J.D.; Gleeson, P.A. Macropinocytosis in Different Cell Types: Similarities and Differences. Membranes 2020, 10, 177. [Google Scholar] [CrossRef]
- Kuhn, D.A.; Vanhecke, D.; Michen, B.; Blank, F.; Gehr, P.; Petri-Fink, A.; Rothen-Rutishauser, B. Different Endocytotic Uptake Mechanisms for Nanoparticles in Epithelial Cells and Macrophages. Beilstein J. Nanotechnol. 2014, 5, 1625–1636. [Google Scholar] [CrossRef]
- Firdessa, R.; Oelschlaeger, T.A.; Moll, H. Identification of Multiple Cellular Uptake Pathways of Polystyrene Nanoparticles and Factors Affecting the Uptake: Relevance for Drug Delivery Systems. Eur. J. Cell Biol. 2014, 93, 323–337. [Google Scholar] [CrossRef]
- Stock, V.; Böhmert, L.; Lisicki, E.; Block, R.; Cara-Carmona, J.; Pack, L.K.; Selb, R.; Lichtenstein, D.; Voss, L.; Henderson, C.J.; et al. Uptake and Effects of Orally Ingested Polystyrene Microplastic Particles In Vitro and In Vivo. Arch. Toxicol. 2019, 93, 1817–1833. [Google Scholar] [CrossRef]
- Perl, K.; Ushakov, K.; Pozniak, Y.; Yizhar-Barnea, O.; Bhonker, Y.; Shivatzki, S.; Geiger, T.; Avraham, K.B.; Shamir, R. Reduced Changes in Protein Compared to MRNA Levels across Non-Proliferating Tissues. BMC Genom. 2017, 18, 305. [Google Scholar] [CrossRef]
- Prabahar, A.; Zamora, R.; Barclay, D.; Yin, J.; Ramamoorthy, M.; Bagheri, A.; Johnson, S.A.; Badylak, S.; Vodovotz, Y.; Jiang, P. Unraveling the Complex Relationship between MRNA and Protein Abundances: A Machine Learning-Based Approach for Imputing Protein Levels from RNA-Seq Data. NAR Genom. Bioinforma. 2024, 6, lqae019. [Google Scholar] [CrossRef] [PubMed]
- Ram, A.K.; Vairappan, B. Role of Zonula Occludens in Gastrointestinal and Liver Cancers. World J. Clin. Cases 2022, 10, 3647–3661. [Google Scholar] [CrossRef] [PubMed]
- Xu, D.; Ma, Y.; Han, X.; Chen, Y. Systematic Toxicity Evaluation of Polystyrene Nanoplastics on Mice and Molecular Mechanism Investigation about Their Internalization into Caco-2 Cells. J. Hazard. Mater. 2021, 417, 126092. [Google Scholar] [CrossRef] [PubMed]
- Tornavaca, O.; Chia, M.; Dufton, N.; Almagro, L.O.; Conway, D.E.; Randi, A.M.; Schwartz, M.A.; Matter, K.; Balda, M.S. ZO-1 Controls Endothelial Adherens Junctions, Cell–Cell Tension, Angiogenesis, and Barrier Formation. J. Cell Biol. 2015, 208, 821–838. [Google Scholar] [CrossRef]
- Tyckaert, F.; Zanin, N.; Morsomme, P.; Renard, H.-F. Rac1, the Actin Cytoskeleton and Microtubules Are Key Players in Clathrin-Independent Endophilin-A3-Mediated Endocytosis. J. Cell Sci. 2022, 135, jcs259623. [Google Scholar] [CrossRef]
- Jou, T.-S.; Schneeberger, E.E.; James Nelson, W. Structural and Functional Regulation of Tight Junctions by RhoA and Rac1 Small GTPases. J. Cell Biol. 1998, 142, 101–115. [Google Scholar] [CrossRef]
- Slifer, Z.M.; Blikslager, A.T. The Integral Role of Tight Junction Proteins in the Repair of Injured Intestinal Epithelium. Int. J. Mol. Sci. 2020, 21, 972. [Google Scholar] [CrossRef]
- Cattaneo, N.; Zarantoniello, M.; Conti, F.; Tavano, A.; Frontini, A.; Sener, I.; Cardinaletti, G.; Olivotto, I. Natural-Based Solutions to Mitigate Dietary Microplastics Side Effects in Fish. Chemosphere 2024, 367, 143587. [Google Scholar] [CrossRef]












| Score | Descriptive Parameter | 
|---|---|
| 3 | cells having an intact ZO-1 | 
| 2 | cells having at least 1/4 of ZO-1 without fragmentation | 
| 1 | cells having a ZO-1 highly fragmented | 
| 0 | cells without ZO-1 | 
| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | AT (°C) | Source | Amplicon Size | 
|---|---|---|---|---|---|
| cltca | GGCTGTCCGTAACAATCTAGCTG | GCAGCCTCAGAGTAGTTTCCC | 58 | XM_036937421.1 | 90 | 
| cav1 | GTGCTACCGTCTCCTCACTG | ACCGCCCAGATGTGAATGAA | 59 | XM_021576628.2 | 96 | 
| rac1 | CAGCAGGACAGGAAGACTACG | ATCCAGCTTGGTGTCTCACCT | 58 | NM_001160673.1 | 147 | 
| oclna | TTTGGTGGTGCTGCCTATGG | GCCGTGATGAAGCTGAATGC | 57 | NM_01190446.1 [66] | 125 | 
| cldn3a | GGATCATTGCCATCGTGTCCT | AACACAGGTCATCCACAGGC | 59 | BK007964.1 [66] | 113 | 
| ZO-1 | AAGGAAGGTCTGGAGGAAGG | CAGCTTGCCGTTGTAGAGG | 58 | HQ656020 [67] | 291 | 
| b-actin (hk) | AGACCACCTTCAACTCCATCAT | AGAGGTGATCTCCTTCTGCATC | 59 | AJ438158.1 [68] | 131 | 
| rl31 (hk) | TTCCTGTCACGACATACAAAGG | GTAAGCAGAAATTGCACCATCA | 60 | NM_001165047.2 [68] | 157 | 
| Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. | 
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Verdile, N.; Cattaneo, N.; Camin, F.; Zarantoniello, M.; Conti, F.; Cardinaletti, G.; Brevini, T.A.L.; Olivotto, I.; Gandolfi, F. New Insights in Microplastic Cellular Uptake Through a Cell-Based Organotypic Rainbow-Trout (Oncorhynchus mykiss) Intestinal Platform. Cells 2025, 14, 44. https://doi.org/10.3390/cells14010044
Verdile N, Cattaneo N, Camin F, Zarantoniello M, Conti F, Cardinaletti G, Brevini TAL, Olivotto I, Gandolfi F. New Insights in Microplastic Cellular Uptake Through a Cell-Based Organotypic Rainbow-Trout (Oncorhynchus mykiss) Intestinal Platform. Cells. 2025; 14(1):44. https://doi.org/10.3390/cells14010044
Chicago/Turabian StyleVerdile, Nicole, Nico Cattaneo, Federica Camin, Matteo Zarantoniello, Federico Conti, Gloriana Cardinaletti, Tiziana A. L. Brevini, Ike Olivotto, and Fulvio Gandolfi. 2025. "New Insights in Microplastic Cellular Uptake Through a Cell-Based Organotypic Rainbow-Trout (Oncorhynchus mykiss) Intestinal Platform" Cells 14, no. 1: 44. https://doi.org/10.3390/cells14010044
APA StyleVerdile, N., Cattaneo, N., Camin, F., Zarantoniello, M., Conti, F., Cardinaletti, G., Brevini, T. A. L., Olivotto, I., & Gandolfi, F. (2025). New Insights in Microplastic Cellular Uptake Through a Cell-Based Organotypic Rainbow-Trout (Oncorhynchus mykiss) Intestinal Platform. Cells, 14(1), 44. https://doi.org/10.3390/cells14010044
 
        



 
       